GEO Profile Links for Gene (Select 101996) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 35

<< First< Prev

Page of 2

Next >Last >>

Select item 932477291.

AI121036 - Endothelial cells from P8 neonatal retina [MG_U74Cv2]

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS4463, AI121036

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 93247729

GEO DataSets Gene Profile neighbors

Select item 295267292.

AI121036 - Uniparental duplication of chromosome 7 regions effect on various tissues (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS2285, AI121036

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 29526729

GEO DataSets Gene Profile neighbors

Select item 273239293.

AI121036 - Type 1 diabetes model: autoimmune target organs (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS2179, AI121036

DataSet type:: Expression profiling by array, count, 39 samples

ID:: 27323929

GEO DataSets Gene Profile neighbors

Select item 76050224.

AI121036 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCTGATAATCACGGTC (ID_REF), GDS878, AI121036

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7605022

GEO DataSets Gene Profile neighbors

Select item 215072295.

AI121036 - Myotube response to PGC-1alpha induced mitochondrial biogenesis: time course (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS1880, AI121036

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 21507229

GEO DataSets Gene Profile neighbors

Select item 12615296.

AI121036 - Hyperoxic lung injury (U74Cv2)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS249, AI121036

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 1261529

GEO DataSets Gene Profile neighbors

Select item 164969297.

AI121036 - Follicular dendritic cell enriched splenocytes (MG U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS1600, AI121036

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 16496929

GEO DataSets Gene Profile neighbors

Select item 47857298.

AI121036 - Spermatogenesis and testis development time course (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS607, AI121036

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4785729

GEO DataSets Gene Profile neighbors

Select item 169775299.

AI121036 - Osteoblast differentiation (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS1633, AI121036

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 16977529

GEO DataSets Gene Profile neighbors

Select item 3035532910.

AI121036 - Acute myocardial infarction model: time course (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS2331, AI121036

DataSet type:: Expression profiling by array, count, 66 samples

ID:: 30355329

GEO DataSets Gene

Select item 700032911.

AI121036 - Spermatogonia in Zfp145 knockout (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS837, AI121036

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 7000329

GEO DataSets Gene Profile neighbors

Select item 392222912.

AI121036 - Intestinal tract gene expression (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS524, AI121036

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 3922229

GEO DataSets Gene Profile neighbors

Select item 5530192913.

AI121036 - Visual cortex during the critical period for ocular dominance (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS3382, AI121036

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 55301929

GEO DataSets Gene Profile neighbors

Select item 2321942914.

AI121036 - Primary visual cortex response to visual input deprivation (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS1986, AI121036

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23219429

GEO DataSets Gene Profile neighbors

Select item 2242322915.

AI121036 - Positively selected H-2b T cell receptor transgenic thymocytes (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS1936, AI121036

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 22423229

GEO DataSets Gene Profile neighbors

Select item 416702916.

AI121036 - Mesangioblast stem cell clone comparison (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS555, AI121036

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 4167029

GEO DataSets Gene Profile neighbors

Select item 37192917.

AI121036 - Lung hypertension recovery (U74Cv2)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS61, AI121036

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 371929

GEO DataSets Gene Profile neighbors

Select item 457862918.

AI121036 - Myogenic differentiation timecourse (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS587, AI121036

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 4578629

GEO DataSets Gene Profile neighbors

Select item 2324462919.

AI121036 - Airway disease trait manifestation in various genetic backgrounds: lungs (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS1988, AI121036

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23244629

GEO DataSets Gene Profile neighbors

Select item 5719142920.

AI121036 - Embryonic stem cell response to STAT3 overexpression in vitro (MG-U74C)

Annotation:: AI121036, expressed sequence AI121036

Organism:: Mus musculus

Reporter:: GPL83, 133240_at (ID_REF), GDS3446, AI121036

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 57191429

GEO DataSets Gene Profile neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 101996) (35)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 35

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity