GEO Profile Links for Gene (Select 100504262) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 13

Select item 971276921.

A730020E08Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100107758_TGI_at (ID_REF), GDS4495, AK043607

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97127692

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 74896042.

A730020E08Rik - MPSS transcriptome analysis project

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCATAGTTCCGAAAGTTG (ID_REF), GDS868, AK042736

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7489604

GEO DataSets Gene Chromosome neighbors

Select item 978406923.

A730020E08Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100107758_TGI_at (ID_REF), GDS4527, AK043607

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97840692

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 395779594.

A730020E08Rik - Wilms' tumor protein Wt1 deficiency effect on the urogenital ridge

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL1524, 6159 (ID_REF), GDS2747, BB263571

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 39577959

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 644472925.

A730020E08Rik - Hypertension model: kidney

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100107758_TGI_at (ID_REF), GDS3675, AK043607

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64447292

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 468274036.

A730020E08Rik - Dicer inactivation effect on the embryonic heart

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL5025, 29903 (ID_REF), GDS3033, AK042736

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46827403

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 76273047.

A730020E08Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCATAGTTCCGAAAGTTG (ID_REF), GDS878, AK042736

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7627304

GEO DataSets Gene Chromosome neighbors

Select item 921520968.

A730020E08Rik - CD-1 neuronal stem cell response to microRNA-128 mimic

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL13455, XR_107822_at (ID_REF), GDS4415, XR_107822

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 92152096

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 921499279.

A730020E08Rik - CD-1 neuronal stem cell response to microRNA-128 mimic

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL13455, XR_105051_at (ID_REF), GDS4415, XR_105051

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 92149927

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 892985910.

A730020E08Rik - DNase II and type I interferon receptor double null mutation effect on fetal liver

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL1524, 6159 (ID_REF), GDS996, BB263571

DataSet type:: Expression profiling by array, count, 3 samples

ID:: 8929859

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6432849211.

A730020E08Rik - Hypertension model: aorta

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100107758_TGI_at (ID_REF), GDS3672, AK043607

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64328492

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6436809212.

A730020E08Rik - Hypertension model: heart

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100107758_TGI_at (ID_REF), GDS3673, AK043607

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64368092

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6440769213.

A730020E08Rik - Hypertension model: liver

Annotation:: A730020E08Rik, RIKEN cDNA A730020E08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100107758_TGI_at (ID_REF), GDS3674, AK043607

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64407692

GEO DataSets Gene Profile neighbors Chromosome neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 100504262) (13)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 13

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity