#ID = Feature Number
#Row = 
#Col = 
#chr_coord = 
#SubTypeMask = 
#SubTypeName = 
#Start = 
#SEQUENCE = 
#ProbeUID = 
#ControlType = 
#ProbeName = 
#GeneName = 
#SystematicName = 
#Description = 
#SPOT_ID = 
ID	Row	Col	chr_coord	SubTypeMask	SubTypeName	Start	SEQUENCE	ProbeUID	ControlType	ProbeName	GeneName	SystematicName	Description	SPOT_ID
1	1	1		260	BrightCorner	0		0	1	GE_BrightCorner	GE_BrightCorner	GE_BrightCorner		CONTROL
2	1	2		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
3	1	3		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
4	1	4	unmapped	0		0	TACATTCCTGAGTTTGGACTGGTGCCCTGCTTTTTGGTGGATGCTTGTTCATTTCTTCTG	3	0	UF_Msa_AF_109538	contig28184___1rc_nr1nt0	contig28184___1rc_nr1nt0	Unknown	
5	1	5	unmapped	0		0	ATCAGCCACACACATTTCATGCGGCCCAACCGACGTGATGGATAATGCACATGCCGGGTC	5	0	UF_Msa_CF_125002	contig05280___0rc	contig05280___0rc	Unknown	
6	1	6	unmapped	0		0	AGTCACGTCAGGCAGCGGCACTTCCTCAGTTCGTTCTTCGGTGGTGCTGGGATCACGCTG	7	0	UF_Msa_CF_125378	LMB_S454.767.C1___0	LMB_S454.767.C1___0	Unknown	
7	1	7	unmapped	0		0	ATGGAGCAGCCATCACCCACAAATGACTCCAAGCATCTGCAGGAGGACACAGAGAGGGCC	9	0	UF_Msa_CF_124689	contig18063___0	contig18063___0	Unknown	
8	1	8	unmapped	0		0	ATCTCATCACAGTTGGAAGTTTGACAGTGATTATGCGGGACAAGGAAATAGATGTTGCAG	11	0	UF_Msa_CF_126632	contig20863___0	contig20863___0	Unknown	
9	1	9	unmapped	0		0	CCGTCTGCTCTGTGAGGTTGTTTCGACCACACTGCAGTTTGGTTACTCCAAGCAGAAGTG	13	0	UF_Msa_CF_120586	contig00574___0	contig00574___0	Unknown	
10	1	10	unmapped	0		0	ATACCCTATCACTTACTGAGCAGGATCAACTTTCTCTGGCTTGTGAACTGAACCCATACC	15	0	UF_Msa_AF_102349	contig13776___1_nr0nt	contig13776___1_nr0nt	Unknown	
11	1	11	unmapped	0		0	GTTGTGATGATGGAAGTTTACAGCTGCTTGGATTGTGCGAAGACTGCAACGATGGAGGAG	17	0	UF_Msa_CF_118056	contig07154___0	contig07154___0	Unknown	
12	1	12	unmapped	0		0	CAGAACATCGACTCAGTTCAAAACAGCATAGTGTGAATAATACTGAAGAGAAAGAGAACA	19	0	UF_Msa_CF_122526	contig28460___0	contig28460___0	Unknown	
13	1	13	unmapped	0		0	CCTGAAGAGAAGGCGAGTCCACGGCTAAAAATATAATAGCTAACACAAGATGGCCGGTTT	21	0	UF_Msa_CF_122303	contig30948___0	contig30948___0	Unknown	
14	1	14	unmapped	0		0	ATGGCGGCTGCTGCACGGTTCTTCATCCGAGGTGCACACTCGAGGCTTTCCATCTCCGGT	23	0	UF_Msa_CF_122930	contig04243___0	contig04243___0	Unknown	
15	1	15	unmapped	0		0	GCCAGAAGGACCTCAGACAAATTTAATGAATGGAATAAAATAAGCAGAATGCTTCTCATT	25	0	UF_Msa_CF_125231	contig27010___0	contig27010___0	Unknown	
16	1	16	unmapped	0		0	CCTGTGATCTGTTTTTCTGTACTGAGTAACTTTGTCTGTCTCTCAAACATGCAAAGCATT	27	0	UF_Msa_CF_123297	contig02340___0	contig02340___0	Unknown	
17	1	17	unmapped	0		0	CCTGTGTGTCCTTCCTGGGCTTCCTGGGAGCTCTGAAGGAGAACCGCTGTCTCCTCCTGA	29	0	UF_Msa_AF_100367	contig26772___1rc_nrnt0	contig26772___1rc_nrnt0	Unknown	
18	1	18	unmapped	0		0	TACCAGCAGGTGATGGCCTGGCACCAGAGGCACAGGCGTGCATACCGAAAGGCCTTTGAG	31	0	UF_Msa_AF_109775	contig13093___1rc_nrnt	contig13093___1rc_nrnt	Unknown	
19	1	19	unmapped	0		0	CATGGCGAACCTCGAGCATGCTGAGGACAACCCAAAAACATGTGAAAATGTCTGGTGACG	33	0	UF_Msa_CF_120304	contig25333___0	contig25333___0	Unknown	
20	1	20	unmapped	0		0	AAACGTGTTTCTGGGGGAGGTGGAGGTGTCTCTGGGCCTGTGGGACTGGACCTGCACTCA	35	0	UF_Msa_AF_101251	contig03642___1rc_nr1nt0	contig03642___1rc_nr1nt0	Unknown	
21	1	21	unmapped	0		0	ACAATGGTGCCATATTTGGTGTTATAGTAGTTGCACGCTGTTCCTATCCCAGTCCAGATG	37	0	UF_Msa_AD_200268	LMB_Add_14_rc	LMB_Add_14_rc	Unknown	
22	1	22	unmapped	0		0	TTCAGGTCCCTGGTGAGGAAATACAACTGTGATATCTGCTTCACCCCAATGATAGTTGCT	39	0	UF_Msa_AF_103885	contig03751___1rc_nrnt	contig03751___1rc_nrnt	Unknown	
23	1	23	unmapped	0		0	TATGACACCAACTCAGGACTCTCTGCTTTCAAGCCGTCTCATCTGCTTCTGAGTTATCTT	41	0	UF_Msa_AF_103298	contig13087___1_nr0nt	contig13087___1_nr0nt	Unknown	
24	1	24	unmapped	0		0	TGTTACTGCAAACAATCGCTGCACAGTCTGTTTCTGCTGTCTATTAAAGTGTAATATGGA	43	0	UF_Msa_AF_104126	contig31665___1_nr0nt	contig31665___1_nr0nt	Unknown	
25	1	25	unmapped	0		0	ACTGTGTTTGAGAGGTCCGTGGCTCTACGTGTGAGGTTTGAGCGGCTGAGTTTACCGCTG	45	0	UF_Msa_AF_101077	contig15624___1_nr0nt	contig15624___1_nr0nt	Unknown	
26	1	26	unmapped	0		0	TATGAATCTTTTGTGAAATTCACACAAGACCAGATCATGCGAAGATACGGAGCCCGGCCT	47	0	UF_Msa_AF_109415	contig03814___1_nrnt	contig03814___1_nrnt	Unknown	
27	1	27	unmapped	0		0	AATGACTACAGGAAGGATCCATACTCCAAGGGTGACCCCTGCAAGTCCATCTGCTGCCGG	49	0	UF_Msa_AF_102560	contig19710___1_nrnt0	contig19710___1_nrnt0	Unknown	
28	1	28	unmapped	0		0	GGAACAGCAGACACACCTGGCTGTACCAGGGTAAAGGAGCTCACCAAGTCCTCCAAGACA	51	0	UF_Msa_AF_100182	contig11913___1rc_nrnt-1	contig11913___1rc_nrnt-1	Unknown	
29	1	29	unmapped	0		0	TGTTTCTTTGGACTTGGCAGTAGCACGCTATTGTGAACTGGTCAGAGCACATGAAGTCAT	53	0	UF_Msa_AF_101921	contig25748___1_nrnt	contig25748___1_nrnt	Unknown	
30	1	30	unmapped	0		0	TTGTTTCCTTCCTCGACGTCAAGAACATAATCCTGGGGAAATCGCACTACATTCTCTACG	55	0	UF_Msa_AF_107898	contig31154___1_nrnt	contig31154___1_nrnt	Unknown	
31	1	31	unmapped	0		0	CAGTGACGCTGTCTGCTGTTGCAGCAGGGGCCGACCGCACCCAGCAGGGCTGAGCTTGCC	57	0	UF_Msa_CF_119179	contig12150___0	contig12150___0	Unknown	
32	1	32	unmapped	0		0	GAAAAAGAAAGGAAGAGAGAGGATGAGAGACGAAGGAGGCAAATGACAAACATGATGAAA	59	0	UF_Msa_CF_118563	contig26018___0	contig26018___0	Unknown	
33	1	33	unmapped	0		0	GATGAGTTTAGATGATGATGAAAAGTTAATTCTGCAAGATGGCCAAACCCTTAGAGCTGC	61	0	UF_Msa_AF_107270	contig25945___1rc_nrnt0	contig25945___1rc_nrnt0	Unknown	
34	1	34	unmapped	0		0	GTGTTCGGTCTGTTGGTCGTGGTAAATTTACACTTTGAGCCTCACAGATCGACTGGAAAA	63	0	UF_Msa_CF_126926	contig22766___0	contig22766___0	Unknown	
35	1	35	unmapped	0		0	GTCTGCCTGTCGCTGCTGGTGTCCTCGTCGCCATTTTTACCTCTAAGAATGATCGCGGTC	65	0	UF_Msa_CF_120438	contig32528___0rc	contig32528___0rc	Unknown	
36	1	36	unmapped	0		0	TGAGACAGGTTAGTTTTACCCTACTGATGATGTGTTGTTGCAATAGTAATCCTGCTCAGT	67	0	UF_Msa_AD_200321	LMB_Add_47_rc	LMB_Add_47_rc	Unknown	
37	1	37	unmapped	0		0	GCAGTTGCAGCAGAAAAGTGTGAAATACAGATACACCTGGAGCGGACTAAACAGGATATT	69	0	UF_Msa_CF_126349	contig20616___0rc	contig20616___0rc	Unknown	
38	1	38	unmapped	0		0	GGTGATGTCTGGAAACACGGCATATCCCGTCATCAACTGCCCACCTCTCACTCCAGACTG	71	0	UF_Msa_AF_104573	contig29157___1rc_nrnt	contig29157___1rc_nrnt	Unknown	
39	1	39	unmapped	0		0	AAGTGCATCATTCAGATGTCAGGAAACACCACAACAATCCTGAACCCCAAACAGCCAAAA	73	0	UF_Msa_AF_101202	contig20339___1rc_nrnt	contig20339___1rc_nrnt	Unknown	
40	1	40	unmapped	0		0	CTCTGGGACACACCGACACCCAGGAGGAGACATTCACAGCATCGTGATACCATTGTGATG	75	0	UF_Msa_CF_119066	contig00073___0	contig00073___0	Unknown	
41	1	41	unmapped	0		0	ATTTTCTTTGGGAGTAAACTCCTGTCACTAAGATGAACGTGGGCTTTGAGATCGAAGGGC	77	0	UF_Msa_CF_121012	contig28118___0rc	contig28118___0rc	Unknown	
42	1	42	unmapped	0		0	GCTGCATCACCAAGCTGGCCAGCAGTGCCAAGAGACCTGCTAACACCACCACCATCGCCA	79	0	UF_Msa_CF_118538	contig32760___0rc	contig32760___0rc	Unknown	
43	1	43	unmapped	0		0	TGGCATTGTTGTCTGGTCCTCCAGGTTTGGGGAAGACCACCCTGGCCCACATCATAGCAA	81	0	UF_Msa_AF_101071	contig05241___1_nrnt0	contig05241___1_nrnt0	Unknown	
44	1	44	unmapped	0		0	TGGAGGAGCTGTGGCTTTATGCTGCATTGTCATGTCTCTCGGCCAGTGACTGCGTTGTCC	83	0	UF_Msa_CF_126000	contig08409___0rc	contig08409___0rc	Unknown	
45	1	45	unmapped	0		0	ACCACGAACCCGAGATGGACCATTACAAGCCGTTCACGACCATGTCTGAGACTTTCATCC	85	0	UF_Msa_CF_118672	contig09234___0	contig09234___0	Unknown	
46	1	46	unmapped	0		0	ATGTCAATGCTGCCATTCTCAAGAAGGTGATTCAGTGGTGCACTCATCACAAAGATGACC	87	0	UF_Msa_AF_108316	contig30581___1rc_nrnt	contig30581___1rc_nrnt	Unknown	
47	1	47	unmapped	0		0	AAACTATAAAACTTATTTGTGGGTTCGCTGGAGGTTCTGCCGTTATAGTCTTCGCGGCTG	89	0	UF_Msa_AF_106475	contig32147___1rc_nr1nt0	contig32147___1rc_nr1nt0	Unknown	
48	1	48	unmapped	0		0	AGGAACTGGTGATAGCTGGAAACCCAGATCAACAGGAAGACACGCTGGATGACCAGTACC	91	0	UF_Msa_AF_108204	LMB_S454.862.C1___1_nrnt	LMB_S454.862.C1___1_nrnt	Unknown	
49	1	49	unmapped	0		0	GACACCTTTCAGGAACTTTCTAGAGGGTGACTTCAAAACCATCCAGAAAGAACGGAAGCT	93	0	UF_Msa_AF_108836	contig13063___1rc_nrnt0	contig13063___1rc_nrnt0	Unknown	
50	1	50	unmapped	0		0	TTTATACGAGGAGAAGAAATTGCGTCAAATGGACTCGCCAGCTAAAACCCGTCAGTCAAC	95	0	UF_Msa_CF_121498	contig22689___0rc	contig22689___0rc	Unknown	
51	1	51	unmapped	0		0	TCAGCAGTTTCGTTCTCTGCACATCCAAAAGTTTCAATTCTGTCCTCTTCTCTTATCATC	97	0	UF_Msa_CF_125480	contig24121___0	contig24121___0	Unknown	
52	1	52	unmapped	0		0	AGCCTCGCTCCGCCACCACATGCTGTTCATAACATCCAGGAGTTATCACTAACATTAATA	99	0	UF_Msa_AF_100776	contig02226___1_nr0nt1	contig02226___1_nr0nt1	Unknown	
53	1	53	unmapped	0		0	TTACAAAGCAGGCCATGGCCAAGTGCTTTACCTGGGACTGAACTTTTTTCTGCTTCAGTT	101	0	UF_Msa_CF_123401	contig19118___0rc	contig19118___0rc	Unknown	
54	1	54	unmapped	0		0	TCGGTGATGAGAGAAAATGTGAGGGAGAAACTGAAAGAACACCTAGAGGGATTTCACCTT	103	0	UF_Msa_CF_125208	contig19776___0rc	contig19776___0rc	Unknown	
55	1	55	unmapped	0		0	CCTGGTGTACTCAGTTTTTCATTTCAATCCTGTGGCCTCAATTGGTTTCGCAAAGTGCGA	105	0	UF_Msa_AF_106915	contig01961___1rc_nr0nt1	contig01961___1rc_nr0nt1	Unknown	
56	1	56	unmapped	0		0	ACGACTTGATGCTCAGTGTTCTTGTGAAACCAGTGGAAGTCAAACCAAGTAAACAATGCC	107	0	UF_Msa_CF_125006	contig14199___0rc	contig14199___0rc	Unknown	
57	1	57	unmapped	0		0	AATCTCAATGAGTGAAGCTCAAACTTCATCGGAAATACCTGGTGTGGCAGAGCTTACGAG	109	0	UF_Msa_CF_124835	contig32856___0	contig32856___0	Unknown	
58	1	58	unmapped	0		0	TGTAAAGCCAATGGTCAGGTCAGCGGTCAGGTCCCAGGCACAGGTTTGGTTAATGGAGCC	111	0	UF_Msa_CF_126758	contig11473___0rc	contig11473___0rc	Unknown	
59	1	59	unmapped	0		0	TGCAGTTGCTCCATAAATCCAGTGTCTGTGCTTGGGTTCATATGGATGTTAATAAAACCC	113	0	UF_Msa_AF_103423	LMB_S454.sd.412.C1___1_nrnt	LMB_S454.sd.412.C1___1_nrnt	Unknown	
60	1	60	unmapped	0		0	GAGCCATGCTCCGGCTGACCTGTACCTGATGACCAAAAACCCGCAAGATTCTCCCAACGT	115	0	UF_Msa_AF_100712	contig02553___1rc_nrnt-1	contig02553___1rc_nrnt-1	Unknown	
61	1	61	unmapped	0		0	GGTGGGTGATATATGTCTCGGAAAAGCGTGATACAGCGAAGTTTTACTGCTTAACAATCC	117	0	UF_Msa_CF_123340	contig02263___0	contig02263___0	Unknown	
62	1	62	unmapped	0		0	CAGCTGGCATCGGGCGAAAGGCAGGGAACACCCTGGACAGCAGTTCTCACCGGGACAGCA	119	0	UF_Msa_AF_108542	contig06612___1_nr0nt1	contig06612___1_nr0nt1	Unknown	
63	1	63	unmapped	0		0	TATAGAAGAACATTTCCACGCTTCAGAGCAACAAGCAGCTTTGTTGTTCAACACTTTGAT	121	0	UF_Msa_CF_127168	contig28333___0rc	contig28333___0rc	Unknown	
64	1	64	unmapped	0		0	TTCGACACATATATTGGTTGAGGGGCGGAGCCCGTATACTTTTAATCGAACCCAAAAGCA	123	0	UF_Msa_CF_117726	GP3-1C11.g___0rc	GP3-1C11.g___0rc	Unknown	
65	1	65	unmapped	0		0	TGGACAGCAAAGCACGGGATTTCTGGATCAGAATGATCTAGATTAAAGGGGACGGATTAC	125	0	UF_Msa_CF_126265	contig22271___0rc	contig22271___0rc	Unknown	
66	1	66	unmapped	0		0	AATATCAGCTTGGATGAAGATCCAGAAGTGCGATGGCTGCCTCTGATCAAAGTCTTTGAC	127	0	UF_Msa_CF_119043	contig05333___0	contig05333___0	Unknown	
67	1	67	unmapped	0		0	TAACATCAACTACTTGGCAGTCAGAGCCCTCCACCACTATAGTAACACAGAAGGACCATA	129	0	UF_Msa_AF_103745	contig14090___1rc_nr1nt0	contig14090___1rc_nr1nt0	Unknown	
68	1	68	unmapped	0		0	GTGAAATCCCAGTATCCTCTGACGTTTGAAGAGATAGAAACAGTTCTATGGATACATGCT	131	0	UF_Msa_CF_120573	contig24129___0rc	contig24129___0rc	Unknown	
69	1	69	unmapped	0		0	TTTGAAGGCACACAGGAAGTGACATCACAAACATCAACACACAGTTCAGTTCGTCCTCCT	133	0	UF_Msa_CF_121827	contig03062___0	contig03062___0	Unknown	
70	1	70	unmapped	0		0	ATGTGAGAAACTGCAGGTGTCTCTCGTGTAGTACTTTGCTGGAGTATTTCAGTAACTGGG	135	0	UF_Msa_CF_124575	contig12637___0rc	contig12637___0rc	Unknown	
71	1	71	unmapped	0		0	ACACACAGTCCTCCTTGATATACCTGCTGCTCGAGTGTTTAAGGGTTGAAAGACATCCAT	137	0	UF_Msa_AF_100709	contig10187___1_nrnt0	contig10187___1_nrnt0	Unknown	
72	1	72	unmapped	0		0	ATTTACACAACAGAGGTGTTCCCTACAGAAAACAGAGCCTTAGCACTGGGGATTTGCAGT	139	0	UF_Msa_AF_104183	contig06140___1_nr1nt0	contig06140___1_nr1nt0	Unknown	
73	1	73	unmapped	0		0	TGTATCTGGCCAGAGGCCTGACAGACAGATGGACGCCAAAGTAAAGACTTCATATCTTAT	141	0	UF_Msa_CF_127651	contig11572___0	contig11572___0	Unknown	
74	1	74	unmapped	0		0	TTATTCCCTTTGTGGTGATTGGCCTACTCTACAGTCTGACTAGACCTGAGCTTTCATCTG	143	0	UF_Msa_AF_104466	contig03869___1rc_nr1nt0	contig03869___1rc_nr1nt0	Unknown	
75	1	75	unmapped	0		0	AGCCAAGTGACCCGACCTTCACAGGAATCACTATGAGAGAAAGGCTGACAAAAAAGAAAG	145	0	UF_Msa_CF_121398	contig14753___0rc	contig14753___0rc	Unknown	
76	1	76	unmapped	0		0	GGGGCTGGTTACAAATAACAACCTCACCTTTCAATAATAGTTAAGACTTCTTCCAAATAA	147	0	UF_Msa_CF_125293	contig32816___0rc	contig32816___0rc	Unknown	
77	1	77	unmapped	0		0	TCCTGTTCAACCAAGGAGTGGGCTGTAAAGAAGGAGCTGGCTTCCACAAGCTGTGTGGCG	149	0	UF_Msa_AF_106501	contig32833___1_nrnt0	contig32833___1_nrnt0	Unknown	
78	1	78	unmapped	0		0	ACGTGTGCGAGATTCGCTGTCAGACTGTGTACATGGGAACAGGATACGGGCGGGATGAGT	151	0	UF_Msa_AF_108240	contig05030___1_nrnt0	contig05030___1_nrnt0	Unknown	
79	1	79	unmapped	0		0	TTTGTGAACGGTTTACCACCAGCAAACTCCAGACTTTTGAGGACCTCTCAGCTATTGCAA	153	0	UF_Msa_AF_100963	contig21681___1rc_nr1nt0	contig21681___1rc_nr1nt0	Unknown	
80	1	80		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
81	1	81		260	BrightCorner	0		0	1	GE_BrightCorner	GE_BrightCorner	GE_BrightCorner		CONTROL
82	1	82		260	BrightCorner	0		0	1	GE_BrightCorner	GE_BrightCorner	GE_BrightCorner		CONTROL
83	2	1		260	BrightCorner	0		0	1	GE_BrightCorner	GE_BrightCorner	GE_BrightCorner		CONTROL
84	2	2		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
85	2	3	unmapped	0		0	TACAGTCTTCCGCCGCTGTCAAGGGCATCGAAAACTAACATTAGCCAGACCTAGCAGTGG	2	0	UF_Msa_CF_118290	contig22396___0	contig22396___0	Unknown	
86	2	4	unmapped	0		0	TATGTTATGGACCAGTTTCGTAAGAATAAGGTAACAGGAGAAAGGTACTGCCGTGCCCAG	4	0	UF_Msa_AF_110196	contig25107___1rc_nrnt-1	contig25107___1rc_nrnt-1	Unknown	
87	2	5	unmapped	0		0	TACTAAGTTAAAAGCTGATTCATCCGGCATAGGAAACGAATGCCGAGAGTGATTATCGAT	6	0	UF_Msa_CF_127029	LMB_S454.640.C1___0rc	LMB_S454.640.C1___0rc	Unknown	
88	2	6	unmapped	0		0	ACCGTGGCCTTACTGCGACAGAGGTCACTGAAGGCCCGTATGAACAGAAATGCCTGCTTG	8	0	UF_Msa_CF_125288	contig22962___0	contig22962___0	Unknown	
89	2	7	unmapped	0		0	CTCAGGATTTTGGTCACAGAAATAACAAGATGCACGTCTTGCTGGCACAGGAGCAGAATC	10	0	UF_Msa_CF_123321	contig10652___0rc	contig10652___0rc	Unknown	
90	2	8	unmapped	0		0	CCCTGTTCCTGTGAATGTTTCAGGTCAGCAGCTCGCTGGTGTCTCCTCCAAGTCTGTCTC	12	0	UF_Msa_CF_119489	contig15945___0rc	contig15945___0rc	Unknown	
91	2	9	unmapped	0		0	TGAATCTCTGCTCAAAGTGTTTTGCAGATATTCAGAAGAAACAGCCAGACAATGATTGTG	14	0	UF_Msa_AF_105785	contig02317___1rc_nrnt	contig02317___1rc_nrnt	Unknown	
92	2	10	unmapped	0		0	GGTTATGCCTGGCTCTTTGTCAGCACCACCATCCCTCACTGTGGATACCACCTCCCCTTC	16	0	UF_Msa_AF_108175	contig23631___1_nrnt	contig23631___1_nrnt	Unknown	
93	2	11	unmapped	0		0	GACTCTACAGAGCTGACTGGCAAGATTTGTATGCAGGGCCTGCAGCATTTTGCTTCTTTT	18	0	UF_Msa_CF_126764	contig26229___0	contig26229___0	Unknown	
94	2	12	unmapped	0		0	GCATGGCTGCTGACATGAGATTACCAACTATTCGGAAACCAGTGTCGCTATCAGTTTCTA	20	0	UF_Msa_CF_119441	LMB_S454.994.C1___0rc	LMB_S454.994.C1___0rc	Unknown	
95	2	13	unmapped	0		0	GTCTCCTGAAGCGCTGGTTCTACCGGCTGCTGTCGGTGATCCTGACTCTGTTCAGCGTGG	22	0	UF_Msa_AF_102534	LMB_S454.396.C1___1rc_nrnt0	LMB_S454.396.C1___1rc_nrnt0	Unknown	
96	2	14	unmapped	0		0	CGAAAACGGCAGCTCTCACGTGGGCAAGATGAAGAAGGCCTAGTATCTCTAGAAGGAAAC	24	0	UF_Msa_CF_125550	contig29928___0	contig29928___0	Unknown	
97	2	15	unmapped	0		0	ATGCACTGCAACGATAAGGCAAAGGATCTCTTTGACTCCGGCGCCAAGGAGCCAGCCGTT	26	0	UF_Msa_AF_105764	contig30769___1_nrnt	contig30769___1_nrnt	Unknown	
98	2	16	unmapped	0		0	TGATCATTGCCAACACAGAGACTAAAGGACCCCTGGGAGACTCCCACCTGGGAGAGGTCT	28	0	UF_Msa_AF_110060	contig12972___1rc_nrnt	contig12972___1rc_nrnt	Unknown	
99	2	17	unmapped	0		0	AGTTACTGCCTTTTAATTCTTTCTTGCCTTTACGAAAAACACCCCAGTCACATCATCTAC	30	0	UF_Msa_AF_104671	contig07410___1_nr0nt1	contig07410___1_nr0nt1	Unknown	
100	2	18	unmapped	0		0	AGTCCAGCAAGCGGACACTTCCCGCTGACTGTGGCGACTCCTTGGCCAAGAGAGGCAGTT	32	0	UF_Msa_AF_105512	contig10876___1rc_nrnt	contig10876___1rc_nrnt	Unknown	
101	2	19	unmapped	0		0	GCAATAAAATGAGCACATTAACCAAGCTCTGTTCCTGTTGTTACAATAAAGACTGGAATC	34	0	UF_Msa_AF_102241	contig02998___1_nr0nt	contig02998___1_nr0nt	Unknown	
102	2	20	unmapped	0		0	TTCTCTCACTGCTTTTGTGGAAGCTAAATTAGTAGACAAAGTTCCCTCTGTCTCTGGTGG	36	0	UF_Msa_AF_107251	contig11466___1_nrnt	contig11466___1_nrnt	Unknown	
103	2	21	unmapped	0		0	TGGGTCCTTAGCCGGGATGCGATGGGTCTGGATTTCATTGCAGTGCAGTCTCCTTCAGCT	38	0	UF_Msa_CF_123728	contig11214___0rc	contig11214___0rc	Unknown	
104	2	22	unmapped	0		0	TGGACAGACCTCTTTATGAGCTCTGTAGATGAGAGTGGAGTGAGCTCGGATCCTCCTCTT	40	0	UF_Msa_CF_127197	contig03409___0rc	contig03409___0rc	Unknown	
105	2	23		1028	E1A	0		42	1	(+)E1A_r60_n11	E1A_r60_n11	E1A_r60_n11		CONTROL
106	2	24	unmapped	0		0	TTCTTTTCTACCTTCACTCAGCTGAGAGAACTGGACCTGCAAGGCAATGTTCTCACCAAA	44	0	UF_Msa_AF_105900	contig12574___1rc_nrnt0	contig12574___1rc_nrnt0	Unknown	
107	2	25	unmapped	0		0	ACAAGTGCTGGGGAACCAAACACTGGACTCTCCTTTCACCCTGTCAAGCGGCCGTTTGGT	46	0	UF_Msa_CF_121529	contig24943___0	contig24943___0	Unknown	
108	2	26	unmapped	0		0	TTGTTTTTAATGAGATACTAGATAATGGCTTCATCCGTGAGCGGCACAGAGGAGGTCCGT	48	0	UF_Msa_AF_101615	contig11021___1rc_nrnt	contig11021___1rc_nrnt	Unknown	
109	2	27	unmapped	0		0	TCACACCTGATGACTATTATTCCTGTGACATCAGGATTTTCTGCCTGCAACAGTTGTTCA	50	0	UF_Msa_AF_102554	contig31346___1_nrnt	contig31346___1_nrnt	Unknown	
110	2	28	unmapped	0		0	TACGAGTTATCCCTGGAGATGAAGCGCCAGAAGATTCAACGTGAGCTGATGAAATTAGAG	52	0	UF_Msa_AF_100292	contig08290___1_nrnt	contig08290___1_nrnt	Unknown	
111	2	29	unmapped	0		0	AGTGAGCCCAGCACAGGTCAGACACCTGTGCTGGGCTCACTCACTGGACTGAAGATGGTG	54	0	UF_Msa_CF_118192	contig17378___0	contig17378___0	Unknown	
112	2	30	unmapped	0		0	CCGAGCAGGAAAAACAGTCGCTTATAGAAGAACTTGAGGAGTGCAAAGGCAACATGAAAG	56	0	UF_Msa_AF_108976	contig26127___1_nrnt	contig26127___1_nrnt	Unknown	
113	2	31	unmapped	0		0	TCACGTAAAAGACAGAAAGCATCTACGTGAAGCTGAGCCGGCAGGAGGACAAAAGCCGAG	58	0	UF_Msa_CF_119937	contig16630___0	contig16630___0	Unknown	
114	2	32	unmapped	0		0	TCACCCAGCAAATCGGCATGTTTAGCTTCACCGGCCTGAACCCCAAACAGGTGGAGTACA	60	0	UF_Msa_AF_105018	contig07080___1rc_nrnt	contig07080___1rc_nrnt	Unknown	
115	2	33	unmapped	0		0	AACAAATGCAGAAAAGTCATCTGACAAAGCGGAAAAACGAGAAGGGGTCTGACTCAGAAG	62	0	UF_Msa_CF_121452	contig03293___0	contig03293___0	Unknown	
116	2	34	unmapped	0		0	AAATCAGTAGAGTACGAGACTCTGAATGACGTGAAGTGGGAGAAAGGATGTGTTTCGGGT	64	0	UF_Msa_AF_108259	contig29247___1rc_nrnt	contig29247___1rc_nrnt	Unknown	
117	2	35	unmapped	0		0	ACCATCCTGAAGGACCTCAACCTCTACCTGCAAGACAAGGTCTACCTGGCTGGCAACCAG	66	0	UF_Msa_AF_105486	contig28321___1rc_nr1nt0	contig28321___1rc_nr1nt0	Unknown	
118	2	36	unmapped	0		0	CATGGGTGGACTGGGCTTTGAGGGAAAGCAGGGAATGGGACCATCATCAGGAGGCTTGAT	68	0	UF_Msa_AF_101794	contig28752___1rc_nr1nt0	contig28752___1rc_nr1nt0	Unknown	
119	2	37	unmapped	0		0	ACCGCTCAGTGCACTTAATCTCATTGCCTTAATACTTTTGTCCTCAGTTTCACGCGCGTA	70	0	UF_Msa_AD_200165	LMB_Add_39_rc	LMB_Add_39_rc	Unknown	
120	2	38	unmapped	0		0	AAGCAGAAGATGAAGAAGAATAGGCTGGATGCCATAAACCAGCAATGGGGGATCACCGAG	72	0	UF_Msa_CF_119114	contig21208___0	contig21208___0	Unknown	
121	2	39	unmapped	0		0	GTACGTCTGTATTTTGAGCACTTCGGAACTGTACCTATGAAAAAATAAAATGTTATGGAC	74	0	UF_Msa_AF_105040	contig06461___1_nr0nt	contig06461___1_nr0nt	Unknown	
122	2	40	unmapped	0		0	TTTGTCTCTTATTTTCAATCAGGTGAAGAAAAATACCTTTTTTGTTCAGTATAATAAAAT	76	0	UF_Msa_AF_102354	contig10734___1_nr0nt	contig10734___1_nr0nt	Unknown	
123	2	41	unmapped	0		0	GCTATCTCAAGGAACAAAGAAAAAAGTTTGCTATTACTATGATGGGGATGTGGGGAACTA	78	0	UF_Msa_AF_107643	LMB_S454.562.C1___1_nrnt	LMB_S454.562.C1___1_nrnt	Unknown	
124	2	42	unmapped	0		0	GTCAGAGGTTTGTCCGCCATCCCCAACAAGTTCTCATTCCTCTGTGAGTGTCAGCTCTCC	80	0	UF_Msa_CF_122919	LMB_S454.537.C1___0rc	LMB_S454.537.C1___0rc	Unknown	
125	2	43	unmapped	0		0	TCCCACCTGCAGAGTACCCCATACACAGACAAAAGACAACCCTGCAGAGAAATCATCGGA	82	0	UF_Msa_CF_123314	contig19432___0rc	contig19432___0rc	Unknown	
126	2	44	unmapped	0		0	TCCTGAAATTAACCAAAGTGGCAGAGAGAATAGCAAGAAACCTGGCTGGGGAGCAACTAA	84	0	UF_Msa_CF_121560	contig26487___0rc	contig26487___0rc	Unknown	
127	2	45	unmapped	0		0	AGAGCTCAGAGTCAGAGGGAATCTCTCTGAGTGCCTTTGAATCCTACATAAGAGGGATGA	86	0	UF_Msa_CF_118703	contig21241___0	contig21241___0	Unknown	
128	2	46	unmapped	0		0	TGTGAGGCCCACATGCCTGTCCTTTTGCTCTGATGCAAAGTGGTTATGTGATTCCCTTGT	88	0	UF_Msa_AD_200089	LMB_Add_55	LMB_Add_55	Unknown	
129	2	47	unmapped	0		0	GGACAAGATTCATAAGGTCAAGCATGGTGTGGTGATTTAGTGTTAACAGGGAGAGACTGC	90	0	UF_Msa_CF_117906	contig05053___0	contig05053___0	Unknown	
130	2	48	unmapped	0		0	GAGAGGGCAGACAGCTAACAAGGGAGACACAATACTCCCCATAACCTTCGGGTTATCCCG	92	0	UF_Msa_CF_127632	contig24165___0	contig24165___0	Unknown	
131	2	49		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
132	2	50	unmapped	0		0	TTTGTCCAGCAAATTCTCAAACAGGATCTTGTTTTACCTCAGTCTGAAGTAAATGAATAC	96	0	UF_Msa_CF_122170	contig30130___0	contig30130___0	Unknown	
133	2	51	unmapped	0		0	AGAAAGAAAAACAAAGAACGGGCATAGCCTTGCAATTAGCGTCCATTGGGAACCCACACA	98	0	UF_Msa_CF_118606	LMB_Sanger.26.C8___0	LMB_Sanger.26.C8___0	Unknown	
134	2	52	unmapped	0		0	TATTCAAGCCTTGTGGATATTTATGACCCTCCTGCCAACCCTCATGCTGAACAGTGAGAA	100	0	UF_Msa_AF_109363	contig19382___1rc_nrnt-1	contig19382___1rc_nrnt-1	Unknown	
135	2	53	unmapped	0		0	TGGTGAAGAAGATTCCGCCTGTTTTGTCTGAGTGTGATTTGTACCTCGTAGTTGAGTCGA	102	0	UF_Msa_AF_101091	contig07955___1rc_nr0nt1	contig07955___1rc_nr0nt1	Unknown	
136	2	54		0		0		104	1	RC7	RC7	RC7		CONTROL
137	2	55	unmapped	0		0	AATGTCCCAACTTTTCTGATAGCCCACCCCCACTGTTATGGAGTAAGGCGCGTATTTTTT	106	0	UF_Msa_CF_121326	contig15834___0rc	contig15834___0rc	Unknown	
138	2	56	unmapped	0		0	TGGCACTGAAGCTGAGCACCACCTCAGCAAGGTGGGTATCGTGGTGCACAGCCTGGCAGC	108	0	UF_Msa_AF_103243	contig20351___1rc_nrnt0	contig20351___1rc_nrnt0	Unknown	
139	2	57	unmapped	0		0	TCATTGGCTAAAGATGCCTCCCTGGGACCAATCAGAGAGCTGCGTCCAGAACAAGTGAGG	110	0	UF_Msa_AF_105705	contig27259___1rc_nr1nt0	contig27259___1rc_nr1nt0	Unknown	
140	2	58	unmapped	0		0	AGCAGTGACATGCTGAGCTGGATCTCCTCCAAACTGCAGAGGTCTGGAGAAGTCACCTTT	112	0	UF_Msa_CF_124903	contig30081___0	contig30081___0	Unknown	
141	2	59	unmapped	0		0	GATGATGCCCTCAACCGTATTAGCCTACACCCAGCTGGGCACGTTCATGATGCTGATCAT	114	0	UF_Msa_AF_104854	contig21953___1rc_nrnt	contig21953___1rc_nrnt	Unknown	
142	2	60	unmapped	0		0	TGTTTCTGAGCGTATTGTCCATGATTACAAAGACATCTTCAAGCAGGCAACAGAGGACCG	116	0	UF_Msa_AF_109998	contig07820___1rc_nrnt	contig07820___1rc_nrnt	Unknown	
143	2	61	unmapped	0		0	CGAGTAAACCACAGTGAGCAGTTTCCCTTGGGTTTAAAAGTTTTTGGGTTGCGATGTTGG	118	0	UF_Msa_CF_126939	contig08829___0	contig08829___0	Unknown	
144	2	62	unmapped	0		0	AGCTGGGTGGAAAACAGCTGGTGATGAATCATATGCACCACGAGGACCAGCTAGTCCGTT	120	0	UF_Msa_AF_103530	contig02857___1_nrnt	contig02857___1_nrnt	Unknown	
145	2	63	unmapped	0		0	CCTGGGAAAGCACAATGGAACTGTTGAAGGGAAGAAATACTTTGAATGTGAGAACAAATA	122	0	UF_Msa_AF_103376	contig20022___1rc_nrnt-1	contig20022___1rc_nrnt-1	Unknown	
146	2	64	unmapped	0		0	TTCTCCCACCTCAAACACTGACATACTGGAATTCATCGACAGAGGCTGCAACGAATTTGT	124	0	UF_Msa_CF_119979	contig26495___0	contig26495___0	Unknown	
147	2	65	unmapped	0		0	GCGCTGCAAGGGGATGGAAGCACAGGCTCAGCCGGCGCAGACAGCCCTAATTCGTCCCAG	126	0	UF_Msa_CF_125001	contig08596___0	contig08596___0	Unknown	
148	2	66	unmapped	0		0	ATGCCTGACCTTCCTGCACCCAAGATAGTTTTCAACCGTCCTAATGGTAAGAAGTACCAT	128	0	UF_Msa_AF_109729	contig07854___1_nrnt0	contig07854___1_nrnt0	Unknown	
149	2	67	unmapped	0		0	AAGACATTATTGCAACTCCTCAAACAGTACAACCCCCAAATGGTTAAAGTAGCAAGTTTG	130	0	UF_Msa_AF_103428	contig21434___1_nr0nt1	contig21434___1_nr0nt1	Unknown	
150	2	68	unmapped	0		0	TATCAGATGGAGAATCACCCCTTCCTCCTGGTTTTCGCTTTAAACCAGATGATCTTGCTG	132	0	UF_Msa_CF_119204	contig14646___0	contig14646___0	Unknown	
151	2	69	unmapped	0		0	ACGACTTCTTCTGCTGCAGCTCCAGACATCTGTTTTGCCTTCAAAGTTTCTCTTTCACTG	134	0	UF_Msa_AF_108624	contig29684___1_nr0nt1	contig29684___1_nr0nt1	Unknown	
152	2	70	unmapped	0		0	AACTCTCACACCAACTCAGCATCAGCCTCCGACAAAGCAAAGAGAGAACTTCTCTCTAAG	136	0	UF_Msa_AF_103534	contig19954___1_nr1nt0	contig19954___1_nr1nt0	Unknown	
153	2	71	unmapped	0		0	GTGTACAGCCTGGTCTGTTGTGTAATGTCATGAAAAGTGAAAATGTAATGTGAAGAATTA	138	0	UF_Msa_CF_123944	contig30365___0rc	contig30365___0rc	Unknown	
154	2	72	unmapped	0		0	AGACTCTGGTGGCCCCGTGGTGTGCAACGGTCAGCTGCAGGGTGTTGTGTCCTGGGGTTA	140	0	UF_Msa_AF_108253	contig05019___1_nrnt	contig05019___1_nrnt	Unknown	
155	2	73	unmapped	0		0	CCCATTTGAACAAACCAAAGCAATATCTATCCACTTGTTTGTTAACTTCTAGTTGCCAAA	142	0	UF_Msa_AD_200328	LMB_Add_24	LMB_Add_24	Unknown	
156	2	74	unmapped	0		0	GAGACAAAAAGTATCCGCAGGTTTGTGTGCGGTCAACTCCGCGATGAGCCAGACCTAAGC	144	0	UF_Msa_CF_121385	contig02651___0	contig02651___0	Unknown	
157	2	75	unmapped	0		0	CTCAGCGGCTGAAGACAGACGTTGATCTGGGCTGTAACTTCTACGTCCAGGCTGAAGTCG	146	0	UF_Msa_AF_105372	contig23990___1_nrnt	contig23990___1_nrnt	Unknown	
158	2	76	unmapped	0		0	GGATTCCCATATCTGGAGAGATGTTTTGTGACTGAAGCAGAAATTAAGTCGTCCATGTCT	148	0	UF_Msa_CF_123003	contig02540___0	contig02540___0	Unknown	
159	2	77	unmapped	0		0	AGAGGAAGAGGGTGACAGCAGTGAGCTGGAAGAGGAGGAGGATACAGAGGAGGGAGAGGA	150	0	UF_Msa_AF_100716	contig05537___1_nr0nt	contig05537___1_nr0nt	Unknown	
160	2	78	unmapped	0		0	GCATGGCCGCTGTGTTGAGAAGTTCTCGGTACCTAGTTGGAAGGTCTTGCAAGCATGTTG	152	0	UF_Msa_AF_105932	contig18567___1_nr0nt1	contig18567___1_nr0nt1	Unknown	
161	2	79	unmapped	0		0	TGTCAGACTCAATCCTAGTGACATGGGCCTTAAAGGTCTGAAGCAGTATTACAAGCTGGT	154	0	UF_Msa_AF_103285	contig29780___1rc_nr1nt0	contig29780___1rc_nr1nt0	Unknown	
162	2	80		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
163	2	81		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
164	2	82		260	BrightCorner	0		0	1	GE_BrightCorner	GE_BrightCorner	GE_BrightCorner		CONTROL
165	3	1		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
166	3	2		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
167	3	3	unmapped	0		0	CTGTGCTGATGCTGGATGACGACACCCTGGTCAGTGTTCCTGATATCAGTTTTGCTTTCT	156	0	UF_Msa_AF_102062	contig17635___1rc_nrnt0	contig17635___1rc_nrnt0	Unknown	
168	3	4	unmapped	0		0	TTTGTCCGTGTGAAGGACAACCTGAGGCGAACACAGACGTTTGAGCAGTGAGGCCCCAAG	158	0	UF_Msa_AF_100285	contig13648___1_nrnt0	contig13648___1_nrnt0	Unknown	
169	3	5	unmapped	0		0	TTTTAAATGGGCCTTGTAAGAAGCCCATGTCACCCTCATGTACAGTGACAAGATGTCGGA	160	0	UF_Msa_AF_108369	contig04575___1_nrnt0	contig04575___1_nrnt0	Unknown	
170	3	6	unmapped	0		0	TACTCTGCTGTGGGGGAATGGGCCAAGCTGGATCAGACAGCACAGTACTGGATGTGTGCT	162	0	UF_Msa_CF_124574	contig14712___0rc	contig14712___0rc	Unknown	
171	3	7	unmapped	0		0	CCAAACCCCTGCACAAGCACCAAAGTCTCAGAATGGCACTCCTCATTCATCCCAGAACAG	164	0	UF_Msa_CF_123882	contig17142___0rc	contig17142___0rc	Unknown	
172	3	8	unmapped	0		0	TAAGATTGTGCGTCTGAAGCCCACTCGCAAGTTTGCTCTCCTTGGGCGTCTGGCACACGA	166	0	UF_Msa_AF_104155	LMB_S454.sd.506.C1___1_nrnt	LMB_S454.sd.506.C1___1_nrnt	Unknown	
173	3	9	unmapped	0		0	AACGATGGCCAAGCGTACCAAGAAGGTGGGGATCGTGGGTAAATATGGCGCGCGTTATGG	168	0	UF_Msa_AF_103084	contig04046___1_nr0nt1	contig04046___1_nr0nt1	Unknown	
174	3	10	unmapped	0		0	TATTGTGAACATGAATGATGCCGCTTTAGCGAGACTCTCATGTCTCACTCGTAGCATCTG	170	0	UF_Msa_CF_120789	contig32873___0rc	contig32873___0rc	Unknown	
175	3	11	unmapped	0		0	CATGTGCATTTACCATGCAGTCACACTGTGCCATTTGTTTTGTAAATAAAATAGTTTTGC	172	0	UF_Msa_AF_109717	contig30390___1_nr0nt	contig30390___1_nr0nt	Unknown	
176	3	12	unmapped	0		0	CTGCCTCATGTGTGGATCTTAAAACACATCCGCTCAAATTACACTCTTACCTGTAAATGC	174	0	UF_Msa_CF_121699	contig14760___0	contig14760___0	Unknown	
177	3	13	unmapped	0		0	TTCAGCACCTAAGGAGGAAGAACTGGAACTCAGCTTGGAGGAGGAGCTGCTGGAGGTACG	176	0	UF_Msa_CF_124221	contig29265___0	contig29265___0	Unknown	
178	3	14	unmapped	0		0	ATTTAAAACAATAGAAACACTAAGAAGACGGCAGCTTGTGTCTCACCTGGACTCACCTGT	178	0	UF_Msa_AD_200076	LMB_Add_133	LMB_Add_133	Unknown	
179	3	15	unmapped	0		0	GTCGGTCATGCTGGCAACGCGACGCACAGGATCAGTCGAGGCCCGGCTGTCTCCACCCCT	180	0	UF_Msa_CF_121097	contig14018___0rc	contig14018___0rc	Unknown	
180	3	16	unmapped	0		0	TTATCACAGCTGACCAAAGATGACAGGGTGTCTGTTAAGACTGGTTATCACCTACAAAAT	182	0	UF_Msa_CF_124577	contig10379___0rc	contig10379___0rc	Unknown	
181	3	17	unmapped	0		0	CAGTCAGAGGCTCGACGCAGTATGGACACACAGGACGCAGCTTTAAGTCAGCAGAGCAGT	184	0	UF_Msa_CF_118560	contig11319___0rc	contig11319___0rc	Unknown	
182	3	18	unmapped	0		0	AAGAGAGTTGCCAAGGAGCTGGGTGAAAACCTCACAGATGAAGATTGCAGGAATGATTGA	186	0	UF_Msa_AF_100751	contig16877___1_nrnt	contig16877___1_nrnt	Unknown	
183	3	19	unmapped	0		0	ACGTCAGACTACGAGGGGACTCTCTGGGTCCGTACAGGGTCAACGTCAGACTACGAGGGG	188	0	UF_Msa_CF_124375	contig31733___0	contig31733___0	Unknown	
184	3	20	unmapped	0		0	TGAATGCCTATCTGAATGGCACCTCATGTTAAATAAACCGTGACCCCTGGATGCTGTTCA	190	0	UF_Msa_CF_119722	contig32159___0	contig32159___0	Unknown	
185	3	21	unmapped	0		0	TTCCAACTGTTGCTACTCTTTTCAGATTTGGATTGTCTGCTGAGCATTACCCTAAACTGG	192	0	UF_Msa_AF_102523	contig00303___1rc_nrnt	contig00303___1rc_nrnt	Unknown	
186	3	22	unmapped	0		0	TCATCACGCTTTATGTTTTCTCTTCAGCGGGTTGTGTTTACAGACTTCAGAGGTGCCATG	194	0	UF_Msa_AF_104979	contig27295___1_nr0nt	contig27295___1_nr0nt	Unknown	
187	3	23	unmapped	0		0	GAATCATCTGCAGCGTTCAAATAAGCAAAAGCTAAACATGTCAAAGTATTCATAGAGCAA	196	0	UF_Msa_AF_107929	LMB_S454.1097.C1___1_nrnt	LMB_S454.1097.C1___1_nrnt	Unknown	
188	3	24	unmapped	0		0	GGATCCGCCGCCTGGGCCTCGTGTCAGAGATGGACCAGGCAAGTATGAGCTGTTTGCATT	198	0	UF_Msa_CF_118616	LMB_S454.111.C1___0rc	LMB_S454.111.C1___0rc	Unknown	
189	3	25	unmapped	0		0	CTGAATGTATAAGACATGCTAAGGACATGTCTTGACTTCAATGTCTTGACTTAAATACTG	200	0	UF_Msa_AF_104560	contig27637___1rc_nr0nt1	contig27637___1rc_nr0nt1	Unknown	
190	3	26	unmapped	0		0	ATGGCTGTAATAAGATGACGTGTACCTCGTGTAGACAATACTTTTGTTGGCTGTGCCTGG	202	0	UF_Msa_AF_102091	contig24567___1rc_nr1nt0	contig24567___1rc_nr1nt0	Unknown	
191	3	27	unmapped	0		0	TATGGACCTGAGTCCTTGTGTTTTAGCCTACGTAGCCAAGGTCTTCAAGAGTCCACAATT	204	0	UF_Msa_CF_121243	contig21741___0rc	contig21741___0rc	Unknown	
192	3	28	unmapped	0		0	CAAACTGACTACATAAACTATAAGTTGTTCCCCTCCATACAGATGCAGGCCATCTGTGAT	206	0	UF_Msa_CF_121370	contig12332___0rc	contig12332___0rc	Unknown	
193	3	29	unmapped	0		0	ATGGCGAGCACCGAAGCTAGAAGAGAGTGCGAGACGGAGGGATGCAGCAAGGACGCAAAA	208	0	UF_Msa_AF_101365	LMB_S454.714.C1___1_nr0nt1	LMB_S454.714.C1___1_nr0nt1	Unknown	
194	3	30	unmapped	0		0	AGTCTCCCTGTCTGCAGACTTCTCCAGAAGATTCCTGAAGGCAGCCAGGATGATGCGTGT	210	0	UF_Msa_AF_107737	contig03994___1_nr0nt1	contig03994___1_nr0nt1	Unknown	
195	3	31	unmapped	0		0	CTGTGCTCGGACAGCACCGTGGTGTTACTAGCCTGCAAGATCCGCTACAAGAGAGACACA	212	0	UF_Msa_AF_110170	contig26973___1_nrnt0	contig26973___1_nrnt0	Unknown	
196	3	32	unmapped	0		0	GCAGATTGTTTCTCAGTAACATGCTCTTCCCTACCTGGGTCTTGCTGAATGACATCATGA	213	0	UF_Msa_AF_104939	contig29850___1rc_nrnt-1	contig29850___1rc_nrnt-1	Unknown	
197	3	33	unmapped	0		0	ATGATGCGCTTCAGTACTGTAAAATGAAGGGCACTAGACCTCAGGAAGCTCAAGGAGTAA	215	0	UF_Msa_AF_103918	contig31466___1rc_nrnt	contig31466___1rc_nrnt	Unknown	
198	3	34	unmapped	0		0	TGGCTGAAGTGGTGAGGTTTGTGGAAGAGAGAATTAAAGGGGAGGACGGCAAAGACTCTC	217	0	UF_Msa_AF_107769	contig00119___1rc_nr1nt0	contig00119___1rc_nr1nt0	Unknown	
199	3	35	unmapped	0		0	TCCAAGGTGAAGCAGGACATGGCTCCTCCGGGAGGCTATGCCTCGTTTGATTATAAGAGG	219	0	UF_Msa_AF_104168	LMB_S454.328.C1___1rc_nr0nt1	LMB_S454.328.C1___1rc_nr0nt1	Unknown	
200	3	36	unmapped	0		0	CTGATCACTGATGAGCAGCAGAAACAGATGATGATGAGTTACCACAGGAGGCAGGAGGAG	221	0	UF_Msa_AF_109663	contig30055___1rc_nrnt-1	contig30055___1rc_nrnt-1	Unknown	
201	3	37	unmapped	0		0	CTGGAAAGGGATCATTCAAGATTAAACATGATTTCATATGAAGGGAAGGATAGGATTAGG	223	0	UF_Msa_CF_126310	contig26007___0rc	contig26007___0rc	Unknown	
202	3	38	unmapped	0		0	ACCTTGCGCCTCTACCACGCGCATACGCACCAGCACCTCCAGGATGTGGACATTGAGCCA	225	0	UF_Msa_AF_101569	contig19789___1_nrnt	contig19789___1_nrnt	Unknown	
203	3	39	unmapped	0		0	ATGCAGAGGACAAAGAACCCACTGTGGCTTTCAAAGGTCGACGCACAGCCAACAGCCAGG	227	0	UF_Msa_AF_100426	contig07040___1rc_nrnt	contig07040___1rc_nrnt	Unknown	
204	3	40	unmapped	0		0	AGTTTGATGTGTTGCAGAAAACCTGTGAGGTGTCAGCGTGGTGTCCAGTTGAAAACAAGA	229	0	UF_Msa_AF_109327	contig19376___1rc_nrnt0	contig19376___1rc_nrnt0	Unknown	
205	3	41	unmapped	0		0	ACATGAGCTATGTGGTGTCAGGAGATGCAGATGGAAAGCTGAACATTTGGGATTGGAAGA	231	0	UF_Msa_AF_103506	contig17323___1rc_nrnt	contig17323___1rc_nrnt	Unknown	
206	3	42	unmapped	0		0	CAAAAAAGTGGGAGTGTCTGAAATCCATCAAAGCTCACAAAGGCCATGTCACATCGCTGT	233	0	UF_Msa_AF_107321	contig04496___1rc_nrnt-1	contig04496___1rc_nrnt-1	Unknown	
207	3	43	unmapped	0		0	ATTGTGTTCCAAAACTCCTCCAGTTTGACAGCAGCTAAATCACACCCACATAATGTGCCG	235	0	UF_Msa_AF_108382	contig00481___1_nrnt	contig00481___1_nrnt	Unknown	
208	3	44	unmapped	0		0	AGCCAGAGACACCAACGGCAGGAGAAACTGGCACCTCCACAAGTATGTTCTCAACAGATC	237	0	UF_Msa_AF_102081	contig29704___1_nr0nt	contig29704___1_nr0nt	Unknown	
209	3	45	unmapped	0		0	AGCAGTAAGCACTTTCCTCTCACTTCCCCATTTCAAACACTTGTTTTCTGTCATTACTGA	239	0	UF_Msa_CF_125040	contig28396___0	contig28396___0	Unknown	
210	3	46	unmapped	0		0	CAGACAAACTTGCCAAGCCGGAGAATCCTCTGGAAGAAGCTGTGAAGTTCCTGATCCCTC	241	0	UF_Msa_AF_104357	contig27743___1_nrnt	contig27743___1_nrnt	Unknown	
211	3	47	unmapped	0		0	AAATTTCTTGAGGGGAACATACATGGCTTCGGCTTACTTGAATGACGTCACCGCAGTTGT	243	0	UF_Msa_AF_104937	contig28737___1_nrnt	contig28737___1_nrnt	Unknown	
212	3	48	unmapped	0		0	GACCTGAGATGGCTGGACAAACATGTAAATGATTAGCAAGACAATTAATAACATAGAGTT	245	0	UF_Msa_AF_106433	contig31420___1_nrnt	contig31420___1_nrnt	Unknown	
213	3	49	unmapped	0		0	GGAAGCTGGGTCCCGCTCTCAAGATCTGTGCCTCTATCAACACCCTGCGTGAGTGATGCA	247	0	UF_Msa_CF_125188	contig23554___0	contig23554___0	Unknown	
214	3	50	unmapped	0		0	AATGACCTCAGGAACTATTTTGAGACGGGACGCACTGACATCTTTACCCTGGAAACCTTT	249	0	UF_Msa_AF_103592	contig21469___1_nr1nt0	contig21469___1_nr1nt0	Unknown	
215	3	51	unmapped	0		0	GTACAGAAGGTACATGAGGTGCTTTCCACCATCCATGTTTATGGGAAAGACACAGACATG	251	0	UF_Msa_AF_106246	contig11739___1_nrnt0	contig11739___1_nrnt0	Unknown	
216	3	52	unmapped	0		0	ATTTAGAGACCGTCCAGGCTGGAAAAGTGCTGCAGGCGATGGTAAAAACATGATAAGTAG	253	0	UF_Msa_CF_120196	contig03980___0	contig03980___0	Unknown	
217	3	53	unmapped	0		0	AGTTTGCTTTATTCCGGTGTTTTTATCGTTTCGCCGCCATGGAGTTCGTTGAAGAGTCGT	255	0	UF_Msa_AF_109032	LMB_S454.493.C1___1_nrnt0	LMB_S454.493.C1___1_nrnt0	Unknown	
218	3	54	unmapped	0		0	TACTGTATCTCACTGTAAAGTGGAGAAATTGCGATTGTAAAACAGCTAAGGCAGGATTTT	257	0	UF_Msa_AF_105788	contig27729___1_nrnt0	contig27729___1_nrnt0	Unknown	
219	3	55	unmapped	0		0	TTTTTACTGATATATTTCTGACACCCCCGCTGAAGGCCACTCTCAAGCATTTGGAGGAGA	259	0	UF_Msa_CF_125399	contig28062___0rc	contig28062___0rc	Unknown	
220	3	56	unmapped	0		0	TTTAGGAAAGACTGTCATTGTAGCTGCCTTGGATGGAACTTTCCAGAGAAAGCCATTTGG	261	0	UF_Msa_CF_122860	contig17852___0	contig17852___0	Unknown	
221	3	57	unmapped	0		0	TCAAAGGCACCGTGGAGTCCATTCCCATCATGCTCGTGGGCAACAAAAGTGACGAGACGG	263	0	UF_Msa_AF_103878	contig15461___1rc_nrnt	contig15461___1rc_nrnt	Unknown	
222	3	58	unmapped	0		0	CAGGGAGTAACCATGAGGAGGAAAATACAGGCATAACAATTACCAGTTTCATTTTTCTTA	265	0	UF_Msa_CF_124494	contig29374___0rc	contig29374___0rc	Unknown	
223	3	59	unmapped	0		0	TGCCAGTGGGGGTGCAAAGGAACTGAAGAACATCCACGTGTGCCTCGGCAGCCTGTTTGT	267	0	UF_Msa_AF_107561	contig24453___1rc_nrnt	contig24453___1rc_nrnt	Unknown	
224	3	60	unmapped	0		0	TGCAGAATCTCCTCTCTAAGGAAGTGCTTTATCCATCCCTTAAAGAAATCACCGCTAAGT	269	0	UF_Msa_AF_104364	contig24348___1rc_nrnt	contig24348___1rc_nrnt	Unknown	
225	3	61	unmapped	0		0	TTAGCACAGGACTGACAGAGCAACTGATGAGACAGACATTCTCCCCCTTTGGACAAATCA	271	0	UF_Msa_AF_107238	contig19521___1rc_nrnt	contig19521___1rc_nrnt	Unknown	
226	3	62	unmapped	0		0	AAAGGCTTTGAGAAGAGACCATACTGCAATGCACACTACCCCAAGACAAACTTCACCTGT	273	0	UF_Msa_AF_109839	contig06851___1rc_nrnt	contig06851___1rc_nrnt	Unknown	
227	3	63	unmapped	0		0	AACACAGAGATTTCCTTCAAGCTGGGAGAGGAGTTTGGCGGGCTGCAGGCAAGTGGAGGT	275	0	UF_Msa_AF_103080	contig00084___1rc_nr0nt1	contig00084___1rc_nr0nt1	Unknown	
228	3	64	unmapped	0		0	TCAAGGACAAAAAAGCCTGAGATGGAGCTGGAAGAACACAAAAAACTGATAAGCTGGTGA	277	0	UF_Msa_CF_121786	contig11012___0	contig11012___0	Unknown	
229	3	65	unmapped	0		0	AACAGCACAAGCAGCAACATCCTCTTTGCATCAGACAGAAGACGGGTTTAAAGGAGATGT	279	0	UF_Msa_CF_121978	contig01131___0rc	contig01131___0rc	Unknown	
230	3	66	unmapped	0		0	CGACACAGCTCAAAACGTTTGGAAAAAGTTTGGACGTTGTTTGTTTTTGTTTACTGAAAT	281	0	UF_Msa_AF_102315	contig06241___1_nr0nt	contig06241___1_nr0nt	Unknown	
231	3	67	unmapped	0		0	AAAGTGGTGCTGAGCTTCCTGAAATCGTCTCGCCTCTACTTCAGAGGAAGGCGAGAAGAA	283	0	UF_Msa_CF_124821	contig10743___0rc	contig10743___0rc	Unknown	
232	3	68	unmapped	0		0	TGAGGCGACGTGTTCAGTCTCTGCCTTTCAGGGATCAAGACAGTTCCCCTCCTACTGATG	285	0	UF_Msa_CF_117933	contig03969___0rc	contig03969___0rc	Unknown	
233	3	69	unmapped	0		0	ATGGGAGCTAACAGTGGGAGTCATGATGCCACCAAAAAGGAGCAGTGTGTGCAGATTGGG	287	0	UF_Msa_CF_127132	contig07008___0	contig07008___0	Unknown	
234	3	70	unmapped	0		0	TATGATGGTGAGCTTGGAGAATCTAATTGGGAGGGACTATGTGTCTGTTGACATCACAGC	289	0	UF_Msa_AF_102658	contig32594___1rc_nr1nt0	contig32594___1rc_nr1nt0	Unknown	
235	3	71	unmapped	0		0	ATGATGACCTGGAAGGATATGTGTCAGATAAGCGATACCTGGGAGCTACAGTGGGCCGTG	291	0	UF_Msa_AF_106405	contig22076___1rc_nrnt0	contig22076___1rc_nrnt0	Unknown	
236	3	72	unmapped	0		0	GACACAACCTGCGGGTGGAGGAATCAGACCCGGTACTGGACATGGTGTATCCACTGGGGG	293	0	UF_Msa_CF_119672	contig31118___0rc	contig31118___0rc	Unknown	
237	3	73	unmapped	0		0	TAAAGAGAGAAATGTAGCACCAAACTGGCCGTAATGCCACCTAACCAGGAGATTTCAGTC	295	0	UF_Msa_AD_200079	LMB_Add_131	LMB_Add_131	Unknown	
238	3	74	unmapped	0		0	AATCCTGCTGCTTGAGGACCGGCCTGCGGGTTCCTGTACTCTGTCTGTGATCCAGGCGCA	297	0	UF_Msa_CF_117724	contig13788___0rc	contig13788___0rc	Unknown	
239	3	75		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
240	3	76	unmapped	0		0	CAGAATCAGCTGGAGTCCAATAAGGAGGTGATACCAAGGGAGACCCACGAGGATGAGATG	300	0	UF_Msa_CF_127337	contig21931___0rc	contig21931___0rc	Unknown	
241	3	77	unmapped	0		0	GGCTGAGCTGGGAGAGTGTCTCTGGGGGAAACTGGAAGTCCGCTGGTAGAGTTGTTTTTT	302	0	UF_Msa_CF_122017	contig06412___0	contig06412___0	Unknown	
242	3	78	unmapped	0		0	AGAGGGAGATGAATGATATTGTGGATGACATCCCAGTTGTCCACGCGGGAGCTGCAGGAG	304	0	UF_Msa_AF_103991	contig28777___1rc_nrnt	contig28777___1rc_nrnt	Unknown	
243	3	79	unmapped	0		0	CACGGCAAAGAAGCACCCTTTAAAAAGAGGTGAAGCGTTGCCAATAGCAAAGAAGAAAAA	306	0	UF_Msa_AF_101149	contig31749___1rc_nrnt0	contig31749___1rc_nrnt0	Unknown	
244	3	80	unmapped	0		0	GTGACAGCTCCAAAAAAGATTAATGGACTCCAAATGAAGACATTCATAGAACTGCAATAT	308	0	UF_Msa_AF_110265	contig27797___1rc_nrnt-1	contig27797___1rc_nrnt-1	Unknown	
245	3	81		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
246	3	82		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
247	4	1		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
248	4	2	unmapped	0		0	GCATCTCATGCTGAAGCTCCTGCACACAGACATGAAGTGATTAACAGAAATGAGCTCTGA	155	0	UF_Msa_CF_119010	contig15211___0	contig15211___0	Unknown	
249	4	3	unmapped	0		0	AGCCAACATTGTACGAGCTGGTGAGTCCCTGATGAAGCTGGTGTCCGATCTGAAGCAGTT	157	0	UF_Msa_AF_100905	contig13289___1_nrnt	contig13289___1_nrnt	Unknown	
250	4	4	unmapped	0		0	CCATCTTCTCCCCCTCCTGCTCCTAGTCCTCAAGCCGGAACTAATCTGAGGGTGAGCCGA	159	0	UF_Msa_AF_104955	LMB_S454.430.C1___1_nr0nt1	LMB_S454.430.C1___1_nr0nt1	Unknown	
251	4	5	unmapped	0		0	CTCTCCCCAGGCAAATTGGATGTGCATGTTAAAAATGGAAAGCATTCTATTTATTTAACT	161	0	UF_Msa_AF_106921	contig23177___1_nr0nt	contig23177___1_nr0nt	Unknown	
252	4	6	unmapped	0		0	CCACAAACAGATGGAGAGAGCGCAGCTGGAGAACGAGAAGAAAAAGCGCGAGCATGCGGA	163	0	UF_Msa_AF_103278	contig06208___1_nr0nt1	contig06208___1_nr0nt1	Unknown	
253	4	7	unmapped	0		0	ATTTTATACATGTTTTTAACGGTTATAAACGTTCAATAAAAATAGCGCTCGAGTCAGGTA	165	0	UF_Msa_AF_100969	contig07571___1rc_nr0nt	contig07571___1rc_nr0nt	Unknown	
254	4	8	unmapped	0		0	GTTCAGATAGACAAAGACAGTATAGAGAGAACTCTGTTGGGATTCACTCCAAGACCAGCA	167	0	UF_Msa_CF_127307	contig31301___0	contig31301___0	Unknown	
255	4	9	unmapped	0		0	TGAATATGTTCACAAACCAGGGGACAGTGATCCACTTCAATAACCCAAAGGTTCAGGCCT	169	0	UF_Msa_AF_104516	contig31138___1rc_nrnt-1	contig31138___1rc_nrnt-1	Unknown	
256	4	10	unmapped	0		0	AGAGATCCAACTCAACTTCAGCTACCACTGGAACAGATCCAACCAAAGCCATGAATGAAG	171	0	UF_Msa_AF_108408	contig02588___1_nrnt	contig02588___1_nrnt	Unknown	
257	4	11	unmapped	0		0	ATCAACCTGGACGGGGTGGTCGGTTTCCTCATGCTGCAGGCTGAACTGAAGGAAGCAGTT	173	0	UF_Msa_CF_118006	contig22093___0rc	contig22093___0rc	Unknown	
258	4	12	unmapped	0		0	GAGGTGATCCATGTGCGAGGCTGCATCCATGCAGTCAACCTCTGGATGAGTGACAACATT	175	0	UF_Msa_AF_104536	contig26328___1rc_nrnt0	contig26328___1rc_nrnt0	Unknown	
259	4	13	unmapped	0		0	GATGACTCAGCCGCACAGAGTCAGGAATACTTTTAATTCATCTTACTATTTAAAATGAAC	177	0	UF_Msa_CF_120802	contig15408___0rc	contig15408___0rc	Unknown	
260	4	14	unmapped	0		0	TCCATGATCATGGAAAGCACCAGCGCTCCAATTCCAACAGCATATGGGATTACAGTCAAT	179	0	UF_Msa_CF_127301	LMB_S454.sd.374.C1___0rc	LMB_S454.sd.374.C1___0rc	Unknown	
261	4	15	unmapped	0		0	ACCTCATTTTCCAGCCAATCAGGAGGTGCTGCAGCGTGTGGAGGTCCAGTATGAGACGCT	181	0	UF_Msa_AF_100894	contig16167___1rc_nrnt0	contig16167___1rc_nrnt0	Unknown	
262	4	16	unmapped	0		0	GAAGAAGAAGCAGCAGCAGCAGCCTGATCATGCGAACATTTTCAGAATGGGTACCCAAGT	183	0	UF_Msa_AF_108445	contig25564___1_nr0nt	contig25564___1_nr0nt	Unknown	
263	4	17	unmapped	0		0	TTCACGATGAGAGGAAATGTCAGTAAAACAAACAAAGAAACAGCTCAAATGTGTGTTACA	185	0	UF_Msa_CF_119310	contig19082___0	contig19082___0	Unknown	
264	4	18	unmapped	0		0	AACTTTGTGGGAAGAGCACACAAATAAAAGGTGAACGGCAGTTCCCTGGAAGACGTACAA	187	0	UF_Msa_CF_117794	contig23315___0	contig23315___0	Unknown	
265	4	19	unmapped	0		0	GCTTGGTATGTCAAAAGTAAGTTGTAATGGAGGCGCTTTGCAAATAAAATTATTCAGTGT	189	0	UF_Msa_CF_126809	GP1-7EGINNI-1-1F12.g___0rc	GP1-7EGINNI-1-1F12.g___0rc	Unknown	
266	4	20	unmapped	0		0	CCAGATTTTGCAGTTACATCTCCCAACCAGCAGGGTTCCCTAGCACTGAGACTCAACATG	191	0	UF_Msa_CF_118824	contig19555___0rc	contig19555___0rc	Unknown	
267	4	21	unmapped	0		0	GCCTTCTGTAATGGCTAATGGCTTAGTTGAAGATGTACAGCTATTATTTCACTTAAGAAA	193	0	UF_Msa_AF_102636	contig32755___1_nrnt	contig32755___1_nrnt	Unknown	
268	4	22	unmapped	0		0	AAGACTGGGGACCAATCAGCTCGCTCGCTTTCAGAACAGACGGTCCTCCTATTGTGGCGT	195	0	UF_Msa_AF_109239	contig13705___1_nrnt0	contig13705___1_nrnt0	Unknown	
269	4	23	unmapped	0		0	TACAGCTCACTGCTTCTTCTTTCCTACCTACCTGATAGTTCAGGTGTGTGCAAGAACAGA	197	0	UF_Msa_CF_121136	contig03989___0rc	contig03989___0rc	Unknown	
270	4	24	unmapped	0		0	TTCCCGTTATCAATCCCTCTACCCCTACGAACTGGCTGTCCAAGCCAGTATGAGCAACAT	199	0	UF_Msa_CF_121271	contig22041___0	contig22041___0	Unknown	
271	4	25	unmapped	0		0	AGATTATCGCTTGCTTCTCTGCCTTTAGCATAGAACACCACAACAAAGAAGAAGAAAAAA	201	0	UF_Msa_AF_105579	contig29699___1_nr0nt	contig29699___1_nr0nt	Unknown	
272	4	26	unmapped	0		0	AAACACATCCTCCGTCGAACACAGCAGTTCTTTGATGAGGTGCGCCACACACCATTAGAA	203	0	UF_Msa_AF_100653	contig21846___1rc_nr0nt	contig21846___1rc_nr0nt	Unknown	
273	4	27	unmapped	0		0	GATAAACTGATAGCAGCCGGGGAAGCTGGTACATATGACTTTGTGTTCATAGATGCTGAT	205	0	UF_Msa_AF_100108	contig14448___1rc_nr1nt0	contig14448___1rc_nr1nt0	Unknown	
274	4	28	unmapped	0		0	CTGTCAGATCATGCAAAAATCAAAAAGCTTTACAAAGTCACTCCCCAGGAGGAGAAATGT	207	0	UF_Msa_AF_104095	contig29211___1_nrnt	contig29211___1_nrnt	Unknown	
275	4	29	unmapped	0		0	ATATAAATTCAAACCCAGAGACCGTAGAAGAACTGGCATCAGAGAACGATGGCGTGTTGG	209	0	UF_Msa_AF_100928	contig25845___1_nr1nt0	contig25845___1_nr1nt0	Unknown	
276	4	30	unmapped	0		0	TCTTGATAGTTGTGCACAAACAATAGGCCCAGGTCCAGGATGAACTCCTACTTAGACTAC	211	0	UF_Msa_AF_110244	contig17437___1_nr0nt1	contig17437___1_nr0nt1	Unknown	
277	4	31		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
278	4	32	unmapped	0		0	AAGCTAAAACGGAGAGTTGGAATAGTTTAAGGCGTCAGATCACAAGAGCCTGGACCAGAA	214	0	UF_Msa_CF_119739	contig28372___0rc	contig28372___0rc	Unknown	
279	4	33	unmapped	0		0	TCATCTTGGAGATGTACTGCTTCACCGCGAGCGTCACGTTCATGATGGCGCGCGGAGAGT	216	0	UF_Msa_AF_109294	contig21508___1_nr0nt	contig21508___1_nr0nt	Unknown	
280	4	34	unmapped	0		0	TGAGGGCACGCTGGTCCTCTTTCAATGCCTCTGCCCCTCTCCTACTCCTCTAGTCCTACT	218	0	UF_Msa_CF_120619	contig25018___0	contig25018___0	Unknown	
281	4	35	unmapped	0		0	AAGTTCGTTATTCAGGAAACGACTCTTCCAGAGGTTTTAGGCAGCCATCAGGTCAGAGTT	220	0	UF_Msa_AF_109125	contig08555___1rc_nrnt-1	contig08555___1rc_nrnt-1	Unknown	
282	4	36	unmapped	0		0	CGGCAAGGTCAAGACAGGCTACAAGTGCGACCACATCAACCTTGGCTGTGACGTCAACTA	222	0	UF_Msa_AF_100054	contig27683___1rc_nrnt	contig27683___1rc_nrnt	Unknown	
283	4	37	unmapped	0		0	TATCGATCAGCCTTCTGCGCTTCTCTTACTTTATCATCACAGGAACTGTTGGCTGTGTCA	224	0	UF_Msa_CF_121899	contig09417___0	contig09417___0	Unknown	
284	4	38	unmapped	0		0	GGACACACTGTGCCACCTTGCTTCCTTGCTTGCAGTTTCCTTTTTATTTGTATTACTTGT	226	0	UF_Msa_CF_127319	contig28673___0	contig28673___0	Unknown	
285	4	39	unmapped	0		0	TCTGTCTCAGATTGTGGAGGCAAGAAAAAAGGCCAAAAATGGAACCCCGGTCAATGAGAT	228	0	UF_Msa_AF_109795	contig00488___1rc_nrnt0	contig00488___1rc_nrnt0	Unknown	
286	4	40	unmapped	0		0	TGGATAAGGGATCCTTCCTTCCACCCTCCTTGCGCACCCGTTCTGTGCCCATCATCCCTT	230	0	UF_Msa_AF_104837	contig22033___1rc_nrnt0	contig22033___1rc_nrnt0	Unknown	
287	4	41	unmapped	0		0	CTTTAAAATCAGAGGAGTTGAGGGATTACTGGCTGTTTTCTGAGTGCCTTACCACTTGCA	232	0	UF_Msa_CF_125217	contig31219___0	contig31219___0	Unknown	
288	4	42	unmapped	0		0	TACACTGAATACAAGGACTGAGTTTGGGTGTTCAGAGAGTCAGATGACAATCAGGGAACG	234	0	UF_Msa_AF_108340	contig12084___1_nrnt	contig12084___1_nrnt	Unknown	
289	4	43	unmapped	0		0	ATCTGGACCCTGGATATTTCCTTGGAAAAGTCTGCTTCTTGGTCACCAATGCTCGTAATG	236	0	UF_Msa_AF_107738	contig00263___1rc_nrnt-1	contig00263___1rc_nrnt-1	Unknown	
290	4	44	unmapped	0		0	TTGGAGCTGCTCTCAGCTCCAGCCCTGATGGTGTGTTTAGGTTGGCAATGGGTCGTCATC	238	0	UF_Msa_CF_124650	contig04005___0rc	contig04005___0rc	Unknown	
291	4	45	unmapped	0		0	ATTTTTCAGTTCCTCCTGACGGACACTCACGTGGCTCTGCTCCGGGAGGATGGCGTCTTT	240	0	UF_Msa_CF_122142	contig03977___0rc	contig03977___0rc	Unknown	
292	4	46	unmapped	0		0	ACCAACACATGAAGTCCTGGGAGGTAACTGACCAGCCTGGCTCTAAGCTGCACAGCACAC	242	0	UF_Msa_CF_126350	contig16622___0rc	contig16622___0rc	Unknown	
293	4	47	unmapped	0		0	GAAGTATTATTACATGTAAGTAGCTCAATTTTCCATATTTATCCGCATGTAAAGGACCGG	244	0	UF_Msa_AF_107753	contig03169___1_nr0nt1	contig03169___1_nr0nt1	Unknown	
294	4	48	unmapped	0		0	ATGAGCTTGGTAGTCAGTGTCCATGTCTACAGTGTCCAGAAAGCATCACTAGAAAGACAG	246	0	UF_Msa_AF_103075	contig29092___1rc_nrnt-1	contig29092___1rc_nrnt-1	Unknown	
295	4	49	unmapped	0		0	TTCTTTGCACATATAACGTGGGCTTAACATGGCCTAACAACTTGCAGGTGAGGATAGCTG	248	0	UF_Msa_AF_107470	contig17164___1_nr0nt	contig17164___1_nr0nt	Unknown	
296	4	50	unmapped	0		0	TACGCTGTACTCGGGGAGGATAAGCCGTTGAAAACAGGAAAATGCTACAAGGTTCCTGAC	250	0	UF_Msa_AF_102623	contig05408___1_nrnt0	contig05408___1_nrnt0	Unknown	
297	4	51	unmapped	0		0	TAAACAGAGGCTGTGGAGGACGTTGGTCTTATAATGCCCTTAGATCCAATAAGGGTTCAG	252	0	UF_Msa_CF_124282	contig25266___0rc	contig25266___0rc	Unknown	
298	4	52	unmapped	0		0	AAGAAAAATACCAAAAAGACTCCAATACCAAGAAAGGCACCCAGCACTGGAAAACAGGGT	254	0	UF_Msa_CF_120537	contig04709___0rc	contig04709___0rc	Unknown	
299	4	53	unmapped	0		0	ACATCAACTTTATCACCTTAGGGTGGGACACCTACCTTGCCTACCTTAAACACAGAGATG	256	0	UF_Msa_CF_120578	contig14122___0	contig14122___0	Unknown	
300	4	54	unmapped	0		0	CAACTTAAAGTGAATGCACTCCTTCCCCGTCATATCTCCATTTGAAAAATGTCTGCCTAT	258	0	UF_Msa_AF_104411	contig28830___1rc_nrnt	contig28830___1rc_nrnt	Unknown	
301	4	55	unmapped	0		0	TGCCGTTGACTAACGTACATTTTTACCAAACTAATGTCCCATGGTGGTCCACAGGAAGGT	260	0	UF_Msa_CF_118868	contig14855___0	contig14855___0	Unknown	
302	4	56	unmapped	0		0	CGGTCTGATGTGGTGGAATGTTGGCCAGGGAGGTTCTAAGGATGAGGGGAACAATCTCCA	262	0	UF_Msa_AD_200295	LMB_Add_38	LMB_Add_38	Unknown	
303	4	57	unmapped	0		0	GAAAGACGAGAGACGAAAACTTAAGGGCACCACCTGTAAGGAGTGTGACATTTATTACGC	264	0	UF_Msa_AF_103952	contig08891___1rc_nrnt0	contig08891___1rc_nrnt0	Unknown	
304	4	58	unmapped	0		0	ATCCCAGGGAGAGCGCCACATGTGGAACCTGGAAAATTACATATTAACAAAAATGTGACC	266	0	UF_Msa_CF_123897	contig04688___0rc	contig04688___0rc	Unknown	
305	4	59	unmapped	0		0	GAAACCTCACAACTGGTCCAGAGCAGTGACTCTCCATCGCCCCCTCCTGGCTTGATTAAG	268	0	UF_Msa_CF_123192	contig29976___0	contig29976___0	Unknown	
306	4	60	unmapped	0		0	GCCACATTGACACCTAGAAATGACAAAGGAGGAAGCAGTTGATGGCACATAATTAGTACT	270	0	UF_Msa_AF_100121	contig00369___1rc_nrnt-1	contig00369___1rc_nrnt-1	Unknown	
307	4	61	unmapped	0		0	GATTACACGACTAATCAAGGAAGAGCTCATCAGATCACAAAATTCCTACCAGCCAACGAG	272	0	UF_Msa_AF_102396	contig04938___1rc_nrnt-1	contig04938___1rc_nrnt-1	Unknown	
308	4	62	unmapped	0		0	TATCTGCTCACTGGGGGTTTCAAGTTTTTGGTTGTTCCTATAGTTATGTCTGTGGCCCTG	274	0	UF_Msa_CF_125838	contig07113___0	contig07113___0	Unknown	
309	4	63	unmapped	0		0	TGGCAGTTAACAAATTCACCTTTCAGACACAGATGGGGTGAAAAAGAAGTTTAGGGGAAG	276	0	UF_Msa_CF_125635	contig27930___0	contig27930___0	Unknown	
310	4	64	unmapped	0		0	TCAGGCTGGAATGAGTGACACAGAAACCAGCTGAGTAAATACATTTAGAGCACGTCTCCA	278	0	UF_Msa_CF_120133	contig18129___0rc	contig18129___0rc	Unknown	
311	4	65	unmapped	0		0	CACTGAAGGTGAGATTCTCTCAAAGGTCAATGTACACTGTCCGGTATTTGACTATGTCCC	280	0	UF_Msa_AF_109700	contig06798___1_nrnt	contig06798___1_nrnt	Unknown	
312	4	66	unmapped	0		0	GGGCATTATTTTTTAGTTAAATGAAGGTGTGTGAGGATGTGTCTCTAAACGCAGGAAGTG	282	0	UF_Msa_CF_126828	LMB_S454.460.C1___0rc	LMB_S454.460.C1___0rc	Unknown	
313	4	67	unmapped	0		0	CCCAGCAAACTTGTTACACAACGGGGGACAGGTCCCACACAACAAACGGATCATTGGCAA	284	0	UF_Msa_AF_108869	contig16626___1rc_nr0nt1	contig16626___1rc_nr0nt1	Unknown	
314	4	68	unmapped	0		0	TGTCCAATTTTATTCCAGAAGATGAAGCAGCTCTCCTGAAAAATGGAAGATACACCTGCC	286	0	UF_Msa_AF_101636	contig01299___1rc_nrnt	contig01299___1rc_nrnt	Unknown	
315	4	69	unmapped	0		0	GGAGACCTCAGCTACAGGAGCGCAGGTTCCCTTTTTCCTCACCATGGCACATTTGAGGTG	288	0	UF_Msa_AF_104015	contig28074___1_nrnt	contig28074___1_nrnt	Unknown	
316	4	70	unmapped	0		0	TGATCCAAATGAAGTCTTCAGAGAGCCTCCGTTCCAAATGAACACCATGAACGTGATGTC	290	0	UF_Msa_AF_102900	contig05651___1_nrnt	contig05651___1_nrnt	Unknown	
317	4	71	unmapped	0		0	GACCGTTTAGTGTTGACTCTAAAACAACCCAGTCTCTCCTTTGACTTTGCTGTCCTACAG	292	0	UF_Msa_CF_120459	contig12542___0rc	contig12542___0rc	Unknown	
318	4	72	unmapped	0		0	AGGAAGAGCCATCCTTGTTAAGAGCTTCGCCAGAATTCACGAAACTAACCTGAAGAAGCA	294	0	UF_Msa_AF_106821	contig29451___1_nrnt	contig29451___1_nrnt	Unknown	
319	4	73	unmapped	0		0	ACAAACGAGCACTGCAGTAAACTGGGGCTTCACGTCAGTTTTACGTCAACAAATAGTACC	296	0	UF_Msa_CF_124526	contig15516___0rc	contig15516___0rc	Unknown	
320	4	74	unmapped	0		0	CCCGGTGGTTCAGGTGAGCTGGAATGATGCTCAGGCCTTCTGCCTGTGGAAGGGCAAGAG	298	0	UF_Msa_AF_105721	contig23414___1_nrnt	contig23414___1_nrnt	Unknown	
321	4	75	unmapped	0		0	CCAGGACTCAAGGTCAAAGATGTCAACCCAGATATTGGAGAAATCCTTGAAAAATACAAG	299	0	UF_Msa_AF_103194	contig01185___1rc_nrnt0	contig01185___1rc_nrnt0	Unknown	
322	4	76	unmapped	0		0	TTGGGGGTCGCCCACATTCCAGTTATAAAACAATCAAGAGACCAATTTGATTCACTGACT	301	0	UF_Msa_AF_104512	contig10607___1_nr0nt	contig10607___1_nr0nt	Unknown	
323	4	77	unmapped	0		0	GTATGCTAACCAGCCGACTGTGAAGATCACAGAACTGACAGACGAAAATGTCAAGTTCGT	303	0	UF_Msa_CF_124394	contig29466___0	contig29466___0	Unknown	
324	4	78	unmapped	0		0	ACTTGAGTCAAATCTTGTCTACATGCAGGGCATCAGCTTTAGCAAGGGCTGTTACATTGG	305	0	UF_Msa_AF_109386	contig30657___1rc_nrnt	contig30657___1rc_nrnt	Unknown	
325	4	79	unmapped	0		0	AGGTTTCTGTTCCGACAGTTCCATACAGGCATCTGGTTCTCCTGCGAGGAAAATATCCAC	307	0	UF_Msa_AF_104590	contig26947___1rc_nr1nt0	contig26947___1rc_nr1nt0	Unknown	
326	4	80	unmapped	0		0	CGCGATGTTAATTTGCACGAGTACACTTCAAAGTGAAAAACACTTTTAAAAATGATGCAC	309	0	UF_Msa_AF_105522	contig32092___1_nr1nt0	contig32092___1_nr1nt0	Unknown	
327	4	81		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
328	4	82		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
329	5	1		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
330	5	2	unmapped	0		0	ATTAAATGGATGCAAAACTACAATTTTGTCCTGTCAGCCAACCTCCATGGGGGAGCTGTG	311	0	UF_Msa_AF_108437	contig20375___1rc_nr1nt0	contig20375___1rc_nr1nt0	Unknown	
331	5	3	unmapped	0		0	TCGAGTGTGACGAGCCAGGACGCACAGCTGGTAATTGTTCCCTGCAGGATCTTCAGCTGT	313	0	UF_Msa_CF_119536	contig08278___0	contig08278___0	Unknown	
332	5	4	unmapped	0		0	TGTCTGTAATGTAAAGTAATGCCTTATATAATTTGATGGTAGCATACGAGCATGCATCTG	315	0	UF_Msa_AF_105051	contig29306___1_nr0nt1	contig29306___1_nr0nt1	Unknown	
333	5	5	unmapped	0		0	TGGAAGCACTCTGGACTCCATACCGTTACTGCCACAAGCTGGTGTGGGTGTAGACATGGA	317	0	UF_Msa_CF_120136	contig24775___0	contig24775___0	Unknown	
334	5	6	unmapped	0		0	AATGGATCTTTATTTACAGCAGTACTATCCTGTCAACAGTTCTGCAGGAACCCGGTCCAG	319	0	UF_Msa_CF_125544	contig12610___0	contig12610___0	Unknown	
335	5	7		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
336	5	8	unmapped	0		0	ACTGACCAACGTCAAAGCATCCGCCAAGATCAGATGGGCGGACTGCTTGTCTTGTGCAGG	322	0	UF_Msa_AF_103714	contig08585___1_nrnt	contig08585___1_nrnt	Unknown	
337	5	9	unmapped	0		0	AGTGGCTGCAGAGGATCGAGGACGGGACTGAGTCACCAGCAGGGATGTTGGGTGAGGACA	324	0	UF_Msa_CF_118398	contig09035___0	contig09035___0	Unknown	
338	5	10	unmapped	0		0	TTGATGAGGAGCTGGAAATGGTGTGTCTGGTGGATCCCGGTCTGCTTCAGGGAGATCGAC	326	0	UF_Msa_AF_109943	contig14974___1rc_nrnt-1	contig14974___1rc_nrnt-1	Unknown	
339	5	11	unmapped	0		0	TATCAGCATGTGTGCACGTACCGGGACTTTTATTACAAGACGTTTGAGCTTCCTGACTGT	328	0	UF_Msa_AD_200188	LMB_Add_7	LMB_Add_7	Unknown	
340	5	12	unmapped	0		0	TCATGGCAGACATGCACCTTATTGAGCAGGCGTGCGGTTTGGGTCAGGATATCGGCCTGT	330	0	UF_Msa_AF_101613	contig02499___1_nrnt	contig02499___1_nrnt	Unknown	
341	5	13	unmapped	0		0	CAGCCTGCAGGAGGCCTGTGCTCCCGTACTTACATAACATTCAGTGACGACGAAGCTTTC	332	0	UF_Msa_AF_106637	contig20054___1_nrnt0	contig20054___1_nrnt0	Unknown	
342	5	14	unmapped	0		0	TGCTATGTCTGTAGGTCAGAGCCCCTCCAGGACCTGATCTCCAAATGCCACAGTATCATG	334	0	UF_Msa_CF_122499	contig17624___0rc	contig17624___0rc	Unknown	
343	5	15	unmapped	0		0	ATGCGCATCGCTGGGGGGTTCGGCCAAATGATCCGAGAGGGCGGTAGTGAGGTCATTGTG	336	0	UF_Msa_CF_125604	contig23015___0rc	contig23015___0rc	Unknown	
344	5	16	unmapped	0		0	TGATGAAATGATCACACAGTTCATCACCCTCTGAAACCACTGCTGGAAACATCAAACCGC	338	0	UF_Msa_CF_120237	contig14724___0	contig14724___0	Unknown	
345	5	17	unmapped	0		0	ATGATGGTTACGTTGTGAAAAAGGAATATCTGAGGGACTGACAGCACGACACTCATGCAC	340	0	UF_Msa_AD_200215	LMB_Add_13_rc	LMB_Add_13_rc	Unknown	
346	5	18	unmapped	0		0	ATGGAAAGTTACTGTATGGGCACCAAAAAATATGTCCTCAATGAAGAGCTGTCGGGCCTG	342	0	UF_Msa_AF_106252	contig02822___1_nrnt	contig02822___1_nrnt	Unknown	
347	5	19	unmapped	0		0	ACTGCAACAGCTTGTATAGAATCCTGCCACTTTTATAACTCTAAACAAGCTCTTATGTGT	344	0	UF_Msa_AD_200099	LMB_Add_128	LMB_Add_128	Unknown	
348	5	20	unmapped	0		0	TATGTACATTGAGGGCAATTCCAAAGGGCTGGCGCCAGATATGACTCTAGCTTTGAAGTA	346	0	UF_Msa_CF_121094	contig10164___0	contig10164___0	Unknown	
349	5	21	unmapped	0		0	CTGGACAACAAGACAGTTCTTGTGACAGCCATGACGGCAGCAGCAGCAGCTCCTCGATTG	348	0	UF_Msa_CF_123990	contig06000___0	contig06000___0	Unknown	
350	5	22	unmapped	0		0	GATTCTACACCGGTACCGAACGCCACCACCTACAGTCAGACACCATGAGCGCCGCAGCCA	350	0	UF_Msa_CF_120699	contig24500___0	contig24500___0	Unknown	
351	5	23	unmapped	0		0	AATAACAACCGTTTAGTTCATCTATCTGCACAGCTGCGCACCTCACAGCCCCTGCATGAC	352	0	UF_Msa_AF_109672	contig12135___1rc_nrnt-1	contig12135___1rc_nrnt-1	Unknown	
352	5	24	unmapped	0		0	CCACCTTAATGAGGTGGCACTCCCTCCACAGCACTGGATGTACGGAGATACACACAAGTT	354	0	UF_Msa_CF_125272	contig25191___0	contig25191___0	Unknown	
353	5	25	unmapped	0		0	AAGCACCCAGGACAAGGACGCATCAACGAAGCCCAAGTACCTCACCAAGAAGACTCAGGC	356	0	UF_Msa_AF_103346	contig09655___1_nrnt	contig09655___1_nrnt	Unknown	
354	5	26	unmapped	0		0	AAAGACTTTGACCTGGACATGACCGAAGAAGAAGTCCAACTGGCACTCTCTAAAATAGAA	358	0	UF_Msa_AF_102397	contig29420___1_nrnt	contig29420___1_nrnt	Unknown	
355	5	27	unmapped	0		0	ACACGATCGAGTTCCTCAGACACATTAGAGATTTCTTCCAGATCATGTTCAAAATTGAAG	360	0	UF_Msa_AF_106443	contig31212___1_nrnt	contig31212___1_nrnt	Unknown	
356	5	28	unmapped	0		0	GATGAGCTGCCACCACCGTTTCTGTTCCTGACTTAAGCTCATGTAAAAATGTTCTCAAGG	362	0	UF_Msa_CF_119513	contig23968___0rc	contig23968___0rc	Unknown	
357	5	29	unmapped	0		0	GGTAAAGATGGAGCATGTAGAGAGTGAACCCTTACCCAGCGATGAAACAAATCAGGAATA	364	0	UF_Msa_CF_118740	contig14117___0	contig14117___0	Unknown	
358	5	30	unmapped	0		0	TTATGGTACCTTTTGCCACCTGACCCCCTAGGAGGAAGACCTGGGCAGGAGAAGCTGCTT	366	0	UF_Msa_CF_120468	contig14986___0	contig14986___0	Unknown	
359	5	31	unmapped	0		0	CTGTCTACAATCCAATGATCTACATCTGCATGAACAAGCAGTTCCGCCACTGCATGATCA	368	0	UF_Msa_AD_200210	AY742597	AY742597	Unknown	
360	5	32	unmapped	0		0	TCGTAACAGGTCTTCTGCCGGAGGGACTCAGACAAGAAGTTTACGGACTGTGGGAGGAAT	370	0	UF_Msa_CF_123425	contig18239___0	contig18239___0	Unknown	
361	5	33	unmapped	0		0	ATTATTTCAGGGACTTTAGGCAAGGCCTTCGGCTGTGTGGGCGGCTACATCGCGAGTACC	372	0	UF_Msa_AF_106542	contig24477___1rc_nrnt	contig24477___1rc_nrnt	Unknown	
362	5	34	unmapped	0		0	AATGGCAGAGGAGGATGAAGGTGAGGCGGAGGCTGGATGGATCGAAGGCGCTGCCGTCTT	374	0	UF_Msa_CF_121659	contig19590___0	contig19590___0	Unknown	
363	5	35	unmapped	0		0	GACGAGCCCAGCCAGGAGCCAGATTAAGCAGAAGAGTCTTTTAGACTGAAATAATTAGAT	376	0	UF_Msa_CF_119901	contig06417___0	contig06417___0	Unknown	
364	5	36	unmapped	0		0	AGTCTGAGCCTTCTTTTCTAACAAGTTTGCTCGCTACAAACTCAACACTGGCAGCACAAC	378	0	UF_Msa_CF_119942	contig11508___0	contig11508___0	Unknown	
365	5	37	unmapped	0		0	TGTAGCCTCCTGATTAGCAACAATCAAGTTCCCCTGAGAAGGATTTAAGATGAAATTCAA	380	0	UF_Msa_CF_118520	contig31542___0	contig31542___0	Unknown	
366	5	38	unmapped	0		0	CTATTATCTCGGTGGACGGTGACACAGTGACAGTGAAGACCCAGAGCACCCTTAAGAACA	382	0	UF_Msa_AF_109375	contig22042___1_nr0nt	contig22042___1_nr0nt	Unknown	
367	5	39	unmapped	0		0	TAATTTTGAGTAAAAATGGTGGACTGGAGTCCGATAGCGAAGGTGTACGACCCGCTGAAA	384	0	UF_Msa_AF_107131	contig10437___1rc_nrnt	contig10437___1rc_nrnt	Unknown	
368	5	40	unmapped	0		0	TCTACCCCTTCAACATGCACGACGAGCTGGACAACCTCACCTTCTACACGTGTCAGTGTT	386	0	UF_Msa_AF_107331	contig26365___1rc_nrnt0	contig26365___1rc_nrnt0	Unknown	
369	5	41	unmapped	0		0	CGCTTCCGGGACAGGACCAGAACTGAAGGTAACCACAGCAGTGTTGATTGTCCTCATGCC	388	0	UF_Msa_CF_127184	contig31215___0	contig31215___0	Unknown	
370	5	42		1028	E1A	0		390	1	(+)E1A_r60_3	E1A_r60_3	E1A_r60_3		CONTROL
371	5	43	unmapped	0		0	ACTTTGTAGGAAACTGATTAACCCACTGACAAACTGCTGCTGAGGACAACTTGTGTCTAG	392	0	UF_Msa_CF_119098	contig32711___0	contig32711___0	Unknown	
372	5	44	unmapped	0		0	ATGTTAAGACTGTTAAACCACAGCAAGGGGTCTTCAAAGTGGGCAAACGGAAAGTGAGAG	394	0	UF_Msa_CF_126644	contig29678___0	contig29678___0	Unknown	
373	5	45	unmapped	0		0	CAAAAATGTTAAGGATGTCACATGGCCTCCCCAAAAGGTTTCCTCGATGGGACCTTTTAG	396	0	UF_Msa_AF_100613	LMB_S454.sd.24.C3___1_nr0nt1	LMB_S454.sd.24.C3___1_nr0nt1	Unknown	
374	5	46	unmapped	0		0	AACAACACCAAGTCCTTCGAGGACATTCACCACTATAGAGAACAGATTAAGCGGGTGAAG	398	0	UF_Msa_AF_100017	contig30206___1_nrnt	contig30206___1_nrnt	Unknown	
375	5	47	unmapped	0		0	TGATCTATGAAGTTCAGGTGCTAGTCTCCTGGGAAACTCTTACAGGGTAACTTCAGATAT	400	0	UF_Msa_CF_120990	contig07215___0rc	contig07215___0rc	Unknown	
376	5	48	unmapped	0		0	TCGCTGGTCCCGCCTAGCGTTATGCCTGCAGGTCAGGTGTCTTTGTCCAGAGCGTCCAAC	402	0	UF_Msa_CF_117991	contig17460___0rc	contig17460___0rc	Unknown	
377	5	49	unmapped	0		0	TTAAAAACTTCCAGTTTGATGGACCCGAGGCATCCAGTGCCCTGAAATTCGCATGTGAAA	404	0	UF_Msa_AF_100746	contig06158___1_nrnt	contig06158___1_nrnt	Unknown	
378	5	50	unmapped	0		0	ATCTATTGAAAGTCATCCCTTGATCCAAGCTTTTGTCCTTCTGCTCCACGGGAGGTTTCT	406	0	UF_Msa_AF_100708	LMB_S454.sd.335.C1___1_nr0nt1	LMB_S454.sd.335.C1___1_nr0nt1	Unknown	
379	5	51	unmapped	0		0	AAACACCTGCTGCTGTTCATCGGTGAGAGGCCGGCTGATGGGTCCAGTCCAGACCGACCA	408	0	UF_Msa_AF_108973	contig15776___1_nrnt0	contig15776___1_nrnt0	Unknown	
380	5	52	unmapped	0		0	TAAAACCTGCCACTTGGCCAAAGTACCAGCTCATGCTGTTGTCACCCGGAAGGACCCACA	410	0	UF_Msa_AF_108059	contig27546___1rc_nrnt	contig27546___1rc_nrnt	Unknown	
381	5	53	unmapped	0		0	TGAATTGTTGACCGTCGTCAGACGACCCTCGGGAACAAGACGTAGATGTGTGTTGTTTGA	412	0	UF_Msa_CF_124471	contig27606___0rc	contig27606___0rc	Unknown	
382	5	54	unmapped	0		0	TGTTGATGTGAGCAGCCATGCAACAAACAGCTGTAACAGTGACAAGCAATCAGTTTCCTC	414	0	UF_Msa_CF_122558	contig17761___0rc	contig17761___0rc	Unknown	
383	5	55	unmapped	0		0	TGCACCACAAACGGGCCAGTAGCCGATGACGTCAAGTCTCCTGACTTACAAGGCATTGGG	415	0	UF_Msa_CF_123816	LMB_S454.227.C1___0	LMB_S454.227.C1___0	Unknown	
384	5	56	unmapped	0		0	TATTCAGTGATAAATAATTTCCTATGATCATAGGCTTTATGTGAAGACATCCGATCAAGG	417	0	UF_Msa_AF_109934	contig26181___1_nr0nt1	contig26181___1_nr0nt1	Unknown	
385	5	57	unmapped	0		0	GCGATATGAACAAGTGTTCAACAGAGCTGCGGATAATCTCGCAACCAAACTGATTCAAAG	419	0	UF_Msa_CF_120134	contig04782___0	contig04782___0	Unknown	
386	5	58	unmapped	0		0	ATCCGCTCCAGACCCGCAGTCAGAGCTGCTGTCGTCATTCTTCTTCTTCTGTTTTACCAC	421	0	UF_Msa_AF_104759	contig11311___1_nr0nt1	contig11311___1_nr0nt1	Unknown	
387	5	59	unmapped	0		0	AAGCTGTGACATCACTACTGGGGTGATGTCTCACAGAGAGCCGGGGGCCAAGAAACACCT	423	0	UF_Msa_CF_127612	contig24101___0	contig24101___0	Unknown	
388	5	60	unmapped	0		0	CACGGTATTATCTGCCAAACACCTTTAATTTGACCAAATCTAAGCCTTATCAATACGACT	425	0	UF_Msa_CF_120727	contig16927___0	contig16927___0	Unknown	
389	5	61	unmapped	0		0	TGTCCTAGAGCCCGCCCTGATGCGTCTGTGCGCCTGGTACCTCTATGGGGAGAAGAGGCG	427	0	UF_Msa_AF_104325	contig28266___1rc_nr1nt0	contig28266___1rc_nr1nt0	Unknown	
390	5	62	unmapped	0		0	AGGGCGGCCCAGATCACAGCCTACGCCATCACCAAGGCTCAGATAGCCGGCCGGGACGCG	429	0	UF_Msa_AF_104664	contig21435___1_nr0nt1	contig21435___1_nr0nt1	Unknown	
391	5	63	unmapped	0		0	CTATGCGGTTGCCAGATGTGCAACGAAAGCCTTTGCCACTGAAACCTGGGAACGTAAACC	431	0	UF_Msa_AF_103460	contig08925___1_nrnt0	contig08925___1_nrnt0	Unknown	
392	5	64	unmapped	0		0	ACTACAACACCTACCAGATTGTGCAGTTCAACCGGTTACCACTGGTCATCAGTTTCATTG	433	0	UF_Msa_AF_104869	contig31107___1rc_nrnt	contig31107___1rc_nrnt	Unknown	
393	5	65	unmapped	0		0	GCTGTGGTGACCCAGGCGTTTGATGAACTCCATGAGGCAGTGGAGGAAGAGAAGAAGAAA	435	0	UF_Msa_AF_102972	contig26677___1rc_nrnt0	contig26677___1rc_nrnt0	Unknown	
394	5	66	unmapped	0		0	TGGCCTGGCGCTGACCACTATTGCTCTCTCTGGACTACTGATCCCATTACTGCTGTCGCT	437	0	UF_Msa_CF_124531	contig05137___0	contig05137___0	Unknown	
395	5	67	unmapped	0		0	TTTTGTGATTGGTTCTTTACATATCTGTCACCTGAGACACGCAACAGGAGATAGGCAAGG	439	0	UF_Msa_CF_125669	contig25246___0	contig25246___0	Unknown	
396	5	68	unmapped	0		0	TTTCAGCTCAAACTACAAGTTAAAGCTCTCTTGTGTTTCTTCGTGCAGGTGGGTTGAACG	441	0	UF_Msa_CF_121803	contig22854___0	contig22854___0	Unknown	
397	5	69	unmapped	0		0	CTGCAGTGGTCAGCAAAGTTCCCATAGGAGGAGGCAAAAAGAAGGACAAGTCTGACTGAG	443	0	UF_Msa_AF_104713	contig09784___1rc_nr0nt1	contig09784___1rc_nr0nt1	Unknown	
398	5	70	unmapped	0		0	GAAAGTGGCTCGCTCCTACTGGTGGAAGAACGTCAAGTTGATCGTGGTCATCGTGGTGGT	445	0	UF_Msa_AF_104780	contig26958___1rc_nrnt	contig26958___1rc_nrnt	Unknown	
399	5	71	unmapped	0		0	ATGAAGGACAGCAACGCACCCAAGGCCCCCTAACGGGCTATGTTCGCTTCATGAACGACA	447	0	UF_Msa_AF_109523	contig04762___1rc_nrnt	contig04762___1rc_nrnt	Unknown	
400	5	72	unmapped	0		0	GAAACTGGCCCAGGTGAAGGTGGACGTCAGCAACCTGAAGGAAGATGTCGGCAAACTCAA	449	0	UF_Msa_CF_125565	contig32392___0	contig32392___0	Unknown	
401	5	73	unmapped	0		0	GCCAAGTTTTGGGAGGTGATCAGTGATGAGCGTGGACATTGACCCAACCGGTACATACCA	451	0	UF_Msa_AF_102067	contig24622___1_nr0nt1	contig24622___1_nr0nt1	Unknown	
402	5	74	unmapped	0		0	GATAAGAAATCCTGTGAGGTTGTACAAAGGAGCAGATCTCCTCAAAGACCAAACCTTCTT	453	0	UF_Msa_AF_101037	contig01323___1_nrnt0	contig01323___1_nrnt0	Unknown	
403	5	75	unmapped	0		0	GTTGTCTACCGCGACCAGCAGCCCTCTGCCGCCTCCTCCTCTTTTTCTTCTGAGTCACTG	455	0	UF_Msa_AF_101326	contig25226___1rc_nr0nt1	contig25226___1rc_nr0nt1	Unknown	
404	5	76	unmapped	0		0	CAGCAGTTCAACTACCAGGCCGGGACGACTGCCACACTCAAACAAACAACTGAGGCACAA	457	0	UF_Msa_CF_120170	contig26741___0rc	contig26741___0rc	Unknown	
405	5	77	unmapped	0		0	ACAGTATCTCCAGAGAGAATTGAACAGAGTTATGGAATAGAAGGCAGAGAGATGGTGTGT	459	0	UF_Msa_AF_108517	contig07956___1_nr0nt	contig07956___1_nr0nt	Unknown	
406	5	78		130	HybridizationNegative	0		461	1	(+)eQC-41	EQC	EQC		CONTROL
407	5	79	unmapped	0		0	CATTGGCTTCCACGGTGGGCTGATCCAGCGCTGCTCTTCCGGTGGAGACGTGGCTCTGTA	463	0	UF_Msa_CF_122355	LMB_S454.306.C1___0	LMB_S454.306.C1___0	Unknown	
408	5	80	unmapped	0		0	TATTCACCAGTCAAAACATAAACTTCAAAACATGAGGTCTGAGGAGCGAAATCCTCACGG	465	0	UF_Msa_CF_123398	LMB_S454.749.C1___0rc	LMB_S454.749.C1___0rc	Unknown	
409	5	81	unmapped	0		0	AGACTGTGATGGTTGAATTCACTAGCAGTGAGACTTCAGCCAAGATGGAGATAGAACGGA	467	0	UF_Msa_CF_124758	contig23708___0	contig23708___0	Unknown	
410	5	82		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
411	6	1	unmapped	0		0	TGAGAATCGCTGTGATCACAGACGAACATGTCAAGTCTCATTTTGCCCCGATAGTAACAG	310	0	UF_Msa_CF_122352	contig25815___0rc	contig25815___0rc	Unknown	
412	6	2	unmapped	0		0	ATAATGGCAGTATCCCAAATGGACAGCCAATGCAGAATTCTCAGCACTAGAGGCTGTGTT	312	0	UF_Msa_CF_123555	contig17961___0	contig17961___0	Unknown	
413	6	3	unmapped	0		0	TGTATACTGCTGTGCCATTTTTGTTTATTTTGAAGATTTTCCAATAAAATAGGTGAAATG	314	0	UF_Msa_AF_108454	contig19641___1_nr0nt1	contig19641___1_nr0nt1	Unknown	
414	6	4	unmapped	0		0	GTCAACACACAGCTTCTTTGGGGGAGATGAGCTAACGCAGTGCAACTCTGCAAATAGCGG	316	0	UF_Msa_CF_122041	contig09172___0	contig09172___0	Unknown	
415	6	5	unmapped	0		0	GGATCAGATTCACCAGCCCAAACAACACAGCAACAACATCCGGCAAAACCCCAGGTCAGA	318	0	UF_Msa_AF_109876	contig12853___1_nrnt	contig12853___1_nrnt	Unknown	
416	6	6	unmapped	0		0	TTAACTTTGTCTCCAAAGTTTTCAGCAGTTACTTCCTCCAGCAGCTGCAAGAGCAGGGAA	320	0	UF_Msa_AF_104189	contig22892___1_nrnt	contig22892___1_nrnt	Unknown	
417	6	7	unmapped	0		0	ATTCAGGTGACAAATGTCTCCCCGAGCACAACGTCCGAGCAAATGAGGACTCTGTTTGGC	321	0	UF_Msa_AF_108304	contig04063___1rc_nrnt0	contig04063___1rc_nrnt0	Unknown	
418	6	8	unmapped	0		0	GGACTAGAAAGCTACAGCAACAGACGTTATCTCAAAGTTAAAGTCACTCCTTATAAGACG	323	0	UF_Msa_CF_118990	LMB_S454.969.C1___0rc	LMB_S454.969.C1___0rc	Unknown	
419	6	9	unmapped	0		0	ATGTCTGCCAAGCAGATTTAATGTAGAGCTTGTGCACCGTGATGACAAACAAAACATTAA	325	0	UF_Msa_CF_121966	contig30928___0	contig30928___0	Unknown	
420	6	10	unmapped	0		0	GTAAAAATAGCCGCTGGGGCCGTAGTTTGTGTTGAAAGTGAAATTAGAGGAGATGTCACC	327	0	UF_Msa_AF_108227	contig00382___1rc_nrnt0	contig00382___1rc_nrnt0	Unknown	
421	6	11	unmapped	0		0	TGTGAGCAGATCCAAGATGAAGTCAAAAATAGGGGAACATCTAGTAAAGAATCAGAGTCT	329	0	UF_Msa_CF_125768	contig07861___0rc	contig07861___0rc	Unknown	
422	6	12	unmapped	0		0	TATTAGGGCTGTTTTACCTTAAGTGTGTCCTGGCTTGTTAATAGTTGTACCTCGCCGCGA	331	0	UF_Msa_AF_105296	LMB_S454.sd.301.C1___1rc_nrnt	LMB_S454.sd.301.C1___1rc_nrnt	Unknown	
423	6	13	unmapped	0		0	AAAGACATGGGAAACAACCAATCTTGTGGATAACCTCCCAAAGCTAATTACAGTACAGTG	333	0	UF_Msa_AF_100197	contig16272___1_nr0nt	contig16272___1_nr0nt	Unknown	
424	6	14	unmapped	0		0	AAACAAGAAAGCCTTCTACAGACGAGCTCTGGCTTAACAAGGGTTTACAGGACTACCTGT	335	0	UF_Msa_AF_103303	contig20004___1rc_nr1nt0	contig20004___1rc_nr1nt0	Unknown	
425	6	15	unmapped	0		0	CAGAGGAGGATACCCAGCTCTAACAGAGGTGATGAACAAGCTCAAGCAGAACCAGGACTT	337	0	UF_Msa_AF_101810	contig15289___1rc_nrnt-1	contig15289___1rc_nrnt-1	Unknown	
426	6	16	unmapped	0		0	TTCTCATACGCACATGGAAAGAGCAGAAACAAGAGACTGTTGCTCGAATCACTCACTCAC	339	0	UF_Msa_AF_100759	contig28603___1_nr0nt	contig28603___1_nr0nt	Unknown	
427	6	17	unmapped	0		0	ACAGTGACAGACGTTATTCTTTCACTCACTGAACCAGTCGTTCCTTCTGTTCTTTCTCCG	341	0	UF_Msa_AF_106979	contig27989___1rc_nr0nt	contig27989___1rc_nr0nt	Unknown	
428	6	18	unmapped	0		0	AGATGAACCCGACGACTGGATCCAAAGAGCCGCGGTGCTCGATTCAAACAGCGCCGCACC	343	0	UF_Msa_CF_127159	contig05644___0rc	contig05644___0rc	Unknown	
429	6	19	unmapped	0		0	GCTGATGTGGGACAGGAGAAAGCCAAACAAACCAGCCTCTAATAATCACAGAACCAGCTG	345	0	UF_Msa_AF_100463	contig27347___1rc_nrnt-1	contig27347___1rc_nrnt-1	Unknown	
430	6	20	unmapped	0		0	ACATACACAAACAGACAGACGAAGAGACTTTTCTCTGTAGCAAAGACACTATATTTGCAA	347	0	UF_Msa_CF_117884	contig26371___0	contig26371___0	Unknown	
431	6	21	unmapped	0		0	CAAGAGATAATGGACGCCCTGCTGTTGCAGTGCTTTCTCCATGCTCTCAAGAGCAAGGTG	349	0	UF_Msa_CF_126825	contig01458___0rc	contig01458___0rc	Unknown	
432	6	22	unmapped	0		0	CGGCCAGCCCCAATCTCCACACCTGAACCCCATTGAAAACCTCTGGAAATTTGATCAAGA	351	0	UF_Msa_AF_106279	contig26892___1_nr0nt1	contig26892___1_nr0nt1	Unknown	
433	6	23	unmapped	0		0	AGATGGAAATGTTGAACTCACAGAGACATGCAGAGAGAATTGAGGATACAGACACGGCCT	353	0	UF_Msa_CF_119633	contig20099___0rc	contig20099___0rc	Unknown	
434	6	24	unmapped	0		0	TGCTGAACTGGTGCACATCGATTTAGGCGTGGCCTTTGAGCAGGGGAAGATCCTACCCAC	355	0	UF_Msa_AF_102436	contig02601___1rc_nrnt	contig02601___1rc_nrnt	Unknown	
435	6	25	unmapped	0		0	AGATGTGCGTCCTGCGACTGACTCCAGACAACCTGTTCTTCGTCCTGTCGGGTAAAGTGG	357	0	UF_Msa_AF_103529	contig00323___1rc_nrnt0	contig00323___1rc_nrnt0	Unknown	
436	6	26	unmapped	0		0	TACTCTAACATGTCGTCCACCACTCTTTCTTCTCCTCTGTGCTTCCTCAAAAGGAATTAT	359	0	UF_Msa_CF_125879	contig02664___0rc	contig02664___0rc	Unknown	
437	6	27	unmapped	0		0	AGCCCAGAGGGAAAATGAATCAGCGTTAGACGCTTCCTGTTGCAGCTTCAGCAACATCCT	361	0	UF_Msa_CF_126793	contig24100___0	contig24100___0	Unknown	
438	6	28	unmapped	0		0	CAAGTCAGAGCTATAAAAAACTCACAACAGGAGGAAGAGGATTGGGAAATCCATGCAAAG	363	0	UF_Msa_CF_125416	contig26642___0	contig26642___0	Unknown	
439	6	29	unmapped	0		0	GTATGGCATAGCATAGAAATATCAGGATCCAGTGAGTGATCAGGAGAGATCAATAATGTG	365	0	UF_Msa_CF_121004	contig21065___0rc	contig21065___0rc	Unknown	
440	6	30	unmapped	0		0	TTTCTCATTCGGGAAAGGGGCTGCTGTCAAGACCAGGTCAGACCTCCCTGCGGCTGGCTC	367	0	UF_Msa_CF_122543	contig00845___0	contig00845___0	Unknown	
441	6	31	unmapped	0		0	TTTCTGTCTGTCGAGCTCTCTGCTCTGAATCAGCAAGAGGAAGCTATGGAGTGTCTTGTG	369	0	UF_Msa_CF_125015	contig18329___0	contig18329___0	Unknown	
442	6	32	unmapped	0		0	CTTCCAGGTGGATACCATAGGCATAAGCAAATGAACTACCCACACACAGTATATGACAGG	371	0	UF_Msa_CF_119207	contig14661___0	contig14661___0	Unknown	
443	6	33	unmapped	0		0	AGATATATGAGCAGCTCTCTGGGACTGAAATCCTAGATGCCATCGAGAATGAGACTTCTG	373	0	UF_Msa_AF_102985	LMB_S454.sd.512.C1___1_nrnt	LMB_S454.sd.512.C1___1_nrnt	Unknown	
444	6	34	unmapped	0		0	ACCACTGCTCAACAACTATAAGGATTGCTGGAAGATGGTCCCTACGTGAATTCTCTTGAC	375	0	UF_Msa_CF_126933	contig08554___0	contig08554___0	Unknown	
445	6	35	unmapped	0		0	ATGCAGTGCGGAATCGACCCGGCGAGGACATTCAAAACTATGGCAGAAGACTCCAACATA	377	0	UF_Msa_CF_127332	contig09372___0	contig09372___0	Unknown	
446	6	36	unmapped	0		0	TGCCAATATCTGTCATGAATGTCTACTGCATGTAATCGTCCACGATAAAGATGATACAGC	379	0	UF_Msa_AF_105395	LMB_S454.1083.C1___1_nrnt	LMB_S454.1083.C1___1_nrnt	Unknown	
447	6	37	unmapped	0		0	GCATCAGCAGCAGCGACACCGCAGCGCAGCCTCCAGTCTCACCTGCTCCTCATCTGCGCT	381	0	UF_Msa_CF_119486	contig18765___0	contig18765___0	Unknown	
448	6	38	unmapped	0		0	AGGTCTTCTCTCTGAAATCGCAGACCCAGACCTTTTCCTGCAGGATTTGTTGAACTCTTT	383	0	UF_Msa_AF_102008	contig25294___1_nrnt	contig25294___1_nrnt	Unknown	
449	6	39	unmapped	0		0	AACAACGCTTTAGAGACTCAACAATAAATTCCCATTTTTAAGCCGCAATCTTTCACTAAG	385	0	UF_Msa_AF_102414	contig21093___1_nr0nt	contig21093___1_nr0nt	Unknown	
450	6	40	unmapped	0		0	AAGGCAAGGCACGACGAGATCCGCAGGAAGTATGGTCTGATCGGTGACGCGGACCACCCA	387	0	UF_Msa_CF_126804	contig05944___0rc	contig05944___0rc	Unknown	
451	6	41	unmapped	0		0	AATGAGGGACCAATGGGAACCTCCCGCTCCTGAATCCACTAATCAACGACAATGACATCA	389	0	UF_Msa_CF_118352	contig25097___0rc	contig25097___0rc	Unknown	
452	6	42	unmapped	0		0	AGTGAAATCCTGGAATCTGCCTGCTCCAGCCCCTCCACAGGGTTCTGCCTGGTGACCTGG	391	0	UF_Msa_AF_106479	contig06885___1_nrnt0	contig06885___1_nrnt0	Unknown	
453	6	43	unmapped	0		0	GGTTCCAGCAAGCATCAAGCTGGTTAGACTCTGCCATGTAGAAGGAGCTGATAATGAGTG	393	0	UF_Msa_CF_122503	contig22649___0	contig22649___0	Unknown	
454	6	44	unmapped	0		0	AAGTTCCTCATTAAGCCAGAGGGTCTTTGAATCATACATGAGTCCTACATCCTATCCCGT	395	0	UF_Msa_CF_119824	contig19947___0rc	contig19947___0rc	Unknown	
455	6	45	unmapped	0		0	ATCTGCTGTCAGGAGAACATCTCCATCACCTCAGGAACCCTTGTGCAGAAACATTGCATC	397	0	UF_Msa_CF_123005	contig08048___0	contig08048___0	Unknown	
456	6	46	unmapped	0		0	GAGACGCCTTGCCATCTGACGCCAGCCTCAACTCCCTCAACAAGGCCCTGTCCTCGGAGA	399	0	UF_Msa_CF_123917	contig10849___0	contig10849___0	Unknown	
457	6	47	unmapped	0		0	AGGACGTCCGCAAACACACCTCTGATATCTCTGCAAATTCCATTATAAGTGTACCTGTCC	401	0	UF_Msa_CF_118828	contig26939___0rc	contig26939___0rc	Unknown	
458	6	48	unmapped	0		0	TATGAACCACACATTGTGCCAAGCACAAAACAACCCAATCAGCTTTTCTGTAAGCTAACC	403	0	UF_Msa_AF_105581	LMB_S454.153.C1___1rc_nrnt	LMB_S454.153.C1___1rc_nrnt	Unknown	
459	6	49	unmapped	0		0	TAAAAACAGGTTTGGCATAGTGGACACAACAGTTGGCAAAACACATGGTAGTACCTGCCG	405	0	UF_Msa_AD_200025	LMB_Add_150	LMB_Add_150	Unknown	
460	6	50	unmapped	0		0	GTCTTTACAGATTTGGTTTAACTTGACACTTTATGATGGATTTGGCCAGAGAAATGATCA	407	0	UF_Msa_AF_104474	contig13503___1_nr0nt1	contig13503___1_nr0nt1	Unknown	
461	6	51	unmapped	0		0	AACCTGCTAGCACCTATGCAGCCCCTTGTTTCGTCCCAAATTGCAGAAGCCACTATTGAA	409	0	UF_Msa_CF_120760	contig09564___0rc	contig09564___0rc	Unknown	
462	6	52	unmapped	0		0	CAACAGAGACTTTGACTGAAACGCACAACGCTCGAACACCAACCTTCATACTCTGCCTCA	411	0	UF_Msa_CF_123089	contig07801___0rc	contig07801___0rc	Unknown	
463	6	53	unmapped	0		0	TCTGATGAAAAACTGTGCTTTGACGAATTACAGCTCAATAAACATCTGACTGTTTATACC	413	0	UF_Msa_AD_200251	LMB_Add_91_rc	LMB_Add_91_rc	Unknown	
464	6	54		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
465	6	55	unmapped	0		0	GTCGGGCGGGTCAAGATTATTTTTCTTATCTGTAACTTGGTTTGATTAACTTGTTTTAAG	416	0	UF_Msa_AF_110094	contig28145___1_nrnt	contig28145___1_nrnt	Unknown	
466	6	56		1028	E1A	0		418	1	(+)E1A_r60_a135	E1A_r60_a135	E1A_r60_a135		CONTROL
467	6	57	unmapped	0		0	GTCTGTCTGTCTTTCTGTCCATCCATCGATCCCAACTGTCCTCCGTCCAGCTCAGGAGAT	420	0	UF_Msa_AF_101571	contig23937___1_nr0nt	contig23937___1_nr0nt	Unknown	
468	6	58	unmapped	0		0	ACGAACAAAGAACTTTCGGCGTTGAGAAGCGGTTGTTGATGAGCGGCTGTCTCCGGTGGC	422	0	UF_Msa_CF_123846	contig05660___0rc	contig05660___0rc	Unknown	
469	6	59	unmapped	0		0	TCACCAGTTGACATCTACAAACAAACACTGTAGCTCACGTCTTGTGTTGAGGAGACAGCA	424	0	UF_Msa_CF_126660	contig26544___0rc	contig26544___0rc	Unknown	
470	6	60	unmapped	0		0	AGTTCTCTTTCCTTCTTTCTTTTCCCCAGACTTTCTGCTTGATTTTGGAGTGGAGGGAGC	426	0	UF_Msa_AF_100858	contig14878___1_nr0nt	contig14878___1_nr0nt	Unknown	
471	6	61		0		0		428	1	RC6	RC6	RC6		CONTROL
472	6	62	unmapped	0		0	GTGACTCAGCTTACTGCAGGACTGTTTGCAGTGTTATGAGGAAGTGGACGAGAGCTGAAT	430	0	UF_Msa_CF_126061	contig07586___0	contig07586___0	Unknown	
473	6	63	unmapped	0		0	AGACTTTATAAAGAGGGGATAAACCTTCGACGCACAGATGATAACAGGAGCGACACCAAA	432	0	UF_Msa_CF_122582	contig25102___0	contig25102___0	Unknown	
474	6	64	unmapped	0		0	ATGTTGTAACCAAACAGACGTCCGAGGAAATGGCTATGAGGTACCAACCTCCAGACAAAT	434	0	UF_Msa_CF_122632	contig07562___0	contig07562___0	Unknown	
475	6	65	unmapped	0		0	GACGCACGACTCCCTCCATCTTCTCTTTCTTGGACCGCTCTTACTGGAAAAGGCAAAAGG	436	0	UF_Msa_AF_109481	contig19087___1_nr1nt0	contig19087___1_nr1nt0	Unknown	
476	6	66	unmapped	0		0	AAAGGCATCAAGACAGAGTCGAAGCTCTGGGCTTTGACCCACATGCCAAAGAAAGATTTA	438	0	UF_Msa_AF_101837	contig09665___1rc_nrnt0	contig09665___1rc_nrnt0	Unknown	
477	6	67	unmapped	0		0	ATAAAGTTCTTTTTTCTCAGTTGACGACTAACAGCTACAGCTAAACATCACAAACACGGC	440	0	UF_Msa_AF_104864	contig10808___1_nr0nt	contig10808___1_nr0nt	Unknown	
478	6	68	unmapped	0		0	TGTTCAGTGAGGTGACGGCGCTGTCTCGCTGTTTGTCGGGAGAAGGGGAACTTCACGGCG	442	0	UF_Msa_CF_127753	contig11890___0	contig11890___0	Unknown	
479	6	69	unmapped	0		0	ATTTGAAATGGCAAGAAACGAGGAGAAGCAACAAGGGAGACTGAACAGACTGTGGCTTCA	444	0	UF_Msa_CF_122266	contig12970___0	contig12970___0	Unknown	
480	6	70	unmapped	0		0	CTTCATACTGTTGTGGGGAAATGACTGCATACACTCTTTATGGTTAAACTCTACTTTGGC	446	0	UF_Msa_AF_105116	contig28599___1rc_nrnt	contig28599___1rc_nrnt	Unknown	
481	6	71	unmapped	0		0	GCCTCAGTTTGAGGTTAAGGAGTACAAAATAATTCTATCAACCCTTTGTGTACATAACAT	448	0	UF_Msa_CF_123867	LMB_S454.1091.C1___0	LMB_S454.1091.C1___0	Unknown	
482	6	72	unmapped	0		0	AGACATCTCAGACAGCTTCTCCTCATCTTCCTACCTGGATGGGAGAGGATGGAGACCTAA	450	0	UF_Msa_AF_104576	contig10293___1_nr0nt1	contig10293___1_nr0nt1	Unknown	
483	6	73	unmapped	0		0	AAACCTCCACAAAGTCCCTATTACCCTCAGTATTATCTGCAGATACCTCACTATCCTGCA	452	0	UF_Msa_CF_123912	contig14166___0	contig14166___0	Unknown	
484	6	74	unmapped	0		0	GTTCATTCGGGAGCGTGTTGGATTTTTACAATGTGATCAATTAAAGTGGGATTGAACGTG	454	0	UF_Msa_AF_106846	LMB_S454.sd.12.C1___1_nrnt	LMB_S454.sd.12.C1___1_nrnt	Unknown	
485	6	75	unmapped	0		0	ATCAACCTGCAGCCGAACACGCTGACGGACAAGTGGTACGGCGAGTCACAGAAGCTGGCC	456	0	UF_Msa_AF_107721	contig08745___1rc_nrnt-1	contig08745___1rc_nrnt-1	Unknown	
486	6	76	unmapped	0		0	TACCTGGGATATCCTGCGCTAGGACTGTTGAAGTTCTGTACAGTTGGTTTCTGTGGAATC	458	0	UF_Msa_AF_103884	contig15562___1rc_nrnt	contig15562___1rc_nrnt	Unknown	
487	6	77	unmapped	0		0	CGGATGAATCAAACAATCATCACAAGTTGCTATGCAAATACCCCTCAAACACAATCCTTC	460	0	UF_Msa_CF_118474	contig24406___0	contig24406___0	Unknown	
488	6	78	unmapped	0		0	ATCTAACTCCAGAGGTGGATGATGGGATGCTTTATGAGTTCTTCTACAACCGCTACCCTT	462	0	UF_Msa_AF_107241	contig29054___1rc_nrnt	contig29054___1rc_nrnt	Unknown	
489	6	79	unmapped	0		0	ATCTCTCTCCATTTTAATTCTGTCGTCCGCCACCAGTTGGGTTTTGTTGCAGAACCAGTT	464	0	UF_Msa_AD_200198	AY517845_rc	AY517845_rc	Unknown	
490	6	80	unmapped	0		0	AATGTGAACATCAGGAGTGCTGTCACTGCATTTCTCTCCTCTTGTTTGTTCTGCACTGCT	466	0	UF_Msa_AD_200253	Z22756_rc	Z22756_rc	Unknown	
491	6	81	unmapped	0		0	TTTGCTTAAAGTGCTGCTGTGGCTGGTGCTGCTTGGTCTGTTTGCTGAACTAAGAAGTTT	468	0	UF_Msa_CF_118757	contig18254___0rc	contig18254___0rc	Unknown	
492	6	82		66	Structural	0		1	1	DarkCorner	DarkCorner	DarkCorner		CONTROL
493	7	1	unmapped	0		0	TGTGGTCTCTACACTTGTACAAGCTAAATGAGCATTACATCCTGAACACTCCAAAACGGG	469	0	UF_Msa_CF_117996	contig18136___0	contig18136___0	Unknown	
494	7	2	unmapped	0		0	AACCGTCCTGTCCCTTGAGGAGCCACTGGCAAGGATTGGCGTGTACTTGGACTACAAGAG	471	0	UF_Msa_AF_104374	contig07230___1_nr1nt0	contig07230___1_nr1nt0	Unknown	
495	7	3	unmapped	0		0	CGAACACAACGCAAAAGAGCAAGCCGGGACCACCTTCGGGTTTTGCAATGATACAAACCC	473	0	UF_Msa_CF_125156	contig19749___0rc	contig19749___0rc	Unknown	
496	7	4	unmapped	0		0	ATGTATACGCACACACTGAAAACATGCATCTAAGCTAAATGCTGATGTGATTATTGTGAT	475	0	UF_Msa_CF_119769	contig27443___0	contig27443___0	Unknown	
497	7	5	unmapped	0		0	GGGACCGTCTGAGTTGTCCCTTGCCCCCAATAGTGGACGTCTGGCGAGCTTATAAAGCTC	477	0	UF_Msa_CF_119981	contig16765___0	contig16765___0	Unknown	
498	7	6		1028	E1A	0		479	1	(+)E1A_r60_1	E1A_r60_1	E1A_r60_1		CONTROL
499	7	7	unmapped	0		0	AAGTTCACAGCCAAACCTTTGGTGCAGTCCATTTTTGAAGGTGGTATGGCGACATGTTTC	481	0	UF_Msa_AF_106845	contig21979___1_nrnt	contig21979___1_nrnt	Unknown	
500	7	8	unmapped	0		0	TCTCTCAGATTTGCAATGTGGTCGTCATCAGAGGTCAGAGGATCTCTACTTAATGCTGCA	483	0	UF_Msa_AF_100023	contig00733___1_nr0nt1	contig00733___1_nr0nt1	Unknown	
501	7	9		0		0		485	1	RC5	RC5	RC5		CONTROL
502	7	10	unmapped	0		0	TACTGCAACAAAGTCAATTTGAAGAAGAGACTTGGGAAGGAGGAGAAAACCACTTCACAT	487	0	UF_Msa_CF_127200	contig31044___0rc	contig31044___0rc	Unknown	
503	7	11	unmapped	0		0	ATTAGTGGATGGCAAGGTTCGCCTAGCCAACACTCAGACAAACAAGTCATCAACCATCTA	489	0	UF_Msa_AF_110031	contig26032___1_nrnt0	contig26032___1_nrnt0	Unknown	
504	7	12	unmapped	0		0	TTGGATGAACCACAAAGGAATCAACATCTGCTCCGAACCTTGCAACATGGTGGTAGAATC	491	0	UF_Msa_AF_106576	contig19596___1_nrnt	contig19596___1_nrnt	Unknown	
505	7	13	unmapped	0		0	GCAGCTTAATGCAGAAACAGAGATTACACAGTAAGTAGTGAGCAGTCAGCAGAAAGAAAC	493	0	UF_Msa_CF_118452	contig15933___0	contig15933___0	Unknown	
506	7	14	unmapped	0		0	AAGGTACAGATCAAATGTCTGTGGAACTCAGAAACAGGGGAGTTTGAGAACTGTGCTGGT	495	0	UF_Msa_AF_107421	contig16976___1rc_nr1nt0	contig16976___1rc_nr1nt0	Unknown	
507	7	15	unmapped	0		0	ATCGCTGGCACGCCGGGTCGCCCTCATCGACGAATCTCACAACTCCTATACCAAGTATTT	497	0	UF_Msa_AF_103860	contig13552___1rc_nr1nt0	contig13552___1rc_nr1nt0	Unknown	
508	7	16		0		0		104	1	RC7	RC7	RC7		CONTROL
509	7	17	unmapped	0		0	GGAATACTCAAAGAGCGCTGGCAAAAAGGCTCTGAACCGCAGCCTCAAGCATGTGATGAA	500	0	UF_Msa_CF_125485	contig22239___0	contig22239___0	Unknown	
510	7	18	unmapped	0		0	AATTTGCGCTAACTTCCTTTTGGGATAACTGAAAGTAAATAATTTCAAATCATACGGGGG	502	0	UF_Msa_CF_124247	contig10643___0	contig10643___0	Unknown	
511	7	19	unmapped	0		0	CAGTTTACACTGACATTTTTGGTTAACGTTCTTTCTCAAACAATTAATGGGGGTGGGGTT	504	0	UF_Msa_CF_121967	contig18740___0rc	contig18740___0rc	Unknown	
512	7	20	unmapped	0		0	TTCAGATTGAACCCCGCTTCCAGCAGGCCTTGAAGGACACCACTCTCCCCAAAGGAGCAA	506	0	UF_Msa_AF_105048	contig11726___1rc_nr1nt0	contig11726___1rc_nr1nt0	Unknown	
513	7	21	unmapped	0		0	CACATTTAACTCTGTATTTTGAGATGTATTCAGTTGATGAAATGAAGTCGCTTTGGGGAT	508	0	UF_Msa_AF_102142	contig10778___1_nr0nt1	contig10778___1_nr0nt1	Unknown	
514	7	22	unmapped	0		0	TCACCTTCAACACGATCCCCGCGTGCCATGCATTCACTACGGTGGCTGAGGAGGGACATG	510	0	UF_Msa_CF_123222	contig00792___0rc	contig00792___0rc	Unknown	
515	7	23	unmapped	0		0	GCCAACCCACCTACCCCACCCTGGCCTGCAGCATCCATACCGGCCTGCCTCCACTTTACA	512	0	UF_Msa_AF_100845	contig18370___1_nrnt0	contig18370___1_nrnt0	Unknown	
516	7	24	unmapped	0		0	AAAGGACCACCTCATAGAGCTCTTCAAGTCTGGAGTCAGTAAGAAGGCCTGTAAGTACTT	514	0	UF_Msa_AF_106818	contig11931___1rc_nrnt	contig11931___1rc_nrnt	Unknown	
517	7	25	unmapped	0		0	CCACCACTCCCGCTCTCCTGCCTCTGCTGCCCCTTTGCCCTCAGCCCACCTCCATTCAAG	516	0	UF_Msa_CF_120905	contig16051___0	contig16051___0	Unknown	
518	7	26	unmapped	0		0	GCCCTTTTGTTCACTGACTGCTCTGATAACACCAGTTATTCTGCTAATGTCCCGAATCTA	518	0	UF_Msa_CF_119673	contig21005___0rc	contig21005___0rc	Unknown	
519	7	27	unmapped	0		0	AGCGACTTTGTGCCATCAGTGAACAAAATCACCTTGCCTCTCTTTGTTGTTTTCTTTCCC	520	0	UF_Msa_CF_121416	contig01168___0	contig01168___0	Unknown	
520	7	28	unmapped	0		0	ATGCTTTCAGTACCGGTCAATGGAGAGGAGCGTGTGCCCAGCCCTCTCCCTACTGAAAAG	522	0	UF_Msa_CF_126811	contig03584___0	contig03584___0	Unknown	
521	7	29	unmapped	0		0	AGATTTGGTTTCCGCCGTGGGAAGATGGCTAGAGACCAGCTCCAAGAAGCAGCTTTTGAG	524	0	UF_Msa_AF_106307	contig08739___1rc_nrnt-1	contig08739___1rc_nrnt-1	Unknown	
522	7	30	unmapped	0		0	AGCAGCAGATCTTGCTGGCTACTCAAGTAGTCAAGATGATCCTAAAGATTGACGACATCC	526	0	UF_Msa_AF_106011	contig15424___1_nrnt	contig15424___1_nrnt	Unknown	
523	7	31	unmapped	0		0	TTACTCTCTGTGTTAGATGATCCAGTTCCAAAAAACTATCCCCGCGGCTCCAAACTTAAA	528	0	UF_Msa_CF_126129	contig18948___0	contig18948___0	Unknown	
524	7	32	unmapped	0		0	CTGGACATGCCAGAGGTGCTGTGGAAGTCCTACATTGACTTTGAGATTGAGTAGGAGGAG	529	0	UF_Msa_AF_107002	contig27482___1_nrnt	contig27482___1_nrnt	Unknown	
525	7	33	unmapped	0		0	ACCATCACACAGCGGGGACACGTCCAGAAAACATCGCGGCCAGTAAACGAGGAGAAGTCT	531	0	UF_Msa_AF_108611	contig32263___1rc_nrnt	contig32263___1rc_nrnt	Unknown	
526	7	34	unmapped	0		0	TGAAAACAAATATTCTCAGATTTTGGCCCTGTATAAGCACCACAACCCAGGAGCCTCTGC	533	0	UF_Msa_AD_200352	LMB_Add_10	LMB_Add_10	Unknown	
527	7	35	unmapped	0		0	AAACCGTACGACTGTACCAAGACTCAGGGCTAGCTAGTGAAGACACACATGTACAAACAT	535	0	UF_Msa_CF_118500	contig06554___0rc	contig06554___0rc	Unknown	
528	7	36	unmapped	0		0	CTGTTGCTCTTCTGCGCCCCCTGTGTGTACTGTTTTCCTGATCACTATCAGAGCCGGAGT	537	0	UF_Msa_CF_124939	contig28986___0	contig28986___0	Unknown	
529	7	37	unmapped	0		0	AAGCTCCAACTGGATCATCCAGTCTCATCACGAGAAAGTTTCCTATGTGTCTGGTTCATC	539	0	UF_Msa_AF_104273	contig20621___1_nrnt	contig20621___1_nrnt	Unknown	
530	7	38	unmapped	0		0	ATTGAGCTACTGTAACTTAAGTACGACTCTACCTTGAGCAGAATGACGGTATTGTATGTG	541	0	UF_Msa_AF_108196	contig31600___1_nr0nt1	contig31600___1_nr0nt1	Unknown	
531	7	39	unmapped	0		0	TTTGAGGAGAGGAGGTCGTCCCAGGGTGAGTCCAGCTGGAAAGCTCCAGATGTCAATGAC	543	0	UF_Msa_CF_118892	contig18438___0	contig18438___0	Unknown	
532	7	40	unmapped	0		0	AGTGCGCAGACAAGCCGGGGAAAGCGGCAGCAGCAGCCGCGGCCGCCGCTGCTGATGCGT	545	0	UF_Msa_CF_125261	contig01219___0rc	contig01219___0rc	Unknown	
533	7	41	unmapped	0		0	AAAGCCTTTGAGAAGTTCAGGAAGGAGCACGGCTCAGTGGCGCCCACCATAGACAACGCT	547	0	UF_Msa_CF_126263	contig14076___0	contig14076___0	Unknown	
534	7	42	unmapped	0		0	GTTAAATGCCAGGCCAGCAGAGCTCCTGGAGATGGCAATACGTAACCTGAAAGCTGGGGA	549	0	UF_Msa_AF_103068	contig15405___1_nrnt0	contig15405___1_nrnt0	Unknown	
535	7	43	unmapped	0		0	CGGAGGTGTGTCACCTCTGATAAATATAGCAATTGTAAGTCGCTTCGGAGAAAAGCATCA	551	0	UF_Msa_CF_121112	contig22681___0	contig22681___0	Unknown	
536	7	44	unmapped	0		0	CAAGAACAAGGGCAAGAATCTCATGGGATTATGAATTCAAAACTTCCTGTCATCCCTGAA	553	0	UF_Msa_CF_121856	contig13585___0rc	contig13585___0rc	Unknown	
537	7	45	unmapped	0		0	GTGGGAGCCACTGAAGCTGGAAAAACCACCTGACTGAACATCAGCAGAAGGCAACGAACC	555	0	UF_Msa_CF_123759	contig02247___0rc	contig02247___0rc	Unknown	
538	7	46	unmapped	0		0	TCGTTCTTTGCCTTCCCTGGTGTGTCCAGCCCCAACCTGTTCAAACAGCTGTACCGTAGC	557	0	UF_Msa_AF_109955	contig10062___1rc_nrnt-1	contig10062___1rc_nrnt-1	Unknown	
539	7	47	unmapped	0		0	TATCAAAACACACCAAAGAACAGGAAACCTTTCCTCTCAAAGAGGCAAGAGGTGTCGCAC	559	0	UF_Msa_CF_126948	contig03796___0	contig03796___0	Unknown	
540	7	48	unmapped	0		0	ATAACCTTTCCTCCTGTTGTGGAGAATGAGGCAGTCTATCAACAGCCGGTCATACAGATA	561	0	UF_Msa_AF_107640	contig06471___1_nr0nt	contig06471___1_nr0nt	Unknown	
541	7	49	unmapped	0		0	ACAGGCGACCGGACCTCGCCGTTTCAGCCGCCGGCGACCATCAGTACGGGTTCCACAACA	563	0	UF_Msa_CF_126451	contig21176___0rc	contig21176___0rc	Unknown	
542	7	50	unmapped	0		0	ACAACACTGACCCAGGAGCTGGGCTCTCGTTTCCTTCCTTATAGGCCGCATGATCATGCC	565	0	UF_Msa_AF_109619	contig21000___1rc_nr0nt1	contig21000___1rc_nr0nt1	Unknown	
543	7	51	unmapped	0		0	TTGAAGTGAGTTGTAAAAACTTTACACGCATTAGCCAGCTGGATGGGAGGAAAGGGAGTC	567	0	UF_Msa_CF_123743	contig10317___0	contig10317___0	Unknown	
544	7	52	unmapped	0		0	CACGTTTTAATACGTGTCAAAGGACCTTCCCCACTTTGACACCTGGTTAACCTTCATTTT	569	0	UF_Msa_AF_107556	contig29357___1_nr0nt	contig29357___1_nr0nt	Unknown	
545	7	53		1028	E1A	0		571	1	(+)E1A_r60_a107	E1A_r60_a107	E1A_r60_a107		CONTROL
546	7	54	unmapped	0		0	GTTATGTTCTACCGGCTCCACCACATGACCATTAGCTGAAACTATGTCAGCAACTCTCTT	573	0	UF_Msa_CF_122214	contig14154___0rc	contig14154___0rc	Unknown	
547	7	55	unmapped	0		0	TGTAGAGACATCTGCGAGAGAACAATGGCAGAAGTCTCAAGGACAGGCAGATATAATCCA	575	0	UF_Msa_CF_121535	contig01410___0rc	contig01410___0rc	Unknown	
548	7	56	unmapped	0		0	AAGACAAACTTTAAAACGCTGGCCTGGTTCCGGGTTTTTAGTTGTCTTCCTGTCCTGGTT	577	0	UF_Msa_CF_125108	contig11123___0	contig11123___0	Unknown	
549	7	57	unmapped	0		0	ACTGTTTTATAAGTGTTTCTCGGTTCCTTTCAGCAGAAATGTTCTAACTAGAAGTGGTTA	579	0	UF_Msa_AF_101696	contig10419___1_nr0nt1	contig10419___1_nr0nt1	Unknown	
550	7	58	unmapped	0		0	CTGGCCTCTCTGGAGGGCAAGAAGACAAAGGAGTTGAATGCAGACACCAGAGCGTCAGGA	581	0	UF_Msa_AF_109287	contig03951___1_nrnt	contig03951___1_nrnt	Unknown	
551	7	59	unmapped	0		0	CAGGCAGGAATTGAAACACAACATAACAGGTTAAGACTGAACAGAAATAACTGAACAGGG	583	0	UF_Msa_CF_126983	contig16199___0	contig16199___0	Unknown	
552	7	60	unmapped	0		0	CTCCCATACTATGCTGTACTGTCCACAGTGGCCATTCACCTAACACATCAGATTTACACC	585	0	UF_Msa_CF_118651	contig06537___0rc	contig06537___0rc	Unknown	
553	7	61	unmapped	0		0	ATCCCATTTGCTAGTTGTCCTGGGACATGGACTGAATGAGTGTAGGGTTTGTGTGAAAGA	587	0	UF_Msa_AF_105991	contig29669___1_nrnt	contig29669___1_nrnt	Unknown	
554	7	62	unmapped	0		0	CCCAAGTGTTGACTTCAAACAGACATTTCTGTGAACTTCAAACAATATGAAGGTTTTTAC	589	0	UF_Msa_AF_106799	contig20304___1_nr0nt	contig20304___1_nr0nt	Unknown	
555	7	63	unmapped	0		0	TGATACACATAAGATAATCAGGCAGGAAGTAAGACAAGACAATGACACCAAGGACAGAAC	591	0	UF_Msa_CF_127166	contig32327___0rc	contig32327___0rc	Unknown	
556	7	64	unmapped	0		0	TTCACAATATAAACCAAACCGACGCTGCTTCAGTAACGATGGCGGAAGGGACAACAAAAG	593	0	UF_Msa_AF_103636	contig32156___1_nrnt	contig32156___1_nrnt	Unknown	
557	7	65	unmapped	0		0	GGTAATGTCGGTTAAGAAAACAGTAACACAGATGGTTTATATGTGTCAAACTATAATGGG	595	0	UF_Msa_AF_105399	contig27600___1_nrnt	contig27600___1_nrnt	Unknown	
558	7	66	unmapped	0		0	TAAAAAGATGGCGGCTGCCACAAGGCTCATATCAAGGTTGACTCTGGTCACTGGTGGAGG	596	0	UF_Msa_AF_101844	contig04582___1_nr0nt1	contig04582___1_nr0nt1	Unknown	
559	7	67	unmapped	0		0	TCTGCCTGTCTACTGCCAGATTCTTCCCATCTCTTCTCCTTATGCCAATGCCTCGGAGAG	598	0	UF_Msa_CF_121345	contig27222___0	contig27222___0	Unknown	
560	7	68	unmapped	0		0	ACACCATGTGGTCACGTTTGATTACAGAGGCTGGGGCGACTCAGAGGGCTCTCCATCAGA	600	0	UF_Msa_AF_101241	contig00973___1rc_nrnt	contig00973___1rc_nrnt	Unknown	
561	7	69	unmapped	0		0	GACGTTTTGTTTCCTGTAAATATTCAGCGTTCTCCTGTAAATCAGATGTTTCACTTAGTT	602	0	UF_Msa_AF_110066	LMB_S454.1062.C1___1_nrnt	LMB_S454.1062.C1___1_nrnt	Unknown	
562	7	70	unmapped	0		0	CGACAGCAAAATAAAACTGACCAATCAATTCAAACAATTTCTATGGCAGGTCAACCTTTA	604	0	UF_Msa_AF_102858	contig32652___1_nr0nt	contig32652___1_nr0nt	Unknown	
563	7	71	unmapped	0		0	TCAGCTGATGAGTACAAAATCTTCTTGGAGCAGAGAGAGGAGAAGTTGAAAGCTGATGCA	606	0	UF_Msa_AF_109694	contig19507___1_nrnt	contig19507___1_nrnt	Unknown	
564	7	72	unmapped	0		0	ACAAAACTGTGTTAAAAATGCGTTCATTTTTACCTGCAGTTGCCGAGCAGCTCTTCCGAG	608	0	UF_Msa_CF_121462	contig23982___0	contig23982___0	Unknown	
565	7	73	unmapped	0		0	TCTTAAAGCCATCCATCTCAATGACTCCAAAGGTAAACTAGGCTGCAACCTTGATCGCCA	610	0	UF_Msa_AF_103741	contig22019___1_nrnt	contig22019___1_nrnt	Unknown	
566	7	74	unmapped	0		0	CTCATTTAAGGGCTAACATATTTACAGTGCAGCATTACAGTGGTTACATTTCAAACAGTA	612	0	UF_Msa_AF_103463	contig21836___1_nr0nt	contig21836___1_nr0nt	Unknown	
567	7	75	unmapped	0		0	TGTCAGGTCCCTTGAAGAAATAATTATAGGTCAAATAAAGAATTGAGACAAGGTGGAGGC	614	0	UF_Msa_AF_109001	contig00503___1_nr0nt1	contig00503___1_nr0nt1	Unknown	
568	7	76	unmapped	0		0	ATTGGAGGAGAAAATTACCAGACTACTGGAGATGTTTCCTCAGTTGACGAGGAAGGAGCT	616	0	UF_Msa_AF_107461	contig30640___1_nrnt0	contig30640___1_nrnt0	Unknown	
569	7	77	unmapped	0		0	CGCTGCGTGGACCTTCGGCTCGTCAGAACCGTGTACAAAGAGACGCCGGCGTTGAGTCTA	618	0	UF_Msa_CF_124987	contig18520___0	contig18520___0	Unknown	
570	7	78	unmapped	0		0	TAAACCAGCTGTTTGCTGCTGTAATTCAGTAAGAAGCAACTCGAGTCTGAGGGTCACAGA	619	0	UF_Msa_CF_125257	contig24221___0rc	contig24221___0rc	Unknown	
571	7	79	unmapped	0		0	AACGTTCCTCAGCCTTGTAGTCTTGAACAGTTTACTAAGACAACTGCAGATGGGAGGTCA	621	0	UF_Msa_CF_122595	contig24233___0rc	contig24233___0rc	Unknown	
572	7	80	unmapped	0		0	GAGCAAGAAGTCTTTGTACTTTTACTGCACTTGTGGAAATAAGGTGTTGTGGCCCTTCAT	623	0	UF_Msa_CF_124266	contig18165___0rc	contig18165___0rc	Unknown	
573	7	81	unmapped	0		0	AGGAAAAACTTCCTTTTTAAGAGGCAGAAACCTTCGAAGCAGAACCATAGGCTCAGGGTG	625	0	UF_Msa_CF_120813	contig21220___0rc	contig21220___0rc	Unknown	
574	7	82	unmapped	0		0	TCGTCAATACCATCTACTTCAAGGGTCAGTGGAAGGACAAGTTTGAGAAAGACAACGTGT	627	0	UF_Msa_AF_106392	LMB_S454.sd.378.C1___1_nrnt	LMB_S454.sd.378.C1___1_nrnt	Unknown	
575	8	1	unmapped	0		0	GCCAAGCTGTGGGGAAATTACGACATAGCTTTATCTAAACTTTTTGTTTCAGTATTTTGA	470	0	UF_Msa_CF_122432	contig29752___0	contig29752___0	Unknown	
576	8	2	unmapped	0		0	AATTCTGATTCATATCGGACATCATCTCAATGTCGTCAACCTGCTGGGAGCCTGTACGAA	472	0	UF_Msa_AF_109141	contig16601___1rc_nrnt	contig16601___1rc_nrnt	Unknown	
577	8	3	unmapped	0		0	TGGTCCCAACTTGAATAAATTTATTCTGGGGAACAAATTAAAACCTTGATGTCAACTGTC	474	0	UF_Msa_AF_100602	LMB_S454.sd.56.C1___1_nrnt	LMB_S454.sd.56.C1___1_nrnt	Unknown	
578	8	4	unmapped	0		0	TAGATGTCAACACCTGTCTGATGAAGCCTTACCTGGACACACAGCCTGTTGATGATTTCT	476	0	UF_Msa_CF_124604	contig08586___0rc	contig08586___0rc	Unknown	
579	8	5	unmapped	0		0	GAAAAGGAGACAGTCAAATATTGACCAATAATATTTCTTCCTTTTCATTATTTAGAAAAA	478	0	UF_Msa_AF_101340	contig01827___1_nr0nt1	contig01827___1_nr0nt1	Unknown	
580	8	6	unmapped	0		0	GATGACATTGCTGATAAAGTCCATTACTTGTTTGCAAAGGCTGGCGCAGCTGAATGTAGC	480	0	UF_Msa_AF_102369	contig10283___1rc_nrnt	contig10283___1rc_nrnt	Unknown	
581	8	7	unmapped	0		0	AGCCGGGGTACAGCCGACAGCGGAGATGGATGTGTTATCAAGCTGGGCAGGGGTCGCTCT	482	0	UF_Msa_CF_118715	contig07304___0	contig07304___0	Unknown	
582	8	8	unmapped	0		0	GGGCACATATTACAACAGTATTAGATGGGGCGACAAACTCAATAGCTGTAATTTTAATAA	484	0	UF_Msa_AF_100171	contig32065___1_nr1nt0	contig32065___1_nr1nt0	Unknown	
583	8	9	unmapped	0		0	AAACAACTTCACCATTGGAAAGGAGGCAGAGCTGGAGACTATTACTGGAGAGAAGGTCAA	486	0	UF_Msa_AF_103131	LMB_S454.sd.271.C1___1_nrnt	LMB_S454.sd.271.C1___1_nrnt	Unknown	
584	8	10	unmapped	0		0	TCAACCTAGTGGGAAGAGAGTGGGAGACATGGAACTATCGCTTTGAGGATGTTTTTGTGA	488	0	UF_Msa_AF_108207	contig07050___1_nrnt	contig07050___1_nrnt	Unknown	
585	8	11		0		0		490	1	RC12	RC12	RC12		CONTROL
586	8	12	unmapped	0		0	AGGTGCTTTCTAATGCGTTTCACTCTCCACGGTGGGGTGGAATTATGGTCTATAATATTA	492	0	UF_Msa_AF_109333	contig08813___1rc_nrnt0	contig08813___1rc_nrnt0	Unknown	
587	8	13	unmapped	0		0	ATTTCTGGCATTGCTCCGTGAAACAGAGGGAAATAGCTGGTTTCACAATAGCAGCTCAGT	494	0	UF_Msa_CF_127152	contig08860___0	contig08860___0	Unknown	
588	8	14	unmapped	0		0	CGGGTGGAATGCCAGAGCCACAGACTAACTGTTGAGGATCCAGTCACAGTGGAATACATC	496	0	UF_Msa_AF_107586	contig27684___1rc_nrnt	contig27684___1rc_nrnt	Unknown	
589	8	15	unmapped	0		0	ATGCTCTCCCACATTAACACCGCACTACTGCATCCACTGCCTGAGCTGACGGTGGATAAC	498	0	UF_Msa_CF_122478	contig21735___0rc	contig21735___0rc	Unknown	
590	8	16	unmapped	0		0	ATGAAAGTAGAGTTTGATCAAAAAGCCCAGTTAGCTGCACTCGACTCCTCCTGTATGCCT	499	0	UF_Msa_CF_119032	LMB_S454.996.C1___0rc	LMB_S454.996.C1___0rc	Unknown	
591	8	17	unmapped	0		0	GGAGCCTGCCCAGTACTACACCCTGTTCGGTCGCAGCTACTAAAAACCTGCTCTTCTGGA	501	0	UF_Msa_AF_103422	contig07662___1rc_nrnt	contig07662___1rc_nrnt	Unknown	
592	8	18	unmapped	0		0	TGAATTTCCCCCAGTTGCATTCACCACCGGCGCGGGCTGTGTGGCGCTACAATGCGCATG	503	0	UF_Msa_CF_126178	contig07628___0rc	contig07628___0rc	Unknown	
593	8	19	unmapped	0		0	TGACTGACCAGGTCTACGAGGTGGCGACAGATCTTCATCCGAGTCCTTTCCACTCTGTGG	505	0	UF_Msa_CF_119106	contig00944___0rc	contig00944___0rc	Unknown	
594	8	20	unmapped	0		0	AGTTCCTGCTGTCTATCTTCTTCATCCAGGTCAATGATGATTGGCCCGCGGCCTTCTTCC	507	0	UF_Msa_CF_126404	contig22304___0rc	contig22304___0rc	Unknown	
595	8	21	unmapped	0		0	CCGTGGTCTCCATACGCTTCCAGGAGGACATCTTGTCCATCTGGAACAGAACATCTAACG	509	0	UF_Msa_AF_105722	contig32274___1_nrnt	contig32274___1_nrnt	Unknown	
596	8	22	unmapped	0		0	AGACAAGATGCCAGTGTTCTGCTTTCAAGTTGTTTCTGTTCTCCTGGCCTGTAATAATGT	511	0	UF_Msa_AD_200105	LMB_Add_123	LMB_Add_123	Unknown	
597	8	23	unmapped	0		0	CCAGACCAGTGCTGTGAGCCGGGACATCGACAACTAAGCTGCAAAGTTCATTGGAGCAGG	513	0	UF_Msa_AF_103533	contig22226___1rc_nr0nt	contig22226___1rc_nr0nt	Unknown	
598	8	24	unmapped	0		0	TCTGCAATGGCGTGTTCCCTGGGCATGGATCCCAACTTGGCGGGTAAGAAGATTCTCCTG	515	0	UF_Msa_AF_101141	contig09506___1_nrnt	contig09506___1_nrnt	Unknown	
599	8	25	unmapped	0		0	GAGGAGGATCACAGAGATACATCCAAGCTCTTCGATAACAGTATTACCAAACCTTCACAG	517	0	UF_Msa_CF_119246	contig00074___0rc	contig00074___0rc	Unknown	
600	8	26	unmapped	0		0	TGTGGTTTTACCTGCTGCTGGGCCAGATTTTTCTTCCTCAGGGATTAAACTGTGCATCTT	519	0	UF_Msa_CF_126551	contig20101___0	contig20101___0	Unknown	
601	8	27	unmapped	0		0	CCCAGATCAGCCAGTATGTCCCAAATGGGTGGCAGCATTGAGAAGCCAGGGGCCTTTGTG	521	0	UF_Msa_CF_118656	contig18565___0	contig18565___0	Unknown	
602	8	28	unmapped	0		0	TAAATCTTCTTCTGTTATTTTCAACATAAAAAGGGGAGCCATGGCCCTGGGCCGCAGTGA	523	0	UF_Msa_CF_126610	contig29055___0rc	contig29055___0rc	Unknown	
603	8	29	unmapped	0		0	CAGCGCTCGTCCACACTCGCGTGATTCAGACATGTCGGCCTTTAATAAACTGGTCAGCAG	525	0	UF_Msa_AF_102021	contig24995___1_nrnt	contig24995___1_nrnt	Unknown	
604	8	30	unmapped	0		0	GGAGACGAGGAGAGAGGGACGAGAAGGGGGCTGGGAGGGACCGGAGCGCAGAATTCACAG	527	0	UF_Msa_CF_117939	contig14397___0	contig14397___0	Unknown	
605	8	31		0		0		428	1	RC6	RC6	RC6		CONTROL
606	8	32	unmapped	0		0	GTCCATCTAATCTATGGAGGAGCAAATCAACAACTATATGGAACAATTAAAACTTCGTAC	530	0	UF_Msa_AD_200234	DQ786407	DQ786407	Unknown	
607	8	33	unmapped	0		0	ACAGCCCTACTCTATTGGCTTAAAACTTTGCTTCCCAGGAATGTGGTTTGACAGGAAGCT	532	0	UF_Msa_CF_123925	contig18484___0	contig18484___0	Unknown	
608	8	34	unmapped	0		0	AAATCAGAAAAAAGGGTCACGGACACCTATCGTCATCATCCCCGCTGCCACCACATCACT	534	0	UF_Msa_AF_104990	contig16245___1_nr0nt	contig16245___1_nr0nt	Unknown	
609	8	35	unmapped	0		0	ACAGCCGATGGACAGGAGTGCGAAGATTTGGACGCCATTGGCGACACCGTTTACAGCAAG	536	0	UF_Msa_CF_117707	contig08046___0	contig08046___0	Unknown	
610	8	36	unmapped	0		0	TGACCAAATGCTGGGACCTTTTTAATGGGAAGAAGATAATTCTGTCATGCATGTCTCTGG	538	0	UF_Msa_AF_101374	LMB_S454.sd.122.C1___1rc_nr0nt1	LMB_S454.sd.122.C1___1rc_nr0nt1	Unknown	
611	8	37	unmapped	0		0	ATGAGACAGCGACAGAGAGAAAAACAACATGTGGCTGTGATAAACAGTCAAGAGTCATGG	540	0	UF_Msa_CF_125460	contig12043___0rc	contig12043___0rc	Unknown	
612	8	38	unmapped	0		0	ATTACTACTTATACAAACGCACAGCAGAGTTTATGGGAGACCCGAGGCTGTATGAGGACT	542	0	UF_Msa_AF_103013	contig31308___1_nrnt	contig31308___1_nrnt	Unknown	
613	8	39	unmapped	0		0	AAGATTATCAAGTATCAAGGGTATGATATAGTCAGCGGGGCACAAACCGGGAAGCTGGAA	544	0	UF_Msa_CF_127236	contig28253___0	contig28253___0	Unknown	
614	8	40	unmapped	0		0	TGAAGGTGGTCTCGGGAAACACTGAAGGAACTTAGGCAAGATGAGGGACGCGGCTCTCCT	546	0	UF_Msa_CF_126898	contig16842___0	contig16842___0	Unknown	
615	8	41	unmapped	0		0	GGTAAAGACTCGTTTATCAGCGCAGCATCTGGATTGGTTCACGCCTACTTATGATGTCAT	548	0	UF_Msa_CF_118898	contig18728___0	contig18728___0	Unknown	
616	8	42	unmapped	0		0	AAACCCTTCAGACCAAACTGCACGACGTTTTTTCATATTGAAAGGACCCAGTGAGTCCAG	550	0	UF_Msa_CF_118181	contig11855___0	contig11855___0	Unknown	
617	8	43	unmapped	0		0	ACTGTGGTTTTGAGCATCCCTCAGAAGTCCAACATGAGTGTATTCCCCAAGCAATCCTTA	552	0	UF_Msa_AF_106854	contig30232___1_nrnt	contig30232___1_nrnt	Unknown	
618	8	44	unmapped	0		0	TTTGGAAAGTCTGGCTCTGCATGCCTTAACATCTCAAGTGTTTTTGAAAAAGGGAAAAAG	554	0	UF_Msa_AF_102918	contig07972___1_nr0nt	contig07972___1_nr0nt	Unknown	
619	8	45	unmapped	0		0	TTGAGGACTTCAGTAGTTTGGATCCACACTGTTCCCAAACTCTGAATCTGAGCTGAAGCA	556	0	UF_Msa_AF_102600	contig15866___1rc_nrnt0	contig15866___1rc_nrnt0	Unknown	
620	8	46	unmapped	0		0	TAACGTGTGCCTTACAAAGGATGAGTCGAAGAGGCCAAAGTACAAGGAGCTACTGAAAGA	558	0	UF_Msa_AF_103010	LMB_S454.sd.213.C1___1rc_nrnt	LMB_S454.sd.213.C1___1rc_nrnt	Unknown	
621	8	47	unmapped	0		0	AGGTATGAACAAACATGAATTGCTCGACGATGAGGCAAAGAGGATCGAAGACTTGAGGAT	560	0	UF_Msa_CF_127615	contig19435___0rc	contig19435___0rc	Unknown	
622	8	48	unmapped	0		0	TTTTGGGGGAGCGACAGAAGAAGACTGAGGATCAGTTGCATGTGAAGAGGAGATCAGAGA	562	0	UF_Msa_CF_120584	contig10805___0	contig10805___0	Unknown	
623	8	49	unmapped	0		0	AGAAATACTCTGACATCTCTGGACTCCCTGCAAACTACACAGACCCCCAGACAAAGCTAC	564	0	UF_Msa_AF_107499	contig20183___1rc_nrnt	contig20183___1rc_nrnt	Unknown	
624	8	50	unmapped	0		0	TAAAGACCGGCATGGTTGCAAAGAAGCAGAAACACGACACAGAGGCTGAACCAGGCAAGA	566	0	UF_Msa_CF_127417	contig10011___0	contig10011___0	Unknown	
625	8	51	unmapped	0		0	AGTGAACAAGTCAGAGCGTGGAGGTTCTATCATGGAGAACTTCAGGAAGAAAGGATCTCT	568	0	UF_Msa_AF_108582	contig28379___1_nrnt	contig28379___1_nrnt	Unknown	
626	8	52	unmapped	0		0	CAGAGATAAATTTGATTGTGGCGACGACGTCATATTGGAAGATGAGGAAGTAGACTCAGT	570	0	UF_Msa_CF_127432	contig11865___0	contig11865___0	Unknown	
627	8	53	unmapped	0		0	GATCAACAGAATGATCAGGAGGATGAACTGAAGTTATGGTTTTCAAAGGACACAAAATGT	572	0	UF_Msa_AD_200220	LMB_Add_34_rc	LMB_Add_34_rc	Unknown	
628	8	54	unmapped	0		0	TATCAAACAGGAAGAGGAAATATCTGAGCAAGCAGACCAAAACAAGCCCAGGGATGTGGA	574	0	UF_Msa_AF_101420	contig32685___1_nr1nt0	contig32685___1_nr1nt0	Unknown	
629	8	55	unmapped	0		0	TGAGAATGTCTGGCATGTGCTGGAAGTGGAGCCTAATTCCCCAGCAGCCCTCGCAGGTTT	576	0	UF_Msa_AF_105691	contig10301___1rc_nrnt	contig10301___1rc_nrnt	Unknown	
630	8	56		130	HybridizationNegative	0		578	1	(+)eQC-40	EQC	EQC		CONTROL
631	8	57	unmapped	0		0	ATTTGTTACCAAGACCTACCAATCACAACAAAATTTGGTGGCTTCTATGTAAATTCAGGC	580	0	UF_Msa_AF_101124	contig29599___1_nrnt	contig29599___1_nrnt	Unknown	
632	8	58	unmapped	0		0	TTCCCCCTGAGTCTAGGCTTGGGCAGGAGGTGGAGGATGGAGGTAGGGAGGTGATGGCAA	582	0	UF_Msa_AF_108691	contig20997___1rc_nrnt0	contig20997___1rc_nrnt0	Unknown	
633	8	59	unmapped	0		0	CTGTTAAAGGAAAATCCTCGTCTGATCTACGCTCGGTTGACGGGCTACGGACAGAGCGAA	584	0	UF_Msa_AF_109252	contig19697___1_nr1nt0	contig19697___1_nr1nt0	Unknown	
634	8	60	unmapped	0		0	TACTTCTTCACCATCGAGTTCGGACTCTGCAAACAGGACGGCCAGCTGAGAGCCTACGGA	586	0	UF_Msa_AF_106808	contig21833___1_nrnt	contig21833___1_nrnt	Unknown	
635	8	61	unmapped	0		0	TTTATCTGCAGTGTACTGTTCGTGGCGTGGAGCATGTCGGCGGTGCTGACCAAGAACAGG	588	0	UF_Msa_AF_110033	contig02206___1rc_nr0nt	contig02206___1rc_nr0nt	Unknown	
636	8	62	unmapped	0		0	AGGCCATCTCCAGCCTGGCTCAGAAGAACAGCACAGAATTATCAAAGGATGGACATTAGA	590	0	UF_Msa_AF_101557	contig02223___1_nr0nt1	contig02223___1_nr0nt1	Unknown	
637	8	63	unmapped	0		0	TGTAGATATTGGTGAGGAGCTGATACGGCTGGGCCATGCTGTCAGCTTCCAGGAGGTGGT	592	0	UF_Msa_CF_122191	contig15537___0	contig15537___0	Unknown	
638	8	64	unmapped	0		0	TGCAAACAAGCTCGCCAGACACATGAGGACGCACACAAAGGAGAAACCGTTCAGCTGCCC	594	0	UF_Msa_CF_123074	contig08971___0	contig08971___0	Unknown	
639	8	65		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
640	8	66	unmapped	0		0	TGTTCTACTTCGAGAACGAGCAGAGCGCGCGACCTGCCGGGATTTACCTGTTGGAAGGAT	597	0	UF_Msa_AF_104119	contig16050___1_nr1nt0	contig16050___1_nr1nt0	Unknown	
641	8	67	unmapped	0		0	TGCATCGGGTCGCCGCCATGGTGAACGTCCCGAAGACCCGCAGGACATACTGCAAGAAGT	599	0	UF_Msa_AF_109671	contig10239___1_nr0nt1	contig10239___1_nr0nt1	Unknown	
642	8	68	unmapped	0		0	AAGCTGCTGGGCAGAACTTCCTGGATCTCATGATGAACATGTTCCGTGAGCTGGGAATGC	601	0	UF_Msa_CF_127698	contig24400___0rc	contig24400___0rc	Unknown	
643	8	69	unmapped	0		0	AGCAAAAGAAATTTGATTATGACATTGTGAAGTCCCTGGTTTTGAGCCCCTACAATGGTT	603	0	UF_Msa_CF_127427	contig27329___0	contig27329___0	Unknown	
644	8	70	unmapped	0		0	CAGCGTACGCCCCATCAATGAAAAGGCCCATTGAGGAAGAGGAGGGAATTGATGACAAGA	605	0	UF_Msa_CF_118543	LMB_S454.84.C1___0	LMB_S454.84.C1___0	Unknown	
645	8	71	unmapped	0		0	GGTATGGGTGTATGGGTAGTATGCTTACATGTCCCAGGCGGCAAGCAAAAATAGCTTAAT	607	0	UF_Msa_CF_125740	LMB_S454.sd.20.C1___0	LMB_S454.sd.20.C1___0	Unknown	
646	8	72	unmapped	0		0	TGAAGATGATTGAGAAGGATCCCAATGGTGGTCGCAAACTAACCGCCCAGGGAACCAGAG	609	0	UF_Msa_AF_106683	contig29835___1_nrnt	contig29835___1_nrnt	Unknown	
647	8	73	unmapped	0		0	ACAGTGTGGAAATAATGTCGTGCAGCAACAGAGAGCTGGTGGAGTTCTTTATAAGCTACC	611	0	UF_Msa_CF_127812	contig06901___0rc	contig06901___0rc	Unknown	
648	8	74	unmapped	0		0	AAAGCTCAACTCACGGCGAGGTGGAGGGGCAGACTGCTGGGACGTCTGCCCAGACAAACA	613	0	UF_Msa_AF_102912	contig19450___1rc_nrnt0	contig19450___1rc_nrnt0	Unknown	
649	8	75	unmapped	0		0	TTCCTTTAAAACCAAAACTGAACCGGAGTTTGCTGTTAAAGATGAGAGAACAAAGAAGGA	615	0	UF_Msa_AF_109271	contig29067___1_nrnt0	contig29067___1_nrnt0	Unknown	
650	8	76	unmapped	0		0	GACCTGGGGAAGAGCTGGACTGCTTGACATACACAAAGAAGAATAATATCTGTTCTGACA	617	0	UF_Msa_AF_107615	contig10664___1rc_nrnt	contig10664___1rc_nrnt	Unknown	
651	8	77		1028	E1A	0		418	1	(+)E1A_r60_a135	E1A_r60_a135	E1A_r60_a135		CONTROL
652	8	78	unmapped	0		0	TTGTGTAGAAGAGACCCTTCGCTTGGTGAAGGCGTTCCAGTTTGTGGAGACCCACGGCGA	620	0	UF_Msa_AF_106672	contig06223___1_nrnt	contig06223___1_nrnt	Unknown	
653	8	79	unmapped	0		0	GGAACAGGTGCGTCTAATGATGAAAGCCCACTCCTTTGTCAGGGAGAATGTACCAAGAGT	622	0	UF_Msa_AF_101323	contig07640___1rc_nrnt0	contig07640___1rc_nrnt0	Unknown	
654	8	80	unmapped	0		0	GAAGATGATGATGATGATTTCTGGTGAGCTGGTTGTCCCAAAGTGCTATCATAAACTGAA	624	0	UF_Msa_CF_118340	contig03446___0	contig03446___0	Unknown	
655	8	81	unmapped	0		0	ATTTCTCGCCCCACTAAACATCATCAGCAGAGGCCTGGTTCTGATCCTCTTCCATCTGGC	626	0	UF_Msa_CF_125559	contig00231___0rc	contig00231___0rc	Unknown	
656	8	82	unmapped	0		0	GAATTAAGAAACTCTTCGGGAAGAAACTAAAAAAGGAGTCAGTCTACCACATTTAACCTG	628	0	UF_Msa_CF_120994	contig02779___0	contig02779___0	Unknown	
657	9	1	unmapped	0		0	TCTTAGATGAGAGTCTCTATGAAGTTAAAGGTGATGTGGTGAATGGGCCAAACCACCAGG	629	0	UF_Msa_AF_105504	contig23447___1_nrnt0	contig23447___1_nrnt0	Unknown	
658	9	2	unmapped	0		0	ATGCTCTTTGACGAAATAAGTAGTTGCATCTTTTCCACCGTACAGCGCTTTGTCAAGGCT	631	0	UF_Msa_AD_200016	AF080250_rc	AF080250_rc	Unknown	
659	9	3	unmapped	0		0	ATTAAACCCTGGTTCTGCCTGGATCTGAAAGCTATTTGAAGCTATAATCAGCTAAAGACC	633	0	UF_Msa_CF_124155	contig06058___0rc	contig06058___0rc	Unknown	
660	9	4	unmapped	0		0	GGTACTATCAGCACTAAGCCAGGCTGTGTGCCTGACTCCCCCTGGACAAGGATTCCCCCC	635	0	UF_Msa_CF_124336	contig02347___0	contig02347___0	Unknown	
661	9	5	unmapped	0		0	CCACTATCAAAAAAGATGCTGAGCTTCTGGTGGCCCCTGGCCCTCATCCTGGCTACTCAG	637	0	UF_Msa_AF_104935	contig08094___1rc_nrnt	contig08094___1rc_nrnt	Unknown	
662	9	6	unmapped	0		0	TAGGAAACCGGTTTGGAGTATTTCTGTTCTCCTTTCTGTGTGTTTTGGGCTCGTCTGAGA	639	0	UF_Msa_AF_109699	contig02240___1_nrnt	contig02240___1_nrnt	Unknown	
663	9	7	unmapped	0		0	CAGATACATCATTAAAATGAACAGCGTGGGTGTTGTCGGCTGCTGTTTCCGCCTGCCACC	641	0	UF_Msa_CF_120985	contig18280___0rc	contig18280___0rc	Unknown	
664	9	8		1028	E1A	0		643	1	(+)E1A_r60_a22	E1A_r60_a22	E1A_r60_a22		CONTROL
665	9	9	unmapped	0		0	ACTCTGCGTCCCCTGAGAGCTTTGGTAGCTCAGCGAATTTATTGGCTGTAGGTTTCGAAA	645	0	UF_Msa_CF_118969	contig09971___0	contig09971___0	Unknown	
666	9	10	unmapped	0		0	ATTTACTACTAGAGGCGCTGCTTCATCATCACCGCTGCTCCAAAAACTGCTTAATATTCC	647	0	UF_Msa_CF_124194	GP3-18D___0	GP3-18D___0	Unknown	
667	9	11	unmapped	0		0	AGTGAAGTCGTTGCTGCATTTAGCTGCTCGAACGCTCGCTCACCTCGACATCCCCTTCTG	649	0	UF_Msa_AF_102128	contig04545___1_nr0nt	contig04545___1_nr0nt	Unknown	
668	9	12	unmapped	0		0	AGTTCACCAAGTGTGTCTATTCCTGTGCATGTCGACACAGAACCTGAAGAGGTTGAAGAA	651	0	UF_Msa_CF_117705	contig18019___0	contig18019___0	Unknown	
669	9	13	unmapped	0		0	ACTCTGCTGACTGAAGAGGAAATACTGTCATCATGCCTACTGATGAAAATAGATGTCACT	653	0	UF_Msa_AF_100570	contig02304___1_nrnt	contig02304___1_nrnt	Unknown	
670	9	14	unmapped	0		0	CCTCCAGAAGATGGACCATAAAATACAAAAAGCAGAGTAGGAAAACTTTTACATTATCTG	655	0	UF_Msa_CF_121606	contig17561___0	contig17561___0	Unknown	
671	9	15	unmapped	0		0	AATGGAGTCAGCTGGCATCCACGAGACGACCTACAACAGCATCATGAAGTGCGACGTGGA	657	0	UF_Msa_AF_105236	contig19900___1_nr0nt1	contig19900___1_nr0nt1	Unknown	
672	9	16	unmapped	0		0	ACAAGAAGGACGGTGCAGACTTCGCCAAGTGGCGCAGTGTGCTGAAGATCAGTGACACCA	659	0	UF_Msa_AF_107162	contig08749___1rc_nrnt	contig08749___1rc_nrnt	Unknown	
673	9	17	unmapped	0		0	AAAGATTCAGTTACAGGTCTTTCTATTCCTCTCGTGACCCTCCAACAGTGACTGAGCTTG	661	0	UF_Msa_CF_124900	contig07671___0	contig07671___0	Unknown	
674	9	18	unmapped	0		0	GCGAGGCATTGATAAATGCTTTCAAGAGGCTGGACAGTGACATTTCCCTGGAGGCTCAGG	663	0	UF_Msa_AF_108332	contig18445___1_nr0nt	contig18445___1_nr0nt	Unknown	
675	9	19	unmapped	0		0	TCAGGCTTTACTGCCCACACAACTCTACCTCAGTTCTCCTGTACTCGCTGTGATGCTACA	665	0	UF_Msa_CF_124192	contig10910___0rc	contig10910___0rc	Unknown	
676	9	20	unmapped	0		0	ATTGCTGTGTTTGTCCCGTTCCCCTCCAGAGAAAGACACCCTTGGTAGCGCAAGACCCTT	667	0	UF_Msa_CF_124065	contig14213___0rc	contig14213___0rc	Unknown	
677	9	21		0		0		669	1	ETG10_13482	ETG10_13482	ETG10_13482		CONTROL
678	9	22	unmapped	0		0	TCATCACTTCTATGCAGCTGTCCTCTCTAACTCCCTCTGTCTGGAAATGTGTAAAGCCAA	671	0	UF_Msa_CF_118228	contig12484___0rc	contig12484___0rc	Unknown	
679	9	23	unmapped	0		0	TATACATGACTAACGGAGAGAGAGGAAAGCCCATCTTCAGGGAGGACAGTACATATGCAT	673	0	UF_Msa_CF_127474	contig26273___0	contig26273___0	Unknown	
680	9	24	unmapped	0		0	AACTGTCATCGTGTGCATCGAGTGCCATCAGTTTCAACCAAAAAACTTCTGGAATGGACG	675	0	UF_Msa_AF_104028	contig05342___1rc_nrnt	contig05342___1rc_nrnt	Unknown	
681	9	25	unmapped	0		0	AGAACGAGATCAGAATGATGTTCTCCTCTTTCGGACAGATTGAAGAGTGCCGAATTCTCC	677	0	UF_Msa_AF_102725	contig15051___1rc_nrnt0	contig15051___1rc_nrnt0	Unknown	
682	9	26	unmapped	0		0	AGTGTGCATAACCCTCCAATAATACAGAATAAATTGTATGATGTAAATAAATTATGTCAC	679	0	UF_Msa_AF_103501	contig32305___1rc_nr0nt	contig32305___1rc_nr0nt	Unknown	
683	9	27	unmapped	0		0	TGAAGAGCTCCTCATTAGCTACATGGTAAATAGAAAATACTAAGTAGTACACAATGGTGA	681	0	UF_Msa_CF_124709	contig03258___0	contig03258___0	Unknown	
684	9	28	unmapped	0		0	TGGGTAGCCAAAGGACCATACCTGCTGGGGGTACGTGCGGTCATCGCTGAGGGCTTTGAG	683	0	UF_Msa_AF_106490	contig10104___1_nr1nt0	contig10104___1_nr1nt0	Unknown	
685	9	29	unmapped	0		0	TGAGGAAACACTGAAGCCACAGCCGCGTCTGCGGTGCTGCAGCTACTTCCGTGTTTACTA	685	0	UF_Msa_CF_126756	contig19850___0rc	contig19850___0rc	Unknown	
686	9	30	unmapped	0		0	GAAAAATACAAAAACAAATATAATCTGCAGGGGAGGAAAAGAAACTAACCAGGATTCCCT	687	0	UF_Msa_AF_100711	contig08579___1_nr0nt	contig08579___1_nr0nt	Unknown	
687	9	31	unmapped	0		0	AACAATACCTTCGCCATGCTGCCGTGAGGTGTTCCAGCCCTGCTAACCCATGTTTCTCAC	689	0	UF_Msa_CF_127397	contig16289___0rc	contig16289___0rc	Unknown	
688	9	32	unmapped	0		0	AGATCACAGGCAGCTAGCGGCAGCCAGCTGCCTCCTTCCATGCAAGCACAATTTAACGAC	691	0	UF_Msa_CF_127558	contig21807___0rc	contig21807___0rc	Unknown	
689	9	33	unmapped	0		0	TTTCAACACGAGACCGAAGTTGCGTGTCAACACTTTCATCTCTGAGATGGTTGCTCAGTT	693	0	UF_Msa_AF_109306	LMB_S454.sd.441.C1___1_nrnt	LMB_S454.sd.441.C1___1_nrnt	Unknown	
690	9	34	unmapped	0		0	CGCCATTGCACCACAGTTACAAGGTTACCCACCAGAATCCTAAATGGATCCTCACTTATC	695	0	UF_Msa_CF_122627	contig07276___0rc	contig07276___0rc	Unknown	
691	9	35	unmapped	0		0	ATAAACAGAACAGCTCAGGGTGCTCTGACTGTCCCAGACTGATGTTATGTAACAGAGGAT	697	0	UF_Msa_CF_122446	contig16386___0rc	contig16386___0rc	Unknown	
692	9	36	unmapped	0		0	AGACAATTTGTGACTGCGAGCCCCCATTAGTGACTCGGGAGGGCGGCGGACTGGTCTGGT	699	0	UF_Msa_CF_126873	contig24093___0	contig24093___0	Unknown	
693	9	37	unmapped	0		0	GACATGTGTCTGTAGAGTCGTGTATCAGTCAGATTCTTCAACTTATTTAACTACCTATTA	701	0	UF_Msa_AF_108487	LMB_S454.sd.222.C1___1_nrnt	LMB_S454.sd.222.C1___1_nrnt	Unknown	
694	9	38	unmapped	0		0	TGCATCAGCACTCATGGACAGTTCTCACCTGTACTAGTTCCTCCTGTGTCCCCTCGCGTT	703	0	UF_Msa_CF_122406	contig21774___0	contig21774___0	Unknown	
695	9	39	unmapped	0		0	TTTATGGCATTCGTTGCCACTCGTTTCACAAATTTGGCATCACTGAGTCAGACTGGTACC	705	0	UF_Msa_AF_106996	contig20214___1rc_nrnt	contig20214___1rc_nrnt	Unknown	
696	9	40	unmapped	0		0	ATGGATGGGGGAGGGACGAACACTGACTCCTGGTTTTGATAGGTCTGGGGCAGAGTCTGA	707	0	UF_Msa_CF_124124	contig05754___0	contig05754___0	Unknown	
697	9	41	unmapped	0		0	TTGTCTAAAATGCAGCGGCTGCTTCTGTGCTGTGGGGAAAGTTATTCACTCAGCCCCGTC	709	0	UF_Msa_CF_126702	contig28512___0rc	contig28512___0rc	Unknown	
698	9	42	unmapped	0		0	TCGCAGTCAGAGGTACAGCAGATGTTCACAAGACACAGGAATACATTTGTAATATGCGGT	711	0	UF_Msa_CF_124356	contig22990___0rc	contig22990___0rc	Unknown	
699	9	43	unmapped	0		0	TAACAGTACCTGCTACACACCCCATGGGGAAACTGCAGGATCTCAAAGAGGAGGCGGAGG	713	0	UF_Msa_AF_106408	contig20104___1rc_nrnt-1	contig20104___1rc_nrnt-1	Unknown	
700	9	44	unmapped	0		0	AATAATACCCCTCAGGAACAAAAAGATTTTCCAGAGAAGACTTAACTCCGGAAAACTAAG	715	0	UF_Msa_CF_124697	contig18095___0	contig18095___0	Unknown	
701	9	45	unmapped	0		0	CAACCATGGCTAGTAGGAGATGTGTGGAGCGTGCTGGAGGAGTGTGTGAAGAAAATAAAT	717	0	UF_Msa_CF_120156	contig12327___0	contig12327___0	Unknown	
702	9	46	unmapped	0		0	AACAACAGCAAGGAGTTCGCTCTGCCGCCGCAGCCCGAGCAGCGGTGGCGGCACCGGCGG	719	0	UF_Msa_CF_127508	contig00289___0	contig00289___0	Unknown	
703	9	47	unmapped	0		0	ACTACGTGATGAGGTGGAACCCATCCAGGACCCACAAGATGACGATGAGGAGGAGCAGCT	721	0	UF_Msa_CF_121095	contig07489___0	contig07489___0	Unknown	
704	9	48	unmapped	0		0	TAGTCGGGCGGAGGACCTCAACACCCGCGTTGCGTTCTGGCCATTGGAGAGCTATTATCC	723	0	UF_Msa_AF_102634	contig08043___1rc_nrnt0	contig08043___1rc_nrnt0	Unknown	
705	9	49	unmapped	0		0	TGTGGCTCTATATTTGACAGCGATCTCCTCCATTGTCCATGTGTAACATCAACAGCAGCC	725	0	UF_Msa_CF_121376	contig28071___0rc	contig28071___0rc	Unknown	
706	9	50	unmapped	0		0	AATCGAACAATGGATCCCTCGCGACTGCTCCAAGAGTGGAACCTGCAAGTGCGGAGCATC	727	0	UF_Msa_AF_110088	contig28874___1rc_nr0nt1	contig28874___1rc_nr0nt1	Unknown	
707	9	51	unmapped	0		0	GTGCAGCACATTACTCCAGACCCAAAGTCACCAAAGAGTCAAAGACCTATTTCATCCATT	729	0	UF_Msa_CF_118042	contig05124___0rc	contig05124___0rc	Unknown	
708	9	52	unmapped	0		0	ACACTGTACCTGGGAGTGGAGACAGACAGATTGGAATACTGATAGACATTGTGCCTTGAA	731	0	UF_Msa_CF_117716	contig30707___0	contig30707___0	Unknown	
709	9	53	unmapped	0		0	ATGAACCTGCACCAAGTCTCTCACACAGTGGTCCTGGTGGACGACATGGGAGGCACAGAT	733	0	UF_Msa_AF_108845	contig32163___1rc_nrnt	contig32163___1rc_nrnt	Unknown	
710	9	54		0		0		735	1	ETG05_36762	ETG05_36762	ETG05_36762		CONTROL
711	9	55	unmapped	0		0	TGAGTCCCACCTTCGCCCCAGACCTAATCACCTGCTGTGCATTCCTGCATAATTTGTGCA	737	0	UF_Msa_CF_118138	contig17329___0	contig17329___0	Unknown	
712	9	56	unmapped	0		0	TTAATAAGCCAATCAGGGATCAAGAGGAGGAGACCGGGTTACCAGCAGAAAGTAATATGG	739	0	UF_Msa_CF_123277	contig05771___0	contig05771___0	Unknown	
713	9	57	unmapped	0		0	ATTTGATGGCTGTTTCCATGACAACGACATTGACCTGGCTTCTTTTCCAGAAGGTCTCCA	741	0	UF_Msa_AF_108280	contig18512___1_nrnt	contig18512___1_nrnt	Unknown	
714	9	58	unmapped	0		0	TGGTAGAGGTGAGACCCACAGCTGACTGTCTGTCGCTCTGTAACGCCAACGCCTTCTTCT	743	0	UF_Msa_CF_121508	contig12142___0rc	contig12142___0rc	Unknown	
715	9	59	unmapped	0		0	GCAAATTTGAGAGTCAAATTCACCAAAGTCGAACATGAACAGGCACAAAGTTGATATTTA	745	0	UF_Msa_CF_123131	contig10964___0	contig10964___0	Unknown	
716	9	60	unmapped	0		0	CACGTTCATCCTCAAAAACCCACCAGAGAGCACTGATAGTGGATCCGCATCTGTAAAAAA	747	0	UF_Msa_AF_104828	contig18483___1_nrnt	contig18483___1_nrnt	Unknown	
717	9	61	unmapped	0		0	ATGAACGAAGAGCTGAAGAGAGCCCGGAAGGCTTTTGACGAAGCTAATTATGGCTCATAA	749	0	UF_Msa_AF_100437	contig27599___1rc_nrnt	contig27599___1rc_nrnt	Unknown	
718	9	62	unmapped	0		0	TGATTTGACTCTAAATGAGATGAAACCTCAGGATCACAGCGCAACATCAAATGGCCGACC	751	0	UF_Msa_CF_124505	contig05718___0rc	contig05718___0rc	Unknown	
719	9	63	unmapped	0		0	CCCAAGAAATGACCATTTCTTGACCTCTTTCTCCAATGCATTTCCTTTTGCTACACTATT	753	0	UF_Msa_AF_107528	LMB_S454.sd.427.C1___1rc_nr0nt1	LMB_S454.sd.427.C1___1rc_nr0nt1	Unknown	
720	9	64	unmapped	0		0	ACGGTGATGAAGACATACCACATGTACCACACTGAGAGTGTCAGTGCTGAGAGCAAGTTG	755	0	UF_Msa_AF_104295	contig00763___1_nrnt	contig00763___1_nrnt	Unknown	
721	9	65	unmapped	0		0	ATCAGGAATGTCGAGGTGAGGCAGGGGGTGGTTTTCGAGGTAAAGAGCAGAGTTTCAGCC	757	0	UF_Msa_CF_118081	contig05611___0rc	contig05611___0rc	Unknown	
722	9	66	unmapped	0		0	AAACAGAAAGTGGCTGTAATTTGGAGCGTTACCCTGCGGTGATTTGAACTGTATGTATAA	759	0	UF_Msa_CF_124358	contig25015___0	contig25015___0	Unknown	
723	9	67	unmapped	0		0	CCGGCCTTTCTTTTGGCTCTTTGAGAACGTCGTCGCTATGGGTGTCAGCGATAAGAGGGA	761	0	UF_Msa_AF_108083	contig23514___1_nrnt	contig23514___1_nrnt	Unknown	
724	9	68	unmapped	0		0	GGACCCGTTGGAGCAGTATGGTATATCAGATGAAACCCGCTTCCAGGTCAGCAATGGCCT	763	0	UF_Msa_AF_101892	contig28641___1rc_nrnt	contig28641___1rc_nrnt	Unknown	
725	9	69	unmapped	0		0	TCTGTTAGAACCGTCTACCATCTTGATTGTAAAATGCGACCTACTGGAGGTGTAGTGAGC	765	0	UF_Msa_AF_105279	LMB_S454.sd.521.C1___1_nr0nt	LMB_S454.sd.521.C1___1_nr0nt	Unknown	
726	9	70	unmapped	0		0	GAGTTTAAGTTAGAGGAAGTAGAAGTGGTCACAGTCCCTCCAGACTCCCTTGGAGAGGCA	767	0	UF_Msa_CF_125535	contig08096___0	contig08096___0	Unknown	
727	9	71	unmapped	0		0	ACAAGAGCTTCCTCAGTGCCAACCGCCTGAAGAGACACCAGCGAACACATTCTGGGGAAA	769	0	UF_Msa_AF_101117	contig28391___1rc_nrnt	contig28391___1rc_nrnt	Unknown	
728	9	72	unmapped	0		0	TTCAGTGTGTCCGGTGAGAACATGGCAGAAGAAGCGAAGAAACTGGCCGCTTACGCCTCC	771	0	UF_Msa_CF_124036	contig03632___0rc	contig03632___0rc	Unknown	
729	9	73	unmapped	0		0	GTTTCCTGTGTTTCGTATGAGCGGTGTGAGTGGAAAGCAGACTCCACCATGGATATCCGA	773	0	UF_Msa_CF_118785	contig00561___0	contig00561___0	Unknown	
730	9	74	unmapped	0		0	TACATTTGTGTCTACGGGAGTTGAAGGAGCTTTTGCTACTGAAGAGCATCCATATGCAGC	775	0	UF_Msa_AF_108456	contig24744___1_nrnt	contig24744___1_nrnt	Unknown	
731	9	75	unmapped	0		0	TTACTCAAGGGCTGCCCAAAGTTGGTTGCAACGAGAAAATCTGATTGACACACACCTTTG	777	0	UF_Msa_CF_127430	contig00313___0	contig00313___0	Unknown	
732	9	76	unmapped	0		0	CTCCAACAGAGGGAGGAAGTGCTACATCGGAAGATGTTGCTGCTTCTTCTCCCGCTGGAG	779	0	UF_Msa_AF_108298	contig05882___1_nr0nt	contig05882___1_nr0nt	Unknown	
733	9	77	unmapped	0		0	AAGACTGATTACAAGTTGAGCGTTGGTTTAGTGACGAAAGAGCGTCAGAAACTGGAAGCT	781	0	UF_Msa_AF_107446	contig31421___1_nr1nt0	contig31421___1_nr1nt0	Unknown	
734	9	78		0		0		783	1	RC8	RC8	RC8		CONTROL
735	9	79	unmapped	0		0	CATGTCTGGAGAACAAAACCTACTGTTTAAACACCTTGGTATGCTTATGTATGTTCATTT	785	0	UF_Msa_AF_100087	contig30494___1_nr0nt1	contig30494___1_nr0nt1	Unknown	
736	9	80	unmapped	0		0	CGGAGAAATGGTATCGTCCAAAGATGGCAGCCTCCGTGTGGAAGCGATGTGTGACTGCAG	787	0	UF_Msa_AF_103933	contig20029___1_nr0nt	contig20029___1_nr0nt	Unknown	
737	9	81	unmapped	0		0	GTACACTATGCTAACAGAAGCTACAGTACAGGGAACAAGTTGGACTATATTCTAACTGCT	789	0	UF_Msa_CF_121256	contig17403___0	contig17403___0	Unknown	
738	9	82		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
739	10	1	unmapped	0		0	TGTGAAGTGAGCGCCATCGGCCCCCATCTGAGCCACGTAGGCGGTACTTACACGCACAGA	630	0	UF_Msa_AF_109374	contig14065___1rc_nrnt0	contig14065___1rc_nrnt0	Unknown	
740	10	2	unmapped	0		0	TAGGACCTCCAGCTACTGCACCCCGCAGTCAGGAAATAGCACTTTGACCCCATTACAGCA	632	0	UF_Msa_CF_124500	contig16783___0rc	contig16783___0rc	Unknown	
741	10	3	unmapped	0		0	TAGCTCGGCGGACGCTAACGTTAGCAGAGCAGATATTTTTCTCCAGTCCCAGCAGCCACC	634	0	UF_Msa_CF_119286	LMB_S454.919.C1___0rc	LMB_S454.919.C1___0rc	Unknown	
742	10	4	unmapped	0		0	AGAGATCAAGAGGATCCTCAAGCAGCAGAAGAAGAAGGAGAGAAAGGAAATTAAAATCCT	636	0	UF_Msa_CF_119525	contig02114___0rc	contig02114___0rc	Unknown	
743	10	5	unmapped	0		0	CGACTCTGGCAAACTCGCAGCACAGAAAGCAACGTGTGCGCTAGCAACTAAGAAAGCTGA	638	0	UF_Msa_CF_127169	contig09276___0	contig09276___0	Unknown	
744	10	6	unmapped	0		0	TTGACTGTGCCCCGGAGAACCTTCACTTCTTGCGCTTTGTCTGTCGGACCCTCAACCAGA	640	0	UF_Msa_AF_103981	contig20279___1_nrnt0	contig20279___1_nrnt0	Unknown	
745	10	7	unmapped	0		0	TCAGTACTTTTCCTTTTTAGTAGCCACCTCTGACTTTTGAGGAGTCACCCTTCAGCACTG	642	0	UF_Msa_AF_104429	contig17257___1_nr0nt	contig17257___1_nr0nt	Unknown	
746	10	8	unmapped	0		0	ACACTGATTTAAACCACAAAACCCACTTTCAGGGTTGCAGAAAGCCCTGACCTGTACCAT	644	0	UF_Msa_CF_126834	contig12072___0	contig12072___0	Unknown	
747	10	9	unmapped	0		0	AAGGTGTGTGCTGTGGAGGTGAAAAGGCAGATCTGGCAGGACAACCAGGCTCTGTTTGGG	646	0	UF_Msa_AF_105885	contig09705___1rc_nrnt	contig09705___1rc_nrnt	Unknown	
748	10	10	unmapped	0		0	ACGTGATGAGGGAGGCAAGGCTTTCTTCAAGGGAGCCTGGTCCAATGTGCTCAGAGGCAT	648	0	UF_Msa_AF_108868	LMB_S454.sd.542.C1___1rc_nrnt	LMB_S454.sd.542.C1___1rc_nrnt	Unknown	
749	10	11	unmapped	0		0	GCAGCAGATAAGAAGACAGATTGACAGCTCCGAATGTTTATGATGCATCTTACACAGTGT	650	0	UF_Msa_CF_124507	contig05109___0	contig05109___0	Unknown	
750	10	12	unmapped	0		0	CGAGGAGAAGTGGGAGTACTATTCACAAATAAAACAAAGGATGAGGTACAAGAGTATTTC	652	0	UF_Msa_AF_100718	contig08433___1rc_nrnt-1	contig08433___1rc_nrnt-1	Unknown	
751	10	13	unmapped	0		0	TTGATATTCTGGAGGATGAAGAGGTGCGTCAGGGGCTCAAAACTTATTCTAACTGGCCAA	654	0	UF_Msa_AF_105315	contig01761___1_nrnt	contig01761___1_nrnt	Unknown	
752	10	14	unmapped	0		0	ATGATAGAAGATGCTAAATTATACGGGATCCAGGACTTCTGTAAGGACCTGCTGGAGGTG	656	0	UF_Msa_AF_103415	contig30488___1rc_nrnt	contig30488___1rc_nrnt	Unknown	
753	10	15	unmapped	0		0	TTAATCTCACACAATGTCATTAAACACGTGGGGATAACAGGAAGTCTCACCCTCCAGCTG	658	0	UF_Msa_CF_126490	contig00600___0	contig00600___0	Unknown	
754	10	16	unmapped	0		0	GACCTTTTTACTAGTCAATAAATCAAACCTTGCCTTTTCAGCGGAGGTCAAACGATTCAG	660	0	UF_Msa_CF_126891	contig15005___0	contig15005___0	Unknown	
755	10	17	unmapped	0		0	CCTTCACCTGCCCTCAATGTGGCACTGACAACATCTACGACAGTGTCTTTGAAGGAGCCC	662	0	UF_Msa_AF_106804	contig20129___1rc_nrnt	contig20129___1rc_nrnt	Unknown	
756	10	18	unmapped	0		0	AGACTGATTAATGAACCAAGCAATGACTGGGACATCTACTACTGGGCAACAGAAGCTCAC	664	0	UF_Msa_AF_107746	contig14127___1_nrnt	contig14127___1_nrnt	Unknown	
757	10	19	unmapped	0		0	GGGTCCCCTCTTTCTATGTAGTTATATTTACCCGTTTCTGTTTTGTCGGTTTCCCAGTTT	666	0	UF_Msa_AF_103961	LMB_S454.944.C1___1_nr0nt	LMB_S454.944.C1___1_nr0nt	Unknown	
758	10	20	unmapped	0		0	TAGATGACAGCCTGTGTGCAGAAGCATCTTTCATGGCTGAGGCAGACGGGTACGGTCTTA	668	0	UF_Msa_CF_120323	contig17281___0	contig17281___0	Unknown	
759	10	21	unmapped	0		0	AGCTGGAGTGGACCGATAGGGGTGTGTTTGCCTCTTCTGGTGAAGTCGGTTCTCTTTTCG	670	0	UF_Msa_CF_119648	contig26816___0	contig26816___0	Unknown	
760	10	22	unmapped	0		0	TGACTTTCTTGTGGAGCAGTATCTTTAATAAACCGCGGCTGTGCCTCTACTTCCATCACA	672	0	UF_Msa_CF_121425	contig24350___0rc	contig24350___0rc	Unknown	
761	10	23	unmapped	0		0	CAAACTCAAGCAAGCGTGCGGGTTCGAGTACACGTCCAAACTGTCAGCGAATGTTCCAGG	674	0	UF_Msa_AF_108574	contig20875___1_nr0nt1	contig20875___1_nr0nt1	Unknown	
762	10	24	unmapped	0		0	GCCTATCTGTGTGAGACATAGCTGCAACTTCTGTTCTTTGTTCTTGATTCAGACTACCCT	676	0	UF_Msa_CF_127827	contig20440___0	contig20440___0	Unknown	
763	10	25	unmapped	0		0	TGTCATGAAGGACGTTCCAGGTTGGAAGGTTGGTGAGAGCGTCTTCCACACAGACCGCTG	678	0	UF_Msa_AF_106612	contig28239___1_nrnt	contig28239___1_nrnt	Unknown	
764	10	26	unmapped	0		0	AAGGACACTGTCCGGGCAGCATCGCCATTGCTGAAGACTGGAATGGACGATGATAGGAGG	680	0	UF_Msa_AF_102302	contig23224___1_nrnt0	contig23224___1_nrnt0	Unknown	
765	10	27	unmapped	0		0	ATCACATGAACGAGCCACAGACTGTTAACTACCCCGAGCGGTTTGGAGACGGCAGCGACT	682	0	UF_Msa_CF_120774	contig03923___0rc	contig03923___0rc	Unknown	
766	10	28	unmapped	0		0	GTCGAAGAATACAACACAGAAACATCGGAAGAGAGGATACAACCTAAACCTAAAGTCAGT	684	0	UF_Msa_CF_126083	contig15784___0	contig15784___0	Unknown	
767	10	29	unmapped	0		0	TAACACATCCAACATTGAATGCACTGTAACGCTCTGGGCCTCTAACTTTGCTCTATGCCT	686	0	UF_Msa_AF_108933	contig24210___1_nr0nt1	contig24210___1_nr0nt1	Unknown	
768	10	30	unmapped	0		0	CTATTGTCTGGCTGCATACAGCACAGTAGTGGAAGCTTGCTAACGTGGACTGAGATACAG	688	0	UF_Msa_CF_119631	contig26251___0	contig26251___0	Unknown	
769	10	31	unmapped	0		0	CACTGGAGACAAACCGAACTTGTGTGAATAGTGGAAACGTCTTCTAGTATCTTCAACCAG	690	0	UF_Msa_CF_125340	contig06777___0	contig06777___0	Unknown	
770	10	32		0		0		692	1	RC1	RC1	RC1		CONTROL
771	10	33	unmapped	0		0	GGGCTGTCTTATTTACATCCCTAATATTATTCCTCATCACTCTTAACATACTTGGCCTCC	694	0	UF_Msa_AF_101139	LMB_S454.sd.406.C1___1_nrnt	LMB_S454.sd.406.C1___1_nrnt	Unknown	
772	10	34	unmapped	0		0	GAGCTCAGCAACGAGTTCGTCAAACTGCAGAACGACATCCTGCAGAAGTACAAGCTGACC	696	0	UF_Msa_AF_106956	contig13936___1rc_nrnt0	contig13936___1rc_nrnt0	Unknown	
773	10	35	unmapped	0		0	ACACAGCTGTCATTTTGTATCCCCAATGATTGAGGGATAAAGAATTCCAGTTCAAGAAAG	698	0	UF_Msa_CF_126757	contig10701___0	contig10701___0	Unknown	
774	10	36	unmapped	0		0	GGGTTGACCAAGAATTCCACACTTTCAATCTACTGTAACAGAATTACAGGGAACCTGGTG	700	0	UF_Msa_AF_105802	contig27720___1_nrnt	contig27720___1_nrnt	Unknown	
775	10	37	unmapped	0		0	AAACCCTGAATGCCCCAAATCCACAAATTTCTCTTGGTCTTGTCCTGCTTCAGCAAGGAA	702	0	UF_Msa_CF_125153	contig07252___0	contig07252___0	Unknown	
776	10	38	unmapped	0		0	TGGATTTCCCCAATCCTCTTCCTCCTGTTGTGAGCTTTTATAGCTCTGACTTGTCATCGT	704	0	UF_Msa_AD_200149	LMB_Add_74_rc	LMB_Add_74_rc	Unknown	
777	10	39	unmapped	0		0	ACGCCTTTGACAGGCCCATCTGTGAAGTTCTGCTCAATCAGAAGTACTTCAACGGTATCG	706	0	UF_Msa_AF_102094	contig23299___1_nrnt0	contig23299___1_nrnt0	Unknown	
778	10	40	unmapped	0		0	AACTTGGAGAATACTGAATCATCGTCCCGCATGTCCGAAAATGGATTTTGACCACCTGGT	708	0	UF_Msa_CF_120570	contig28471___0rc	contig28471___0rc	Unknown	
779	10	41	unmapped	0		0	AGGAGCAAACTGGCGCATCATCTCTGAAAGTAGAACTGACGAAAAACAGTGTGGATGAGT	710	0	UF_Msa_CF_124615	contig17552___0rc	contig17552___0rc	Unknown	
780	10	42	unmapped	0		0	GTCCTCTCCTATCCTGCTTCATCAATACTGTGCAGTTTAATAATAATGTCAGTTTCCATC	712	0	UF_Msa_AF_103867	contig27861___1_nrnt	contig27861___1_nrnt	Unknown	
781	10	43	unmapped	0		0	TTTTTATGGGATGGCTTATTGAGAAGTGGAAGAGACATACAGAGACTTCAGCGTGGTGGC	714	0	UF_Msa_CF_118239	contig11878___0	contig11878___0	Unknown	
782	10	44	unmapped	0		0	GAAAACACTGAAGACAGGCTTGAAACAAAGACGATTTACCAACAAGGAGAGCACACAGAC	716	0	UF_Msa_CF_121397	contig08926___0rc	contig08926___0rc	Unknown	
783	10	45	unmapped	0		0	GACAGTTCTCTCTGGGTCGCACATGGACAGAGACAGCCTGCTCACCTGGCTATAGACACA	718	0	UF_Msa_AF_100318	contig08050___1rc_nrnt-1	contig08050___1rc_nrnt-1	Unknown	
784	10	46	unmapped	0		0	TACACAGAAAGTGAATCTCAATCAAGTGCCTTTGGGCAGAGACACAAACAGCCTTGTCCT	720	0	UF_Msa_AF_101033	contig04067___1rc_nrnt-1	contig04067___1rc_nrnt-1	Unknown	
785	10	47	unmapped	0		0	TAAATGGAGATGTTGGATGGGAAACGGCTGCTCATCCACGAATGGGAAGCCGGCGGCATG	722	0	UF_Msa_CF_123144	contig16760___0	contig16760___0	Unknown	
786	10	48	unmapped	0		0	ATGAGGGGATCATAGATCCCCTTTCTAGCTCTCAAGCTGATGAGACTGATCCAGGAGCTG	724	0	UF_Msa_CF_118721	contig04727___0rc	contig04727___0rc	Unknown	
787	10	49	unmapped	0		0	AATGTCAAAGACAAACTCTGCAGCAAGAGGACAGACCTCTGTGACCACGCTCTAAAAACA	726	0	UF_Msa_AF_105564	contig05701___1_nrnt	contig05701___1_nrnt	Unknown	
788	10	50	unmapped	0		0	AGACCACACAGAGAGGCAGTGCCTAAATGGGAACACCACGGCTTTCAGGAGCCTACACGT	728	0	UF_Msa_CF_121985	contig15231___0	contig15231___0	Unknown	
789	10	51	unmapped	0		0	GCGGGGTAGGGAGTGGGACACACCACCACCACCACAAAAGAAAAGCTCCAATGACATTAC	730	0	UF_Msa_CF_122005	contig17900___0	contig17900___0	Unknown	
790	10	52	unmapped	0		0	TCAACAGGAAGTCATCAGAAAAGACTGGCTGTTCAAGCTGGTTGGAAAGGAAACCTTCAC	732	0	UF_Msa_AF_100796	contig15204___1_nr0nt1	contig15204___1_nr0nt1	Unknown	
791	10	53	unmapped	0		0	AGCCAAGAAGACAAAAACTATATTTTAGTTGAAAGCTCAGAAGAGACTGAGGAGCAAGTT	734	0	UF_Msa_CF_119896	contig02377___0	contig02377___0	Unknown	
792	10	54	unmapped	0		0	AGATAAAATGTCTATTGAAGAAGTGTGCTGGTTTGGATTTTACAAGTGGTTCAAATCCGG	736	0	UF_Msa_CF_127538	contig26373___0	contig26373___0	Unknown	
793	10	55	unmapped	0		0	TAAGCAAGAGAAACCACTCTGCGTGTATGCATATTCCAGCAACAGCAAGGTCATCTCAAG	738	0	UF_Msa_AF_108413	contig05952___1_nrnt0	contig05952___1_nrnt0	Unknown	
794	10	56	unmapped	0		0	GACAACCAGTACTGTTAAATGTTAACAGTTTGTGAAACAAGAGTCAAACAAAACCTGGAA	740	0	UF_Msa_AF_108048	contig29439___1_nrnt	contig29439___1_nrnt	Unknown	
795	10	57	unmapped	0		0	ATTCTTCAAATCCCTGGATGAGAGGCAAGCTCTCTGAAGATCCCACAGAGAAAGAGATAA	742	0	UF_Msa_CF_126393	contig18212___0	contig18212___0	Unknown	
796	10	58	unmapped	0		0	GTTGTGGTGAGATGGCCTGATTGTATTTTTCTTTTAATAGATTGTACAAGACTGTACTGA	744	0	UF_Msa_AF_106997	contig28401___1rc_nrnt	contig28401___1rc_nrnt	Unknown	
797	10	59	unmapped	0		0	CTACCCGATACTGATATGAGAATGTGAGTAACATTTTTGTTTAGGGGCAGAAAACAAAAT	746	0	UF_Msa_CF_125145	contig08784___0	contig08784___0	Unknown	
798	10	60	unmapped	0		0	GAGAGCGAGGAAGAGAAGAAAGTTTCAATCTGAAAGTCAGTAGTAAGACGAAATGTGACC	748	0	UF_Msa_CF_123776	contig11236___0	contig11236___0	Unknown	
799	10	61	unmapped	0		0	ATCTTTATCAAGAGCTATCATCCCTATAGTGTCATGGGAGTGCACATTGGCATGGTTTGC	750	0	UF_Msa_CF_118875	contig15485___0rc	contig15485___0rc	Unknown	
800	10	62	unmapped	0		0	GTGCTCGTCTTGTGAGAAGATGCTGCCGCCGTTGCCGCTGTGTGGACGCCGTGACCGCCT	752	0	UF_Msa_CF_124189	contig27111___0rc	contig27111___0rc	Unknown	
801	10	63	unmapped	0		0	ACAAAGATAAACCAAAAGAATGCCCAGAGGCAACCAGCACTCCCACAGAGGTAGAAAACA	754	0	UF_Msa_CF_125733	contig11422___0rc	contig11422___0rc	Unknown	
802	10	64	unmapped	0		0	GGCGCTGTGGTTCCTGGTGCGGGACCTAAATGTAGACGTGAACCAGAAGGCGACAGACAT	756	0	UF_Msa_CF_118867	contig22422___0rc	contig22422___0rc	Unknown	
803	10	65	unmapped	0		0	ACAGAGACATGCAACTCCGCAGCCAGGCCAGAGCCCTGATCACCTTTGCTGGTATGATTC	758	0	UF_Msa_AF_103723	contig17433___1rc_nrnt	contig17433___1rc_nrnt	Unknown	
804	10	66	unmapped	0		0	TAAATTCAGAAAGCTGATCTACTACATGCTGGTGTCCATCGTGCTGCTGTGTCTATGTGC	760	0	UF_Msa_AF_105072	contig17221___1rc_nrnt	contig17221___1rc_nrnt	Unknown	
805	10	67	unmapped	0		0	ATACAGACACTGAAAAACCACCGAAGAAGAAGAGAGAAGATAAGGTCCTGCCAAGCAACG	762	0	UF_Msa_CF_124771	contig13750___0	contig13750___0	Unknown	
806	10	68	unmapped	0		0	GGACGCAGTGAATGTCAGTGACCGTGAGCTGTTTGGCATGTTGAGGAAGCGTGCTGACAG	764	0	UF_Msa_CF_117810	contig23620___0	contig23620___0	Unknown	
807	10	69	unmapped	0		0	CTGGACACCACCACTATCCCACCAGAGGAGCTGTCCCTGAAACCTTCACGCTCTGGGGCT	766	0	UF_Msa_AF_105189	contig23672___1_nrnt0	contig23672___1_nrnt0	Unknown	
808	10	70	unmapped	0		0	AGTCATCTTGTGTGGAGACTGAGACAAGGAGAGGAGCTCTCTGAGAGTTTTAGAATGCAT	768	0	UF_Msa_CF_122528	LMB_S454.1058.C1___0	LMB_S454.1058.C1___0	Unknown	
809	10	71	unmapped	0		0	TTCTTTAGACCACGCTAGTATTCGTCGTGGTTACCAGGTATATAAGCAGGTGTGTTCAGC	770	0	UF_Msa_AF_101413	contig04765___1rc_nrnt	contig04765___1rc_nrnt	Unknown	
810	10	72	unmapped	0		0	ACATGCCGATTGTGTCAGAGTCAGGCTGCAGGAGGAACAGAGTCTATTCCTGCAGCCCGA	772	0	UF_Msa_CF_118367	contig21639___0rc	contig21639___0rc	Unknown	
811	10	73	unmapped	0		0	GAGGACCAGCTGCAGTTTGGCTGGCTTTGTTCTTCGAGTGACCCTTGACCTTTTTAAAGA	774	0	UF_Msa_CF_126771	contig13423___0	contig13423___0	Unknown	
812	10	74	unmapped	0		0	ACACATCGGCAGGGCTTACTTTGAACTGGCTGAGTACACACAGGCGGAGCGTCTGTTCAG	776	0	UF_Msa_AF_107487	contig07996___1_nr1nt0	contig07996___1_nr1nt0	Unknown	
813	10	75	unmapped	0		0	ATCCAGCCGCTCGTCAAAACTCTGATCTGCGAGTCCGAGTGCACCACCCTCAAGTCTTTG	778	0	UF_Msa_AF_100903	contig01074___1_nrnt0	contig01074___1_nrnt0	Unknown	
814	10	76	unmapped	0		0	ATCCAAGTCGAGCAACGACGGGGCAACGTGACCTTTGACCAGGTGACGGTGTTCTTCTTC	780	0	UF_Msa_AF_106053	contig15470___1rc_nrnt	contig15470___1rc_nrnt	Unknown	
815	10	77	unmapped	0		0	GAAGAACGCAGCAGCGAGCAGACGGAGGATTTATTCTTATTCTTATGATTATTATTGTTG	782	0	UF_Msa_CF_124592	contig19867___0	contig19867___0	Unknown	
816	10	78	unmapped	0		0	CCAGGCTGTAGCCGAGTACTGGGCCAGTGCTAAAGAACCAGAGTATGATCTGAATGTGGA	784	0	UF_Msa_AF_110187	contig05792___1rc_nrnt	contig05792___1rc_nrnt	Unknown	
817	10	79	unmapped	0		0	TAAAAACCCAACCAGTGCCTCATCACCACCACCATCATCATACCTCGTCCTCCTCCTCAC	786	0	UF_Msa_CF_122168	contig30211___0rc	contig30211___0rc	Unknown	
818	10	80	unmapped	0		0	AGAGGAAAGAGAATCTGCATGTTCCAGCCAATCAAACCAACTACATCTGAAGCAGCTGCA	788	0	UF_Msa_CF_123588	contig18635___0	contig18635___0	Unknown	
819	10	81	unmapped	0		0	GTTAAAGCGCGCTCACAGACGGGCGAATCGGCCTGATTGGACTGACTTTAACTCCCTCGT	790	0	UF_Msa_CF_127468	contig04381___0	contig04381___0	Unknown	
820	10	82	unmapped	0		0	TGAAGACAGAGATTGGCTGCTGGGCGCTCTCCCCATGTGCCAGACAGCAGCTCCAGCTGT	791	0	UF_Msa_CF_123793	contig09173___0rc	contig09173___0rc	Unknown	
821	11	1	unmapped	0		0	GAAAAACAGAATTCAGCCAAAACAGACAGCTGACATAAGATGGATTTCACAGAGGTTCCC	792	0	UF_Msa_CF_126668	contig01130___0	contig01130___0	Unknown	
822	11	2	unmapped	0		0	AGCAGTGAGGAAGCAGCCCACCTCCTGTCCATCACTGCCAAGGACGTTGCAGTCATTATG	794	0	UF_Msa_CF_117695	contig03797___0	contig03797___0	Unknown	
823	11	3	unmapped	0		0	TAAATCCGCTGGTGCTCCCAGAGTATCTCATCCATTTCTTCTTCTGCGTGATGTTCTTCT	796	0	UF_Msa_AF_107808	contig29783___1rc_nrnt	contig29783___1rc_nrnt	Unknown	
824	11	4	unmapped	0		0	TGAGGTGCATCTGCAGGCTGACCCCACCAAGCTGGAGCTGCTTCACAAGTCCTTTAAGGT	797	0	UF_Msa_CF_119140	contig03939___0	contig03939___0	Unknown	
825	11	5		1028	E1A	0		799	1	(+)E1A_r60_n9	E1A_r60_n9	E1A_r60_n9		CONTROL
826	11	6	unmapped	0		0	AGTGATCACCTCATAGGAATGAATGAAATGACTTGCAGACCAGTCGTGTTTTGTTCCCCC	800	0	UF_Msa_CF_122135	contig28939___0rc	contig28939___0rc	Unknown	
827	11	7	unmapped	0		0	ATGCACCATTTATTTCACCTTTAACCCCATTTGACTCTGACTTCGTCTCATCAGCTGTTA	802	0	UF_Msa_CF_123329	contig01854___0rc	contig01854___0rc	Unknown	
828	11	8	unmapped	0		0	GTCTGTGCCAGCAGTACTCCACCATCAGCTCTACCAGCTCGAAAACAATCTGCTGCTCGA	804	0	UF_Msa_AF_109118	contig31272___1rc_nr0nt	contig31272___1rc_nr0nt	Unknown	
829	11	9	unmapped	0		0	TATATTAGCAGAAGCGCCCGGCAAGGTAGACGGAAGGAGACATTAACGGCTCGAAACAAT	806	0	UF_Msa_CF_123117	contig23966___0	contig23966___0	Unknown	
830	11	10	unmapped	0		0	TGAAGGCCATTGTGACTGAGAGCAAGACTCCAGGTCGTCCTGATCCTCCACCACGTCAGA	808	0	UF_Msa_CF_124737	contig12620___0	contig12620___0	Unknown	
831	11	11	unmapped	0		0	ACATTGTTAACCAATCAGACGAGGCCTTACAAGGTGAAGATGCTGAAGAGATGAACACCC	810	0	UF_Msa_AF_109142	contig19667___1rc_nr0nt	contig19667___1rc_nr0nt	Unknown	
832	11	12		0		0		812	1	ETG04_27747	ETG04_27747	ETG04_27747		CONTROL
833	11	13	unmapped	0		0	GCCGCACGGTAGTTAGCCTGTACTCGCGCTGCCCTCCCTGCTTGTGAATGAGAAGTAAAT	814	0	UF_Msa_CF_123418	contig03122___0rc	contig03122___0rc	Unknown	
834	11	14	unmapped	0		0	AATTTAGAAGGCACTTGGTCTGTTTGCTGTTCTTACATGTGCTCTGGGTGGTTCTGCAAG	816	0	UF_Msa_AF_100583	contig06503___1_nr0nt1	contig06503___1_nr0nt1	Unknown	
835	11	15	unmapped	0		0	TGACTCATGCTGCTCTGTGCCCTAGCCCTGCCCTGAGGTCATATTCCCCATGATGCACTT	818	0	UF_Msa_CF_126794	contig03789___0	contig03789___0	Unknown	
836	11	16	unmapped	0		0	CTTTGGTAGAAGGATGTTGAGACGCCAGCAGCCAAAGAAAAGTAAAGGCAAGAAAAATGA	820	0	UF_Msa_CF_118091	contig30219___0rc	contig30219___0rc	Unknown	
837	11	17	unmapped	0		0	ATTGTTTCAGACAAGGTCAAGAGACCAGTCTCACCAACCGAAGAGTACACGCACAAAGAA	822	0	UF_Msa_CF_124467	contig24033___0rc	contig24033___0rc	Unknown	
838	11	18	unmapped	0		0	TTATCTGGTATTGCTGATGGGGCTGTTGGAGGGATACTTTGTGCCACTCTACAACTTCTT	824	0	UF_Msa_AF_107158	contig23019___1_nrnt	contig23019___1_nrnt	Unknown	
839	11	19	unmapped	0		0	TTACAGAGAGAAAGTTTAAACGTTCTGCAGATCAGTCCTGCTGTTTGTACTTTAGCATTA	826	0	UF_Msa_CF_125545	contig28834___0rc	contig28834___0rc	Unknown	
840	11	20	unmapped	0		0	TACGACTACTTGTTCAAAGTCGTACTAATCGGAGACTCAGGAGTGGGGAAAGAGTAACCT	828	0	UF_Msa_AF_107188	contig29073___1rc_nrnt	contig29073___1rc_nrnt	Unknown	
841	11	21	unmapped	0		0	GGGACATGTAAGCAGGCAGACGGGACATGCCCTTTCTCTCATAAGGTGGCTAAGGAGAAG	830	0	UF_Msa_AF_103577	contig02438___1_nrnt	contig02438___1_nrnt	Unknown	
842	11	22	unmapped	0		0	TCACTCAAGGAGGAGAGGTCGGACTGATTTCAGGGTGAATCCAGGGAAGGCGGTTGAAAG	832	0	UF_Msa_CF_121566	contig26053___0rc	contig26053___0rc	Unknown	
843	11	23	unmapped	0		0	AGAGATGGCTCCTCAGATCGACTACACCATCAAGGTGTTTAAACCAATCGTGGAGAAGTT	833	0	UF_Msa_AF_103260	contig14258___1_nrnt	contig14258___1_nrnt	Unknown	
844	11	24	unmapped	0		0	TGGTCCCAGTGAGAAGTATTTCCATTGTGAGAAGTGCAATCTGTGTTTAGCCCAGGATCT	835	0	UF_Msa_AF_104890	contig14249___1_nrnt	contig14249___1_nrnt	Unknown	
845	11	25	unmapped	0		0	TGGAGTGAACTCAACATGGCTTCTGGCAACGACAGGGGAGCGACCCTGTCCAGAGCATTA	837	0	UF_Msa_CF_126928	contig18527___0	contig18527___0	Unknown	
846	11	26	unmapped	0		0	TTTACTCATAATCACCGCTCACACATCATCCGTGTCCGCAGACAGAGACCTGCGGCCGTG	839	0	UF_Msa_CF_123052	contig09664___0rc	contig09664___0rc	Unknown	
847	11	27	unmapped	0		0	TTACGCTCAACATAATCTGCTTGATTTACCATAGAGAGCAACAAGATCGGCATTGATGGG	841	0	UF_Msa_AF_101846	contig09380___1rc_nrnt	contig09380___1rc_nrnt	Unknown	
848	11	28	unmapped	0		0	ATACTGTTACATACTCAAGATTTACCGGCAGCGCTTTGGCTAACACCTCTTCTGACACCT	843	0	UF_Msa_CF_124439	contig07957___0rc	contig07957___0rc	Unknown	
849	11	29	unmapped	0		0	AGCTGTGCTGGAAAACAACTTGAGAGAGTAATATGGGGGAAAATCAAGATTATACCGTTT	845	0	UF_Msa_CF_124834	contig11316___0	contig11316___0	Unknown	
850	11	30	unmapped	0		0	ACAGAACAGAGCATGACAGAATAGCCAAACAATGGACGAAGAGATACGCCACATAGACTC	847	0	UF_Msa_AF_103519	contig32308___1_nrnt	contig32308___1_nrnt	Unknown	
851	11	31	unmapped	0		0	TACAACGCAGGGAAAACGCTAACATCGAGGGCCTCATACCAAGCTACGGCTCCTGAATCC	849	0	UF_Msa_CF_125837	contig18050___0rc	contig18050___0rc	Unknown	
852	11	32	unmapped	0		0	TTCATTTGTTGCCTGAACTCTGAGTGAACCTCAGCTTTAGGAAAAAAGGGCACCAACAGG	851	0	UF_Msa_AF_104595	contig10545___1_nr0nt1	contig10545___1_nr0nt1	Unknown	
853	11	33		1028	E1A	0		853	1	(+)E1A_r60_a97	E1A_r60_a97	E1A_r60_a97		CONTROL
854	11	34	unmapped	0		0	ATCGTGTGTCTCACGGATATGCTCTTATAGGGTTTACGCAAAAAGGTAATTTTCATAAGT	855	0	UF_Msa_AF_107522	LMB_S454.sd.473.C1___1_nrnt	LMB_S454.sd.473.C1___1_nrnt	Unknown	
855	11	35	unmapped	0		0	CTCCCGAAAATACCAGATTCCACCTGAAGACCTGGTGGATATGTTGAAAACTGGAGAAAC	857	0	UF_Msa_AF_102407	contig09457___1rc_nrnt0	contig09457___1rc_nrnt0	Unknown	
856	11	36	unmapped	0		0	TTGAAGTAACCCTTGGTATCAAACACGGTGTTCAGTTTGGGAAACATAACTGCTAAGGTC	859	0	UF_Msa_AF_110112	contig27851___1_nr0nt1	contig27851___1_nr0nt1	Unknown	
857	11	37	unmapped	0		0	TCTGCAGCAAAGTGACTCCTAAAGACAGCCAGTTCGCTGCAGCGTTGGAGATCCGCTTCC	861	0	UF_Msa_AF_104885	contig05648___1_nrnt	contig05648___1_nrnt	Unknown	
858	11	38	unmapped	0		0	CAGACGTCATGTTAAAGCCAGTCTGTGTTGCAGGTTATAGACCAGAAGATACTCAACGTG	863	0	UF_Msa_CF_120704	contig16583___0rc	contig16583___0rc	Unknown	
859	11	39	unmapped	0		0	TCTCACCGAAAGGTATCATCATCACAGACACAGAGACCACAGACCTCATAGAAAATGTCT	865	0	UF_Msa_AF_104888	contig18833___1rc_nr0nt	contig18833___1rc_nr0nt	Unknown	
860	11	40	unmapped	0		0	CAGCGTCTCACTAAGTCAGAACCAGCTATCAGAGGAAGACCGAGCCAAACTGAAGGAAGT	867	0	UF_Msa_CF_127584	contig01134___0	contig01134___0	Unknown	
861	11	41	unmapped	0		0	TGGCATCGCGCTTCCAACATGGCGGTGAATCTCACAGACCTCTCCCTGCCTCAATTAGAG	869	0	UF_Msa_AF_106860	contig26283___1_nr0nt	contig26283___1_nr0nt	Unknown	
862	11	42	unmapped	0		0	CCTGGCTTCCAGGGTTCTGTAGATGGATGGTGGCCACCCCAGGAGCAGAGGATGTTAAAG	871	0	UF_Msa_CF_125613	contig10912___0	contig10912___0	Unknown	
863	11	43	unmapped	0		0	TCTCTTCCTGACCTGCCAACATGCCAGCCGCACTTACAGATTCCAGTCAGATAATCTGTG	873	0	UF_Msa_AF_110009	contig07419___1_nr0nt1	contig07419___1_nr0nt1	Unknown	
864	11	44	unmapped	0		0	TGTGACCTACAGACTGCTCATGCTGCAGAAGCAGAGGTCCATCTACATCAAGACCTGCTT	875	0	UF_Msa_CF_119200	contig18206___0	contig18206___0	Unknown	
865	11	45	unmapped	0		0	GCAAGTGTGGATTCAGAGGATAAAACATGGACTAATATAAGAGACGTTTTCTTCATTTAG	877	0	UF_Msa_AF_106543	contig27701___1_nr0nt1	contig27701___1_nr0nt1	Unknown	
866	11	46	unmapped	0		0	ACACATCCACATGAAGCTGTTCAGAGCTCAGAGGAACGAGTACATCGCCGGCTTCGCCCT	879	0	UF_Msa_AF_107991	contig30264___1_nrnt	contig30264___1_nrnt	Unknown	
867	11	47	unmapped	0		0	AGCCTCTGAGCGACGCGGCGCTCGCTCAGTAAATCTTAGGACCAGAGAACACTACAGAAC	881	0	UF_Msa_AF_107633	contig28633___1_nrnt	contig28633___1_nrnt	Unknown	
868	11	48	unmapped	0		0	TGACGGCACCACAAAGATCATCATCAACTACAGCATCAGCCCTGCAGCCGCCACCACTGC	883	0	UF_Msa_CF_122059	contig20466___0	contig20466___0	Unknown	
869	11	49	unmapped	0		0	AGGAGACACATGCCTGACAGCCTGCTGGACAGCTCTGTGTTGTTGCTGTCTCTGGGACAT	885	0	UF_Msa_AF_107792	contig13384___1rc_nrnt	contig13384___1rc_nrnt	Unknown	
870	11	50	unmapped	0		0	TCTGTTGTAAAGTTGCCTAAAAGCAACCTGTACCTGCAGAGACCGTTACCTTTACTCCTG	887	0	UF_Msa_CF_123540	contig10069___0	contig10069___0	Unknown	
871	11	51	unmapped	0		0	GATCGACTCGGCTCTGCTGCAACTTCCATCTTGGACTCCTCAGCTGCACTTATTGATCCC	889	0	UF_Msa_CF_126646	contig22623___0	contig22623___0	Unknown	
872	11	52	unmapped	0		0	CCAGCAGGAAGGACTACATCAAACAGACCGTCAAATCTCTCATCACATGAAGATCTGAAG	891	0	UF_Msa_AF_109384	contig32427___1rc_nrnt0	contig32427___1rc_nrnt0	Unknown	
873	11	53	unmapped	0		0	GCTTCCTCGGTCTTCTCCATATGGAGGTGTTCAATCAGAGGCTGGAGCAGGAATACAATG	893	0	UF_Msa_AF_104091	contig18383___1rc_nr1nt0	contig18383___1rc_nr1nt0	Unknown	
874	11	54	unmapped	0		0	CTCTCCTGATTGTCTCCTGTCAAATATGTCAATATTGTTGATTAAATCCATACTGTCCTA	895	0	UF_Msa_AF_103064	LMB_S454.801.C1___1rc_nrnt	LMB_S454.801.C1___1rc_nrnt	Unknown	
875	11	55	unmapped	0		0	TCTACACTCACACACATTACAGCTATCAGACAGACGCAAAAGGGGAAGTGAGTAGCAACA	897	0	UF_Msa_CF_119230	contig27362___0rc	contig27362___0rc	Unknown	
876	11	56	unmapped	0		0	GCTGGATCATGAGTTGGATAGAGACCTTCTTCCGTGTAGTTGACGTGTCGCTGAACGCTC	899	0	UF_Msa_CF_120820	contig09082___0rc	contig09082___0rc	Unknown	
877	11	57	unmapped	0		0	GCGACAAAGGTCTGTCAGACGAGGCAGCGGCAACAGCTTGTAAAGATGGAAACCCAATTA	901	0	UF_Msa_CF_118778	contig10534___0	contig10534___0	Unknown	
878	11	58	unmapped	0		0	AATTCCAAGTGTTTCTAATGAAAAGCGGCAGTGTCCGTTTGATAATCCAGTGTTGTGGTA	903	0	UF_Msa_AF_107622	contig28658___1_nrnt0	contig28658___1_nrnt0	Unknown	
879	11	59	unmapped	0		0	CAAAGCAGCAAAGCCACAGCCAAATATTTCATCGTGGCAGTCAAACGTGTCTCCCCGCAT	905	0	UF_Msa_AF_108905	contig13252___1_nr0nt	contig13252___1_nr0nt	Unknown	
880	11	60	unmapped	0		0	ATACCTGAACTCAGATTCTGCATCCCCAGAGCTGCGTGAGCATCTTGCCCAGAAGCCGGT	907	0	UF_Msa_AF_102017	contig26498___1rc_nrnt-1	contig26498___1rc_nrnt-1	Unknown	
881	11	61	unmapped	0		0	GCAGGGACATGATCACCCGTCGATCCCTCGGCTATGCCTATGTCAACTTCCAGCAGCCTG	909	0	UF_Msa_AF_100755	contig10531___1_nr0nt1	contig10531___1_nr0nt1	Unknown	
882	11	62	unmapped	0		0	ACATTACGGCTCTGTCTGTCAGTGCAGACCTCGTGGAGTTTCAGCCCTCACCGTTGTCTC	911	0	UF_Msa_CF_118499	contig10548___0rc	contig10548___0rc	Unknown	
883	11	63	unmapped	0		0	TGCCTTTCCACGCAACATGAGGCTTCCTGACCCTTTCACACCCAATCTCAAGGTGGACAT	913	0	UF_Msa_AF_101460	contig18209___1rc_nrnt	contig18209___1rc_nrnt	Unknown	
884	11	64	unmapped	0		0	ATGAATGAAAACCTGGACATTGAAACTCAAGATGGAGACTTAACGATGGACTGGGGAACC	915	0	UF_Msa_CF_124464	contig09790___0	contig09790___0	Unknown	
885	11	65	unmapped	0		0	TCATGCAACATGATGTACAGGAGCTGTGTAGAGTGCTCCTGGACAATGTGGAGAACAAAA	917	0	UF_Msa_AF_103719	contig18276___1rc_nrnt	contig18276___1rc_nrnt	Unknown	
886	11	66	unmapped	0		0	GGAACACAATGGTGGATGTCTCACAGTGGGGATCGAACTCAGGTCTCCCACACCAAAGGG	919	0	UF_Msa_CF_120842	contig24787___0	contig24787___0	Unknown	
887	11	67	unmapped	0		0	TATTGTAACAATAGAAGATGGGAAGATGGTGCACATACAGAGGTGGGATGGCAAAGAGAC	921	0	UF_Msa_AF_103150	contig28920___1rc_nrnt	contig28920___1rc_nrnt	Unknown	
888	11	68	unmapped	0		0	GGCTTTGGAGAAGGCCAACAAGCTGGAGGCAGAAAACCAAAGTGTAGAACAGTTGAAGGA	923	0	UF_Msa_CF_119511	contig26177___0	contig26177___0	Unknown	
889	11	69	unmapped	0		0	GGGTCCGTCCGCAGCCTGGAAACCGCTGTGCCCACGTAACACCTCACATTAGGTAACAGG	925	0	UF_Msa_CF_123521	contig19367___0rc	contig19367___0rc	Unknown	
890	11	70	unmapped	0		0	GGAGGAGGATGAGGACAGTATCCAGGCTGAAGGTCAGGAGCTAGAGGAAGAATCGGCGGT	927	0	UF_Msa_CF_127011	contig00218___0rc	contig00218___0rc	Unknown	
891	11	71	unmapped	0		0	AAAGACAGACTTTAAATCACTAAGACGCCGGAGATACTAAAGGTGAACCTCCGTCCTCGT	929	0	UF_Msa_CF_121260	contig24098___0rc	contig24098___0rc	Unknown	
892	11	72	unmapped	0		0	ACATTCAACATTAGAGTTCCACTCATCAACCGGGAGACAGCAAATTCCACACCTGGATCA	931	0	UF_Msa_AF_103184	contig15667___1_nrnt	contig15667___1_nrnt	Unknown	
893	11	73	unmapped	0		0	TCGTCTCACAGCAGGCTAACAGTTAGCAACAGAGGTCACTTTAGCACCCCCGAGGACTCC	933	0	UF_Msa_AF_101731	LMB_S454.803.C1___1_nr0nt	LMB_S454.803.C1___1_nr0nt	Unknown	
894	11	74	unmapped	0		0	AGCCCACCACCTGATCATAAAACACCACAGGAAAGACAGAAGACAGGTCCAAAGAAGCCC	935	0	UF_Msa_CF_123533	contig22282___0rc	contig22282___0rc	Unknown	
895	11	75	unmapped	0		0	TCTTCTTCTTCACTGATGCACCTTCTGTGTCCGCCATCTTCAACTGAGCCCCCGCGTACT	937	0	UF_Msa_CF_121178	contig31744___0	contig31744___0	Unknown	
896	11	76	unmapped	0		0	ACTTCCTGACTCTGCTTGCTTGCAAAATGGCTTATTTACAAAGCATGATGATACAGAGCA	939	0	UF_Msa_CF_120315	contig20258___0	contig20258___0	Unknown	
897	11	77	unmapped	0		0	TAAAGCAGAAAAGACTTGAAAGTCTTAGTTTGAGTTCTGGGTGGGAGAGGACGAGGAAGT	941	0	UF_Msa_AF_103557	LMB_S454.sd.606.C1___1_nrnt	LMB_S454.sd.606.C1___1_nrnt	Unknown	
898	11	78	unmapped	0		0	TAGCATCACAGGATGAGGAGAAAGTGCAGGAGGTGGCCGAAGAGGAGCAGGAGCAGCTCC	943	0	UF_Msa_AF_108861	contig10360___1_nr0nt	contig10360___1_nr0nt	Unknown	
899	11	79	unmapped	0		0	ACTTAATATAAAATATAGATATCTGTAACATGGGGACGTTACAGCGCCGCCGCCTGGCAG	945	0	UF_Msa_CF_124722	contig23524___0	contig23524___0	Unknown	
900	11	80	unmapped	0		0	AAGATGGATGAGAACCACTCTGATCATGAGACACCTAGAGCAGGATGTTGTCAGACTTTG	947	0	UF_Msa_CF_122881	contig26357___0	contig26357___0	Unknown	
901	11	81	unmapped	0		0	GGGATTTTACGATGCTATTAGCTAAAAGGATTTTTGCCATATTAGCCGAAGATACTCTTT	949	0	UF_Msa_AD_200129	AF006491_rc	AF006491_rc	Unknown	
902	11	82	unmapped	0		0	CTTACACTCAGGAAAGGAGAACATGGATTGTCCTTGAACACTATTCCACTGGACATTTCC	951	0	UF_Msa_CF_125435	contig09572___0rc	contig09572___0rc	Unknown	
903	12	1	unmapped	0		0	TTACTGACCGATCAGCATATCTCTTGGTCATGCAATGACCTTGTTAAAGTCTTTTTCTTT	793	0	UF_Msa_CF_125387	contig06086___0	contig06086___0	Unknown	
904	12	2	unmapped	0		0	TCTCGCCCTATCCCAGGACCAGATTAGTAAATATGCTGACAAAATCCTGCTGTACACCAA	795	0	UF_Msa_AF_108093	contig32733___1rc_nrnt	contig32733___1rc_nrnt	Unknown	
905	12	3		1028	E1A	0		42	1	(+)E1A_r60_n11	E1A_r60_n11	E1A_r60_n11		CONTROL
906	12	4	unmapped	0		0	AAAGACAGTGGAGGTCCGTTTGTTTTGCCTATGTTGGCTGAAGGCATGGAGCCTTATTAT	798	0	UF_Msa_AF_102179	contig08119___1_nrnt	contig08119___1_nrnt	Unknown	
907	12	5		1028	E1A	0		571	1	(+)E1A_r60_a107	E1A_r60_a107	E1A_r60_a107		CONTROL
908	12	6	unmapped	0		0	TAAAATTGAACAGGCAATGGACCTGGTGAAAAGCCATCTGATGTATGCAGTGCGTGAGGA	801	0	UF_Msa_AF_106907	LMB_S454.285.C1___1_nrnt	LMB_S454.285.C1___1_nrnt	Unknown	
909	12	7	unmapped	0		0	ATGATTTTTACAGTGCCGAGGGGTCCTAAAACCCTACTGTGTGGAAGATGAAGAGCAAAA	803	0	UF_Msa_CF_120183	contig02128___0	contig02128___0	Unknown	
910	12	8	unmapped	0		0	AGAAGCATCCTGTGATACCAAAACCTCAAAATGGTGAGCTGCGGAAAAAGGAGGCTAAAG	805	0	UF_Msa_CF_125955	contig29984___0rc	contig29984___0rc	Unknown	
911	12	9	unmapped	0		0	ATGGACGGAGGTCAGATTGACGGACAGGAAATCACTGCATCTGCCGTGCTGACTCAACGG	807	0	UF_Msa_AF_106984	contig05324___1_nrnt	contig05324___1_nrnt	Unknown	
912	12	10	unmapped	0		0	CAAATTAAATGAGGATCTGGTTAATAAGAAGACCAAGTTCTTCGGTGGTGATTCCATCAC	809	0	UF_Msa_AF_109988	contig15491___1_nrnt-1	contig15491___1_nrnt-1	Unknown	
913	12	11	unmapped	0		0	CAGTTGCCACTACACATATTCAATCCAAACAGCTGTGTGAAAAATACTGAAGAAGATGGT	811	0	UF_Msa_CF_124023	contig12804___0rc	contig12804___0rc	Unknown	
914	12	12	unmapped	0		0	TCAGTGTTAAAAGACCAGTGCCTCCTCCACCCAGTTTGGAGAACATGTACAAAGAACTCA	813	0	UF_Msa_AF_108180	contig15117___1rc_nrnt	contig15117___1rc_nrnt	Unknown	
915	12	13	unmapped	0		0	TTCCAGCATCTTAGCAGAGCAGCAGCTGCACTTCTCCCTGCGTCTCATGACAGAGGACTG	815	0	UF_Msa_AF_110046	LMB_S454.sd.600.C1___1rc_nrnt-1	LMB_S454.sd.600.C1___1rc_nrnt-1	Unknown	
916	12	14	unmapped	0		0	ACTCGAGCAAGCATGGCATCCCGGACACTGGCGAAAGGACTTTGGGGGCTACGGCACTCA	817	0	UF_Msa_CF_125957	contig32261___0	contig32261___0	Unknown	
917	12	15	unmapped	0		0	GTGGATGTAAAGGGACAGACAACAGGCGACTTTCAAACAATTAGGTTTTATTTAATTTAC	819	0	UF_Msa_AF_102767	contig01579___1rc_nr1nt0	contig01579___1rc_nr1nt0	Unknown	
918	12	16	unmapped	0		0	TCTTCAAATAAAAACCATGGACCTCTCTGACCTGCCCTATTCCTGAGTGCTAATGTCCTG	821	0	UF_Msa_AF_105207	contig32280___1_nrnt	contig32280___1_nrnt	Unknown	
919	12	17	unmapped	0		0	TGATGTGGAGAGAGTCCAAAATACAACAGGTGAGTAATCCAACAGAGCAGCTCGGAGAAA	823	0	UF_Msa_CF_121809	contig16414___0rc	contig16414___0rc	Unknown	
920	12	18	unmapped	0		0	TGAACCTGCTGTCAGACTAACTTACTCCGAAGTTCCTCCAGAAACACAGACCCGCCTGTC	825	0	UF_Msa_CF_125843	LMB_S454.172.C1___0rc	LMB_S454.172.C1___0rc	Unknown	
921	12	19	unmapped	0		0	ACAGGCAAAAGACTTTTTAGAGGAAATGGAGGGGTGGTTTTAAGGGAGTGCAAGGTTTAA	827	0	UF_Msa_CF_127073	contig02890___0rc	contig02890___0rc	Unknown	
922	12	20	unmapped	0		0	TTTTAGATTTGGTGGAGGGGGAGGGTGTGGTGTTTGCAAATCCATAAGTTGTTTTTATGA	829	0	UF_Msa_CF_126249	contig31514___0rc	contig31514___0rc	Unknown	
923	12	21	unmapped	0		0	TATTAAATGCACAGGTATTCCTACTCTTGGGAAGAATGTTGTGGTCGCAGGACGCTCCAA	831	0	UF_Msa_AF_101534	contig02650___1_nrnt	contig02650___1_nrnt	Unknown	
924	12	22		1028	E1A	0		571	1	(+)E1A_r60_a107	E1A_r60_a107	E1A_r60_a107		CONTROL
925	12	23	unmapped	0		0	AGCATCTAAGGCCCGTATTGCTAAGTATGAGAAAGAGTTGGATAAGTTTAAGAACATGAT	834	0	UF_Msa_CF_122793	contig15850___0	contig15850___0	Unknown	
926	12	24	unmapped	0		0	AAATGTCTGACTCAAGGCCGTCCCTGCAGTGGAGGAGGTCCTGTTCCTTACTCTCACGCT	836	0	UF_Msa_CF_124669	contig08788___0	contig08788___0	Unknown	
927	12	25	unmapped	0		0	GACTTCTTTGCCAGATATGGTGCTGTAAAGAAAGTAAAAATTATCACGTACCGTGGAGGG	838	0	UF_Msa_AF_107613	contig01882___1rc_nrnt-1	contig01882___1rc_nrnt-1	Unknown	
928	12	26	unmapped	0		0	GAGATGTGGGGTGTTCTGCTGGAAGAGGTGCAGGAGGAGGCAGTGGTGTCGGAGTGGAGT	840	0	UF_Msa_CF_122456	contig09185___0	contig09185___0	Unknown	
929	12	27	unmapped	0		0	AAACGCTCCCTCATCGACAGCGGCTGTCCGCTCTCAATTGTGAACGACCTGATCGAGAAC	842	0	UF_Msa_AF_106897	contig02203___1rc_nrnt0	contig02203___1rc_nrnt0	Unknown	
930	12	28	unmapped	0		0	AATTCCCTACCTGAGAAAAGGCATGTTCTGGTAAGACCAACACGTACTCTGGTGGAGTTT	844	0	UF_Msa_AF_100966	contig16714___1_nr0nt	contig16714___1_nr0nt	Unknown	
931	12	29	unmapped	0		0	ACAGATTCCCTTTCTTACACCTGAGATCCACCGGACCGCCAGCTCTCTTACGTGCATGGA	846	0	UF_Msa_CF_125812	contig11979___0	contig11979___0	Unknown	
932	12	30	unmapped	0		0	CAGCTTCTTTACCCTGTGGAGGCGCCAGGTCAAGACCGAGTGGGGCCATCAGTGAGGACA	848	0	UF_Msa_AF_106953	contig12164___1rc_nrnt0	contig12164___1rc_nrnt0	Unknown	
933	12	31	unmapped	0		0	CATCAACGACAACAGAGGGAACCGTGAGAGCTCCAGCAGGGCATCTAGCAGTCGTCAAAG	850	0	UF_Msa_CF_120189	LMB_S454.755.C1___0	LMB_S454.755.C1___0	Unknown	
934	12	32	unmapped	0		0	GCAGGACCTCTGGCAGTGGCTTCACCAGTTGCACGCCGAGAAGTTTGAGCTGGCTGAAAA	852	0	UF_Msa_AF_107271	contig11737___1rc_nrnt	contig11737___1rc_nrnt	Unknown	
935	12	33	unmapped	0		0	ACATCTCCTTCTGGCAGATGAACACCAGTCTGCTGGGCAGCATTGGGATGCTGAACTCGG	854	0	UF_Msa_AF_105419	contig08597___1rc_nrnt	contig08597___1rc_nrnt	Unknown	
936	12	34	unmapped	0		0	TGCAAGGAACCTGGATGTGACACTGGACGACCATCTGTGCTTCTCTGCCAACATCGCAGG	856	0	UF_Msa_CF_119819	contig04544___0rc	contig04544___0rc	Unknown	
937	12	35	unmapped	0		0	TTCAATTTGATTCGTCTCACTTCACCTCCACAGTTTCTAACGGCTGCTGCAGACTGGAAA	858	0	UF_Msa_CF_125339	contig12346___0rc	contig12346___0rc	Unknown	
938	12	36	unmapped	0		0	AACCAGCTCACCAGAAATCATCATCATCATCTTCATCCTTGTGTGAATATGCTGCAATAC	860	0	UF_Msa_CF_127113	contig03446___0rc	contig03446___0rc	Unknown	
939	12	37	unmapped	0		0	GGCATTTATGTAAAACAATAGCACCTAATGTATTAAGTTGCATGTGACAGCAGAAGTGTT	862	0	UF_Msa_CF_127660	LMB_S454.sd.30.C1___0	LMB_S454.sd.30.C1___0	Unknown	
940	12	38	unmapped	0		0	CAAGAACTTTCTAATAGAATTATCTTTGACGACAGTTGAGCCAACATATGATTTCTACCC	864	0	UF_Msa_CF_121735	contig17402___0rc	contig17402___0rc	Unknown	
941	12	39	unmapped	0		0	GGTGGGTCTAAGATGAGTAAAAGATGTGTTAATGCCCTGATTTCATTTATAAATGCAGTT	866	0	UF_Msa_AF_103275	contig00800___1_nrnt	contig00800___1_nrnt	Unknown	
942	12	40	unmapped	0		0	CTGTTTGTTGTGAAAGGCTTGAGAATCACTGCGGCACCTGAAGAGGACAGAAAGTTCAGA	868	0	UF_Msa_CF_124800	contig27685___0	contig27685___0	Unknown	
943	12	41	unmapped	0		0	TGTGAAGCCTCGTGAAGCGGGAATTGACAGACAGCCCACTGTCATGGACTGGGGTCAGAA	870	0	UF_Msa_CF_119806	contig08289___0	contig08289___0	Unknown	
944	12	42	unmapped	0		0	TCCAGGTGCCAGGCCAGTCGCACTGGTTCAAAGAGCCAGATCCAAAGATGGAGACGCAGT	872	0	UF_Msa_AF_101248	contig14226___1rc_nrnt0	contig14226___1rc_nrnt0	Unknown	
945	12	43	unmapped	0		0	GGTATTTATGATGAAATGTACCAACTGTTAAGACCATAGCAGGATACTGGCATTGTGCTT	874	0	UF_Msa_AF_101644	LMB_S454.1082.C1___1_nrnt	LMB_S454.1082.C1___1_nrnt	Unknown	
946	12	44	unmapped	0		0	AAATGTGGCACGCTGCCTTCCTGTTATTGGTTGCCAGCTTGTCAGTGAGCCTGGCCAGAC	876	0	UF_Msa_AF_107259	contig31996___1rc_nr0nt1	contig31996___1rc_nr0nt1	Unknown	
947	12	45	unmapped	0		0	AGCTTTGCGAGTGACCCAACTGAGTCTGTCGTCGCCGTCTGCTCTGCATTCAAACAGTCC	878	0	UF_Msa_CF_120755	contig27821___0rc	contig27821___0rc	Unknown	
948	12	46	unmapped	0		0	GCATCAGCTGCACCGAGACAGAGGAGCTGGACCGCCAGAAGGAGGACCGCTGCCTGCAGA	880	0	UF_Msa_CF_121763	contig00496___0	contig00496___0	Unknown	
949	12	47	unmapped	0		0	AAACTGAATAAACCCGTTTCATCAACTATTCCGACGTGGCAACAAGCACAGAAGCCGCTA	882	0	UF_Msa_CF_123948	contig10390___0rc	contig10390___0rc	Unknown	
950	12	48	unmapped	0		0	GTAAACACCCGAGAATGCCCCCCGATAACGCACCTAATATTATGCTGCTATTTAAACAAC	884	0	UF_Msa_CF_120148	contig09048___0	contig09048___0	Unknown	
951	12	49	unmapped	0		0	AGCTTTGGGCAAAGCAACCTGTCCCAACCACTCCTCTTCTTGACACAGCATTGGGCCGCT	886	0	UF_Msa_CF_123486	contig28148___0rc	contig28148___0rc	Unknown	
952	12	50	unmapped	0		0	GCTTTGCAGTATCTCTCTATGACTGAATCAATGCATAGAGCTGAATTCAAAATTGGTTGT	888	0	UF_Msa_AF_100414	contig06779___1_nr0nt	contig06779___1_nr0nt	Unknown	
953	12	51	unmapped	0		0	CAGTCAGACCAAAGTGGAAAACAAAAGCGTTACAACAACAAAGATTCTGTTTTATCCTAA	890	0	UF_Msa_CF_117738	contig26364___0rc	contig26364___0rc	Unknown	
954	12	52	unmapped	0		0	TGATCTACAGCATCTGCTTCCACCTCTACCAATGCTACCCTTCCAGCACCATGATGGTGG	892	0	UF_Msa_AF_109676	contig23090___1rc_nrnt0	contig23090___1rc_nrnt0	Unknown	
955	12	53	unmapped	0		0	ATTTAGCAGGCCCAAATGTGGAAGCTAGATTAAGTCCCAACCATAGACCCAACAGTCAGA	894	0	UF_Msa_CF_122996	contig09821___0	contig09821___0	Unknown	
956	12	54		0		0		896	1	RC3	RC3	RC3		CONTROL
957	12	55	unmapped	0		0	TAATGGAGACTGGGCCTATGAGGTGAAATATATTGAAGGATGTCCAGTGGGTGTCACCTA	898	0	UF_Msa_AD_200189	LMB_Add_6	LMB_Add_6	Unknown	
958	12	56	unmapped	0		0	TAGAACATGGCTGACGTGACAGCGGTGGACGGAGAGAAACTCAGCAAAAATGAGCTGAAG	900	0	UF_Msa_AF_105471	contig06394___1rc_nr0nt	contig06394___1rc_nr0nt	Unknown	
959	12	57	unmapped	0		0	GAGAACACCATCAAAGCATCCATTAGTCCTACTATGGCTGGCATTTACTTCCAGAAGAGG	902	0	UF_Msa_CF_125349	contig01911___0	contig01911___0	Unknown	
960	12	58	unmapped	0		0	CAGCCTGCAGAGCCACGAGACCCCGCCTCCTCTCAGGAACCACGACAACCAGGGAAAAAA	904	0	UF_Msa_AF_108412	contig00113___1_nrnt	contig00113___1_nrnt	Unknown	
961	12	59	unmapped	0		0	CAGATGGTTAATCTGAGCAGCTAGCAGATAACCTTGTCGTATCTAAACACAAGAAATACC	906	0	UF_Msa_CF_124430	contig12711___0rc	contig12711___0rc	Unknown	
962	12	60	unmapped	0		0	GATATTTGAAAGTCCTCAGCTCTCTTTCGAGATCTGCCGCTGCTTTTTCCAGAAACCCCG	908	0	UF_Msa_AF_102732	contig20611___1_nr0nt1	contig20611___1_nr0nt1	Unknown	
963	12	61	unmapped	0		0	TGGAGAAGTGTTTTAGCGAGTGGCTCAAGGAAACCAAAGCTAAACTGTAGCTTATTTTCT	910	0	UF_Msa_AF_104389	contig04312___1_nrnt0	contig04312___1_nrnt0	Unknown	
964	12	62	unmapped	0		0	GTCTTGTTTGTAGAAAATCGTTTGTCACTGATTGCACTGTTTGTCCTGAAAACTTGAAAA	912	0	UF_Msa_CF_119883	contig27460___0	contig27460___0	Unknown	
965	12	63	unmapped	0		0	ACTACGGCTACCAGGGAAAAGCTCTGCCTCCTTTCCCACGCTTCCTGGCTGGCTCACTGG	914	0	UF_Msa_AF_105968	contig07725___1_nrnt0	contig07725___1_nrnt0	Unknown	
966	12	64	unmapped	0		0	GTGACAGTGATGTGTCTTGCCTGATGACCGCCATGACCTTTCTGACACTCTGTGTGTCAA	916	0	UF_Msa_CF_125647	contig13536___0rc	contig13536___0rc	Unknown	
967	12	65	unmapped	0		0	CTACCAGTAACAAAATTTGACTTAACTTTCCAATTACCATCGGTGACAAGACTGAAATAC	918	0	UF_Msa_AF_105610	contig00945___1rc_nr0nt1	contig00945___1rc_nr0nt1	Unknown	
968	12	66	unmapped	0		0	CTAACTAAACCAAACACATTACGCAGCAGCAGTTACAGGTACTTTACGCCTCTTTATCTT	920	0	UF_Msa_AF_105169	contig32518___1_nrnt	contig32518___1_nrnt	Unknown	
969	12	67	unmapped	0		0	TTTCTTCAAGGAACTGATCAGCTATATGAGCTCTGGACCAATCGTAGCAATGGTGTGGGA	922	0	UF_Msa_AF_105888	contig16008___1_nrnt	contig16008___1_nrnt	Unknown	
970	12	68	unmapped	0		0	CACCGCACTCCAGTAAAGCTGTGCATGAGTTAGTCGAGCTGTTCCAGGTGGAATTGGCAG	924	0	UF_Msa_CF_127047	contig04415___0rc	contig04415___0rc	Unknown	
971	12	69	unmapped	0		0	AATAAGTTGCTGTTGAGTCCGTTTGTTCTCGTTGCTGCAACATGTCGTCTGTGGAAGTTC	926	0	UF_Msa_AF_103808	contig27287___1_nrnt	contig27287___1_nrnt	Unknown	
972	12	70	unmapped	0		0	AGGCACGTTCAGCGGCGCGCTCACCCCAGGAGGAAATAAACTCGTAGTGGACATCAAAAA	928	0	UF_Msa_CF_126567	contig02604___0	contig02604___0	Unknown	
973	12	71	unmapped	0		0	GGAAATCCTCACCAATTACGTCCGGAAGAACCTTTGACAGATCCACTAAGGTCCTGGACC	930	0	UF_Msa_AF_107029	contig19049___1rc_nrnt-1	contig19049___1rc_nrnt-1	Unknown	
974	12	72	unmapped	0		0	CACAGAATCATCAAGAAGTTCATGATCCAAGGAGGTGACTTCTCCAACCATAATGGCACT	932	0	UF_Msa_AF_103458	contig31168___1rc_nrnt	contig31168___1rc_nrnt	Unknown	
975	12	73	unmapped	0		0	TATTTCGGAAAGTTTGGAAACCTCTACAACGCCGAGGCTATAACTGCAAATCCACAGGTC	934	0	UF_Msa_AF_104905	LMB_S454.sd.531.C1___1_nrnt	LMB_S454.sd.531.C1___1_nrnt	Unknown	
976	12	74	unmapped	0		0	TTACTCTGCGTCATTTTCTGCCTTTATTCGTGTTCCTGTCCGCAAAAGCAGAATCACGCT	936	0	UF_Msa_CF_123872	contig16261___0rc	contig16261___0rc	Unknown	
977	12	75	unmapped	0		0	ACTCCGTTGGAGTCCAAACATCTCTATCTCTCCATTTAATCACAAAGTCCTGGTGCAGCT	938	0	UF_Msa_CF_119487	contig22234___0rc	contig22234___0rc	Unknown	
978	12	76	unmapped	0		0	TATCTCAAGTACCTAACGAAGAAGTACCTGAAGAAGAACAACCTCCGTGACTGGCTGAGA	940	0	UF_Msa_AF_108547	contig06529___1_nrnt	contig06529___1_nrnt	Unknown	
979	12	77	unmapped	0		0	AATATTTCGCTCCTTCCGCGATGGCAGAACAAAACAGCAACGTACAGATATCAAGAGCTG	942	0	UF_Msa_AF_109500	contig26332___1rc_nr0nt	contig26332___1rc_nr0nt	Unknown	
980	12	78	unmapped	0		0	TGCTCCGCTGCAAAACACCCCGTGAGTTATCAGTCCTGTCCCTCTCAGCAGCACCGCAGC	944	0	UF_Msa_CF_122184	contig19962___0rc	contig19962___0rc	Unknown	
981	12	79	unmapped	0		0	GAAGGATGCCAATCCCTGCTGCAAAGAAGGCGTTTGAGAAGTTGGTCGACTCTCAGGGCC	946	0	UF_Msa_AF_106199	contig13916___1rc_nrnt	contig13916___1rc_nrnt	Unknown	
982	12	80	unmapped	0		0	GGCTGCAGACACATACCTGGTCCAGGTGTATAACCTCACCCTGCTGTGTTCAGAGGAGTA	948	0	UF_Msa_CF_118742	contig16048___0	contig16048___0	Unknown	
983	12	81	unmapped	0		0	GTCAACATATAGATATGAGTTCTGTCCATTTCACAACATTACACAACATGAGCAGTCATT	950	0	UF_Msa_AF_103321	contig04507___1rc_nrnt0	contig04507___1rc_nrnt0	Unknown	
984	12	82	unmapped	0		0	CGGTAATTTGGTAAACTGCGGTAAATTTGTAAACAGTCATTTTACCAATAGCCCAATGCG	952	0	UF_Msa_CF_123473	LMB_S454.sd.367.C1___0	LMB_S454.sd.367.C1___0	Unknown	
985	13	1	unmapped	0		0	AGATCTCAAGGAAAACCAGGAACCCTACTTTCAATGAGATGCTGGTGTACAGTGGCTACA	953	0	UF_Msa_AF_105890	contig26809___1_nrnt	contig26809___1_nrnt	Unknown	
986	13	2	unmapped	0		0	GCCTGGACAACAACATTTACATGCATACTGTACATACATGGTAGTTTTATAAATACACCA	955	0	UF_Msa_CF_126034	contig12232___0rc	contig12232___0rc	Unknown	
987	13	3	unmapped	0		0	AAGTGTGTGAAGTGTTTTGTCCCTGTGCTTGCACCTCAGGGAGACCCCTGCTCTCCAGGT	957	0	UF_Msa_CF_127825	contig12415___0rc	contig12415___0rc	Unknown	
988	13	4	unmapped	0		0	TGCAGCTCGAACCAGCACCAAACCTCATTTACAAAAAGTGTGTTTTTAGGTTTCCCCTCT	959	0	UF_Msa_CF_120925	contig25957___0	contig25957___0	Unknown	
989	13	5	unmapped	0		0	TTTCAGGATCAAATCCATTCTGACCCGCCACATGAAGACACATACGGGAGAGAAACCTTA	961	0	UF_Msa_AF_105867	contig04785___1_nrnt0	contig04785___1_nrnt0	Unknown	
990	13	6	unmapped	0		0	AGATGCCAATGAAAGTGTCACTGTTTGGCTTCAAACCCTTATGGATAAGTCCTGACCCCA	963	0	UF_Msa_CF_124385	contig03949___0rc	contig03949___0rc	Unknown	
991	13	7	unmapped	0		0	TACACCAGCCTGGGGGACCCTGAAGATGCACAAAAAATTCGCTCACACACTCTGCCCTGC	965	0	UF_Msa_AF_109046	contig29557___1_nrnt	contig29557___1_nrnt	Unknown	
992	13	8	unmapped	0		0	CATGCAGGTGCAAAGAAAAAGAAGTAAAATATCCATTTCCCATGTCGGGAAAAAGGAATA	967	0	UF_Msa_AF_100939	LMB_S454.sd.284.C1___1_nr0nt1	LMB_S454.sd.284.C1___1_nr0nt1	Unknown	
993	13	9	unmapped	0		0	ACTGCTCCAGCTCATCAGCCCGCCCACTTCGCAAAAAGCAGAGCAATGTTGTTTTGCACC	969	0	UF_Msa_CF_126282	contig21496___0rc	contig21496___0rc	Unknown	
994	13	10	unmapped	0		0	AATCAATTACTGAGCTTGGAGGACATGGTCATGTATTTGGAGCGGGCGGAGGTTTTGAAA	971	0	UF_Msa_AD_200263	LMB_Add_93	LMB_Add_93	Unknown	
995	13	11	unmapped	0		0	GCAGACACGGAGACAGGAGCGGGCACCGGGACAGGAGATGAAGCTGGAGATCCGATCTCA	973	0	UF_Msa_CF_124048	contig25951___0	contig25951___0	Unknown	
996	13	12	unmapped	0		0	TCCTGCCTAGCTCAACATGACCGAGTTAGCCCATGCTAAGGAGCTAATGCTACATAGACT	975	0	UF_Msa_CF_120928	contig06386___0rc	contig06386___0rc	Unknown	
997	13	13	unmapped	0		0	ATACAACTACACGGATGTTTTGTTGCTCAGTCAGTTCATCAGGTCAGATGGGGGGTTGTT	977	0	UF_Msa_AF_101824	contig29650___1rc_nrnt	contig29650___1rc_nrnt	Unknown	
998	13	14	unmapped	0		0	TTCTTTGCTACGCCGGAGGAGAATAAGGAGTGTGCAGCGCTGCTCTATGCAGGGATGGAA	979	0	UF_Msa_CF_119263	contig14762___0rc	contig14762___0rc	Unknown	
999	13	15	unmapped	0		0	AGGCTCCCGGCGGTCTGAGGACGGACTAGGTGGACCGGAGAAGTTTCAGCAGCCTGAAAA	981	0	UF_Msa_CF_121220	contig10802___0rc	contig10802___0rc	Unknown	
1000	13	16	unmapped	0		0	TCCGGTTCAGATTTGGGCACTGGAAAATATCAGATTTTATGTGACCTGGACTGTTCACAC	983	0	UF_Msa_CF_126624	contig16091___0	contig16091___0	Unknown	
1001	13	17	unmapped	0		0	AATTCATACCCAATGACCATTAGAAAATCATCTCACAAAGTAGCTTCCAGCCCCTTTCAT	985	0	UF_Msa_CF_123035	contig08794___0	contig08794___0	Unknown	
1002	13	18	unmapped	0		0	TTTCCTCCTCACTTTGGGTTTCTTGACCGGCCGGAGGTACGGGTTGTCGATCACGTTGTC	987	0	UF_Msa_AF_104960	contig32419___1_nr0nt1	contig32419___1_nr0nt1	Unknown	
1003	13	19	unmapped	0		0	AGCCACTGTGAACATGATTAACAAAATGTATCCCGCCAGCAAAAGTTTTCCCTTCATAAT	989	0	UF_Msa_CF_118610	contig31882___0rc	contig31882___0rc	Unknown	
1004	13	20	unmapped	0		0	GAAAAGCCTTTGGACTGTCACTAAACTGCTTCTTCTATAATTGCGCGCAGCACAGAGAAC	991	0	UF_Msa_CF_118598	contig15907___0	contig15907___0	Unknown	
1005	13	21	unmapped	0		0	ATGATATCCACACACTGTACTCTGGAAAGACGGTGGAGATCAACAACACTGATGCAGAAG	993	0	UF_Msa_AF_106938	contig30947___1_nrnt	contig30947___1_nrnt	Unknown	
1006	13	22	unmapped	0		0	TTGGTGAGCATGAGAGGATTGTGAATGCCCTGCTTACCCCTTCAGTACTTGGATCAGTGG	995	0	UF_Msa_CF_124304	contig19182___0rc	contig19182___0rc	Unknown	
1007	13	23	unmapped	0		0	CAGTGCAATGGCCGCCCTTATTCTCATGACGACATCCATCTTGTCTGTGGTGGGTTCGCT	997	0	UF_Msa_AF_107220	contig10800___1_nrnt	contig10800___1_nrnt	Unknown	
1008	13	24	unmapped	0		0	CTCACTGAATCTTACATTCTCCTGCTGCGACGATAGGACCCTTTTTTGTATTCCTGTTTT	999	0	UF_Msa_CF_127622	contig22350___0rc	contig22350___0rc	Unknown	
1009	13	25	unmapped	0		0	GTCATTTGTTGATCAAAATGCAGGTCTGTGCACCAATGTCAATGGCATTAATAAAAATCT	1001	0	UF_Msa_AF_101668	contig10158___1_nrnt	contig10158___1_nrnt	Unknown	
1010	13	26	unmapped	0		0	ACTCTGTCACACAGAATTCACTATTGAAAGACGACCACAACCACTCACTCAGTGGCTGAA	1003	0	UF_Msa_AF_100889	contig00535___1_nrnt	contig00535___1_nrnt	Unknown	
1011	13	27	unmapped	0		0	TCATGGAAAACTGGAAGAAGATCGTTTTCTGTTCTCATTGGAAAACGACTCGGCAGCGTG	1005	0	UF_Msa_CF_120420	contig19211___0rc	contig19211___0rc	Unknown	
1012	13	28	unmapped	0		0	ATGGACTCTGATTGACTTCTACGACAATCAACCCTGCATCAACCTCATAGAGGCCAAGAT	1007	0	UF_Msa_AF_106527	contig02864___1_nrnt	contig02864___1_nrnt	Unknown	
1013	13	29	unmapped	0		0	TGCATTTTCTCTTCAGTTAACCTCTTGAAGGAGACAATGTGACTGTGCAGAAGGTGAAGG	1009	0	UF_Msa_CF_124857	contig23737___0	contig23737___0	Unknown	
1014	13	30	unmapped	0		0	TCTGGCTGCTGATGGCCAACACGGACGACAAGGTCATGATGACTATCAGCTGCCTGTCAG	1011	0	UF_Msa_AF_102022	contig16879___1rc_nrnt	contig16879___1rc_nrnt	Unknown	
1015	13	31	unmapped	0		0	GTGTCAAGATTCAGTTACTGAGCAGTAGCTCTGTCGCTGTCTCCACGTCCCAGGATTTCG	1012	0	UF_Msa_CF_120496	contig04798___0	contig04798___0	Unknown	
1016	13	32	unmapped	0		0	AACCCTAAATCCAAAAGGCCCAACAAAGAAGGCAGAACATCCACAGGAAACACTTGGGAA	1014	0	UF_Msa_CF_118792	contig17879___0	contig17879___0	Unknown	
1017	13	33	unmapped	0		0	TAGGAGTGGTCACAGGTTTGGAGAAGTTTGTCAAAGACTGTTTTCGTTTCCGTTTTTTAT	1016	0	UF_Msa_AF_105841	contig30794___1rc_nrnt0	contig30794___1rc_nrnt0	Unknown	
1018	13	34	unmapped	0		0	TGACGACGATGATGACGAAAGTGAAGAGGTGGAGAAGGAAGAGCAAGATAGTGAAGATTT	1018	0	UF_Msa_CF_120486	contig13744___0	contig13744___0	Unknown	
1019	13	35	unmapped	0		0	AGAAAATCAAGGAGAAGTACATTGATCAGGAGGAGCTGAACAAGACCAAGCCCATCTGGA	1020	0	UF_Msa_AF_108954	contig04465___1rc_nrnt	contig04465___1rc_nrnt	Unknown	
1020	13	36	unmapped	0		0	TGGCCAACCTAAATGCCAGTCGAACTGAAGATAATCCAAAGAGAACAGTGAATGAGTAAA	1022	0	UF_Msa_CF_120419	contig03523___0	contig03523___0	Unknown	
1021	13	37	unmapped	0		0	AAATGAACTTTCATCTGAGGAAATGGCACACATTGAGGGGAAGGATAACAGCCCGGTATC	1024	0	UF_Msa_AF_105583	contig07580___1rc_nrnt	contig07580___1rc_nrnt	Unknown	
1022	13	38	unmapped	0		0	CATGAACGGGTTTCTAGGAGTTTACGTAAGTGACATAAAGGGGGAAAGAACAAAGGAACA	1026	0	UF_Msa_CF_126099	contig25352___0rc	contig25352___0rc	Unknown	
1023	13	39	unmapped	0		0	GGCCACAAACAATCCTGTTTCTGCCAACAAACCAGAGAAAAATCAAACATCTACTGTCTC	1028	0	UF_Msa_CF_119803	contig32489___0	contig32489___0	Unknown	
1024	13	40	unmapped	0		0	CCCAATTCTACCTCTGCGTAATCTGTCACTGTGATTATTTCAACTGCTACGTCATCTACG	1030	0	UF_Msa_CF_118044	contig20844___0rc	contig20844___0rc	Unknown	
1025	13	41	unmapped	0		0	CGTTCAGAAAGTCAAATTATCATTTCATGTTCACACCTGATGTTGTGCTGCGCCGCCACA	1032	0	UF_Msa_CF_120495	contig22160___0rc	contig22160___0rc	Unknown	
1026	13	42	unmapped	0		0	GAATTGTAGCACATGGCAAACATAAGAGCCAGTGTGACCACACCTCATTTTCAACAATGT	1034	0	UF_Msa_AF_104971	LMB_S454.sd.552.C1___1rc_nrnt	LMB_S454.sd.552.C1___1rc_nrnt	Unknown	
1027	13	43	unmapped	0		0	TTAAAAAGGTGGCGTTTTTATTTCAGTCACGCCGTCATAAAGCGTCGTAGTCGTCGTCGT	1036	0	UF_Msa_AD_200119	LMB_Add_82_rc	LMB_Add_82_rc	Unknown	
1028	13	44	unmapped	0		0	CTCTGTGGACACTAAAAACTCAAGTTGTATCCATTTTAAACCAGAACGGGATTAACTTTT	1038	0	UF_Msa_AF_107184	contig27374___1_nr0nt1	contig27374___1_nr0nt1	Unknown	
1029	13	45	unmapped	0		0	TGGAGCAACAGCCAATCGTAAGGGAGGCTGTGGAGGCCTGCCTGTCATAATTTACATGAC	1040	0	UF_Msa_CF_121772	contig08419___0	contig08419___0	Unknown	
1030	13	46	unmapped	0		0	AAGCAATGGCGTTAGATCTTTCACTGCATATGCTTAATCGACATGCTGCTGTCGAGTAGC	1042	0	UF_Msa_CF_124099	contig28085___0	contig28085___0	Unknown	
1031	13	47	unmapped	0		0	TTACCTGTTTGACTTTCTCTGCAAAGTCTCCCAGAGATGCACTGACAACTTGATGACCAG	1044	0	UF_Msa_AF_100332	contig30298___1rc_nr1nt0	contig30298___1rc_nr1nt0	Unknown	
1032	13	48	unmapped	0		0	AGGGAGCGACAGCAGAAGAACCATCCGACGGAGAGAAGGCGGCATCAGAGGAAGCTCCTG	1046	0	UF_Msa_CF_117956	contig25027___0	contig25027___0	Unknown	
1033	13	49	unmapped	0		0	GAGCTCCGAGCATGTGGCCGAGATTGTGGGCAGACAGGGTGCGTGTTTCAGTGTTTCTAC	1048	0	UF_Msa_AF_107700	contig15317___1_nrnt	contig15317___1_nrnt	Unknown	
1034	13	50	unmapped	0		0	CGTGACAAGCGTGCAACAGTTCTTCCAGCCATATTCACTTTATTACATAATTAATTCTTA	1050	0	UF_Msa_CF_124534	contig31441___0rc	contig31441___0rc	Unknown	
1035	13	51	unmapped	0		0	TTGAACTAAAGGCAGCGGTGGCTAAAGAACTGGGATTCAATATAACTAGCGAGTTCGTCG	1052	0	UF_Msa_CF_124004	contig09228___0rc	contig09228___0rc	Unknown	
1036	13	52	unmapped	0		0	AACTCAGCGCAGCAGTAGACCGCATTATTATGAACAGCAGTAAATTTAACTGAGTTGGAG	1054	0	UF_Msa_AF_104040	contig15599___1_nr0nt1	contig15599___1_nr0nt1	Unknown	
1037	13	53	unmapped	0		0	TCTGTGACGAAACTAGATTTGTCAAATACACTTGAGAATTAAAACCTAAATACCACAACG	1056	0	UF_Msa_AF_102433	contig17760___1rc_nr0nt	contig17760___1rc_nr0nt	Unknown	
1038	13	54	unmapped	0		0	AGCCCAGGGATCAAGAAGCACTGAGTACACAGAGGCAGGCAGGCACACACACACGACAGT	1058	0	UF_Msa_CF_125314	contig07235___0	contig07235___0	Unknown	
1039	13	55	unmapped	0		0	CAGTCTACTCGGCTAACAAAGCTAGCCCGTCATCAACAATACGCATGCGCGAGAACACTC	1060	0	UF_Msa_CF_119365	contig26931___0rc	contig26931___0rc	Unknown	
1040	13	56	unmapped	0		0	GCTGTACTGAGGCTTTTGACAGATGACTCTGCTTATAATCATTAATGTACAATGTCTAAA	1062	0	UF_Msa_AF_107072	LMB_S454.sd.536.C1___1_nrnt	LMB_S454.sd.536.C1___1_nrnt	Unknown	
1041	13	57	unmapped	0		0	CAGCAGACAACCCCTGCAGAGAAATCATCGGAGGCACAAATGAGAGTGATCACAGTGATA	1064	0	UF_Msa_CF_121958	contig09640___0rc	contig09640___0rc	Unknown	
1042	13	58	unmapped	0		0	CAACCTACACAGCACAGCCCTCCTCTGGGTCCATTTGCGCATGGCCGCTGACTCAGTACC	1066	0	UF_Msa_CF_122230	contig16827___0rc	contig16827___0rc	Unknown	
1043	13	59	unmapped	0		0	ATAACAGCAATAACCACCTTCACCTGTAAGAATGGGACCCACATTGCACACCTCGCTCAT	1068	0	UF_Msa_AF_109476	contig03108___1rc_nrnt0	contig03108___1rc_nrnt0	Unknown	
1044	13	60	unmapped	0		0	ATCTAGAAACCACTTCAAAAAGAAAAGGGGCCTCTCCTTCCCAGAGTACCTCAAGACACT	1070	0	UF_Msa_AF_100635	contig02412___1_nrnt0	contig02412___1_nrnt0	Unknown	
1045	13	61	unmapped	0		0	TTTGCTGACATTGCGCTAGCTCCCATGGAGGCTGTCAAAGTTCGTATCCAGACCCAGCCG	1072	0	UF_Msa_AF_106889	contig11850___1_nr0nt1	contig11850___1_nr0nt1	Unknown	
1046	13	62	unmapped	0		0	ATAAAGCTGCAGGTAACAAGGGAACGAGGCTCTTGGGATGCCCTATCTTTCCTAAAGAAA	1074	0	UF_Msa_CF_119580	contig16282___0	contig16282___0	Unknown	
1047	13	63	unmapped	0		0	TTTCTTGTGGACAGTCCAACAGGCAGTGGCCATCAGCAACAGCAAAAAACCCATGACAAG	1076	0	UF_Msa_CF_127441	contig10333___0	contig10333___0	Unknown	
1048	13	64	unmapped	0		0	TATTGCCTCTTCTTTACAGCCTGGTCCTCTTTGTCGGAGGCGGGGAGGCAAGTCGGATCT	1078	0	UF_Msa_CF_126502	contig15329___0rc	contig15329___0rc	Unknown	
1049	13	65	unmapped	0		0	TTACACCTGTCCACATATATGATACCTGTATCCTAATGGCACCGCCCTGACTTGACATAT	1080	0	UF_Msa_CF_119335	contig03003___0	contig03003___0	Unknown	
1050	13	66	unmapped	0		0	AAATATGGTGTGGGTACATGTGGTCCAAGAGGCTTCTATGGAACTTTCGATGTTCACCTG	1082	0	UF_Msa_AF_103675	contig16619___1_nrnt	contig16619___1_nrnt	Unknown	
1051	13	67	unmapped	0		0	GACCCACCTCGATCCTCCTATGTGGGTGTGACCATCAATGTCCTGGACGAGAATGATAAC	1084	0	UF_Msa_AF_109706	contig27340___1rc_nrnt	contig27340___1rc_nrnt	Unknown	
1052	13	68	unmapped	0		0	AACAGCACCACAGTTGGCTAACCCCCAAAAAATGTATTGCCCGGCGCTGGTGTGGTCCCT	1086	0	UF_Msa_CF_125709	contig04022___0	contig04022___0	Unknown	
1053	13	69	unmapped	0		0	GTACATGTTCTTGGCTGTAGAAATATTTGTCGTGGAACAGTCAGTGAATGTCTATATTTA	1088	0	UF_Msa_AF_101237	contig25081___1_nr0nt1	contig25081___1_nr0nt1	Unknown	
1054	13	70	unmapped	0		0	AAGAAAGCAAGAGAGGGAAGTTTTAGCTAGACGTATTGTGATGCTGAACTCGGAGGTGGA	1090	0	UF_Msa_AF_109915	contig05466___1rc_nrnt-1	contig05466___1rc_nrnt-1	Unknown	
1055	13	71	unmapped	0		0	CTGATTTAATCCAGTTTTGAGGCATCCTGGCCTTGGAGTGAAATTAAAGTGCATATAGAA	1092	0	UF_Msa_CF_121965	contig00926___0rc	contig00926___0rc	Unknown	
1056	13	72	unmapped	0		0	TGTTGGATCCGAAACCGTGGACCCGACAGATACTGGAAAGTTCAAGAAGTTCTCAAACAT	1094	0	UF_Msa_AF_108580	contig28246___1_nrnt	contig28246___1_nrnt	Unknown	
1057	13	73	unmapped	0		0	AGACTTGGATGATTGAAGAAGAGTACATTGCATGGATAGAACGATTATGGAGACAGAGGA	1096	0	UF_Msa_CF_125890	contig28926___0rc	contig28926___0rc	Unknown	
1058	13	74	unmapped	0		0	CTGCCTGGCTGCGTGGTGGAGGCCAGTATATTCATCCTCCTCGACATGATAGACGCAACT	1098	0	UF_Msa_CF_123231	contig00400___0rc	contig00400___0rc	Unknown	
1059	13	75	unmapped	0		0	GTCGGAGCAGAAATGTCTGAATGGAAGCGGCTCAGGAGGAGTTGGAGTTAAATCCAGCCG	1100	0	UF_Msa_CF_127300	contig23057___0	contig23057___0	Unknown	
1060	13	76	unmapped	0		0	TTTCTGTATCCAGCTGCCTCTGATCTAGCGGGACTTACTACTTCACTGAATTCTTCAACC	1101	0	UF_Msa_AF_109116	contig05581___1rc_nrnt	contig05581___1rc_nrnt	Unknown	
1061	13	77	unmapped	0		0	AGACACACTTTGCTCTCGGCCCGTAAAGTTCCTCTTAATAAACCTGCTGTGAAGGAAGAT	1103	0	UF_Msa_CF_119170	contig12442___0	contig12442___0	Unknown	
1062	13	78	unmapped	0		0	GATCGATCACAAGCTGCTGCTCTTGGCAACGCCGTGGTCATGGGCGCAGAGTTGGTTTCA	1105	0	UF_Msa_CF_126119	contig09255___0	contig09255___0	Unknown	
1063	13	79	unmapped	0		0	ATCTAAGAGACTCAACCCTAGTCAGAGAGCAAAAGGGAGCTTTTCTAGAGGGGAAAAACG	1107	0	UF_Msa_CF_121159	contig00413___0	contig00413___0	Unknown	
1064	13	80	unmapped	0		0	GCGTGGATGTGCCAGACTCCCTCTCATCTTCATCGCAACTTATTTCTACTTCTCCTGCTC	1109	0	UF_Msa_CF_124750	contig32387___0	contig32387___0	Unknown	
1065	13	81	unmapped	0		0	AAAGCCAGAAAAAGTTGTTCGTGTAGGCGTAGTGTCGCAGCTTTTCATTCACCCTCTCAA	1111	0	UF_Msa_CF_123387	contig32502___0	contig32502___0	Unknown	
1066	13	82	unmapped	0		0	TAAGTTTCAGATCATCAGTCTGGAGAATCAGTCGTCCACCGAGTCTGTGTTTCGGTTTGA	1113	0	UF_Msa_CF_127805	contig23303___0rc	contig23303___0rc	Unknown	
1067	14	1	unmapped	0		0	GAGATGTTTATATTTATGAATATTGTTGAATGGCTGTAGCATTCGTGCTGCCAAAACTTC	954	0	UF_Msa_CF_124037	contig23762___0	contig23762___0	Unknown	
1068	14	2	unmapped	0		0	GGTTTCATTACTCTTCTATGACAGCAAAGTGAATATGTTTGGGTTGTGGACAAAACAAGA	956	0	UF_Msa_AF_102136	contig10589___1_nr0nt	contig10589___1_nr0nt	Unknown	
1069	14	3	unmapped	0		0	ATTCCCCAGCTTCGACAGACTCTGGTAGAGTACGAGAATATTAGTAAGAAAGACTCTGCA	958	0	UF_Msa_AF_107757	contig11745___1_nrnt	contig11745___1_nrnt	Unknown	
1070	14	4	unmapped	0		0	ATTTATACACAGCATCAGGAAAAGCATGGAGCCACAGACAGACAAATCCCTGAGACGTGT	960	0	UF_Msa_CF_120501	contig23475___0rc	contig23475___0rc	Unknown	
1071	14	5	unmapped	0		0	TCGCTGAGAAGAGGCAGAGAGCGATGATCCAGACGATGCTAGAGCGCTGCGATCGCTTCC	962	0	UF_Msa_AF_103646	contig17941___1rc_nrnt-1	contig17941___1rc_nrnt-1	Unknown	
1072	14	6	unmapped	0		0	TGGGTGACACACACTCTGAATCTGATGGAGTAACAGACGATCACAAACACTTCTCTTCGT	964	0	UF_Msa_CF_119592	contig21844___0rc	contig21844___0rc	Unknown	
1073	14	7	unmapped	0		0	GTGGATTACCTGCCGAGTTCTCAGACTGTATGCGAGGTGGTGGCCTTGTCCAGCACTGTA	966	0	UF_Msa_CF_122376	contig01782___0rc	contig01782___0rc	Unknown	
1074	14	8	unmapped	0		0	GGTGTTCGGACAGTTACAGGTAGATGATGATCCACCAATGGCCTTTCATCAAGTGTTTAT	968	0	UF_Msa_AF_100756	contig29395___1rc_nrnt0	contig29395___1rc_nrnt0	Unknown	
1075	14	9	unmapped	0		0	TGGGGGATAGTACAGTGCTCAGAGTACCACAGGTGAGGCTCAAAGCAGCACCTGCATTGG	970	0	UF_Msa_AF_104461	contig32581___1rc_nrnt	contig32581___1rc_nrnt	Unknown	
1076	14	10	unmapped	0		0	TTGACCCTCAGCTGGACTCATGGACTCCCTCTGAGGAGTCGTTGCGGTCTCTGACCCGAG	972	0	UF_Msa_AF_107995	contig20289___1_nrnt	contig20289___1_nrnt	Unknown	
1077	14	11	unmapped	0		0	GTGGAGGTGTCTTTGATGACATCATCATGACAGGGTTTGGTTGATTTGCCTCATTGCTCA	974	0	UF_Msa_CF_118173	contig29487___0rc	contig29487___0rc	Unknown	
1078	14	12	unmapped	0		0	CCGGATGTGTCTTCACTATTATCTCTGTGTTTAATTTAAGACTACAAGCGGGATCACGGT	976	0	UF_Msa_AD_200359	LMB_Add_104_rc	LMB_Add_104_rc	Unknown	
1079	14	13	unmapped	0		0	ATCAATGTGTCGCGCTTTCTCAGCTGCAACACGAAGAATGCCTCTCTGCCGACCCCTGCT	978	0	UF_Msa_CF_125351	contig23803___0	contig23803___0	Unknown	
1080	14	14	unmapped	0		0	TGCTGTACACAGATTTAAGTTACTACACACCGAGTGTGCATCTTCACATCCGTGTGGACT	980	0	UF_Msa_CF_125219	contig26628___0	contig26628___0	Unknown	
1081	14	15	unmapped	0		0	ATTTATTGGGAGGTCACAAGGCCATCCCTATAAGGTTTTCCCTGGGTGAGCCAATCTTAA	982	0	UF_Msa_AF_103615	GP3-1E12.g___1_nr0nt1	GP3-1E12.g___1_nr0nt1	Unknown	
1082	14	16	unmapped	0		0	TCTTTTTTTCAGTTGGAGAATTTCTTTTGGTGGCAAAAACCCACATGGATATTTGTGGTT	984	0	UF_Msa_AF_104190	contig24893___1_nr0nt	contig24893___1_nr0nt	Unknown	
1083	14	17	unmapped	0		0	AGCTATGTTGGTGTTTTTATTCACGGCACAGTGACAGTATGGCCACCACAAAACTTCAGC	986	0	UF_Msa_CF_125667	contig04707___0rc	contig04707___0rc	Unknown	
1084	14	18	unmapped	0		0	CCTCTACTCCATTCGCAAATTTGCAGTCAAAGCTTAGAGGCTTTTTCTATTGATAAAATA	988	0	UF_Msa_AF_107079	contig31472___1_nrnt	contig31472___1_nrnt	Unknown	
1085	14	19	unmapped	0		0	ACAAGGACAACCTCTCGCAGCACGAAGATGATAACATCTCCACCACTAGCGGCTTCTCCT	990	0	UF_Msa_CF_121209	contig11037___0rc	contig11037___0rc	Unknown	
1086	14	20	unmapped	0		0	TGTTAGCCATAGGCACTTAACCCAAGTCCAAAACGCAAGTAACATTTGGTCAAATGTTTA	992	0	UF_Msa_CF_118925	contig04966___0rc	contig04966___0rc	Unknown	
1087	14	21	unmapped	0		0	TTATACATCCAGGTCACATGGTCAGGGACACCTGTACGACACGTCTCCTCAGCCGGTTGG	994	0	UF_Msa_AF_105246	contig01750___1rc_nr1nt0	contig01750___1rc_nr1nt0	Unknown	
1088	14	22	unmapped	0		0	GATCAATCTTCATTTTGAGTGTACTTTGCTGTTCCTCCATGAGGACATTTTAAACTGTAA	996	0	UF_Msa_AF_102199	contig05011___1_nr0nt	contig05011___1_nr0nt	Unknown	
1089	14	23	unmapped	0		0	GACTCGACCTACCCTCCAGCTCACGGACATACGGACATCTGCAAAGCGGGCTGGTGTAAG	998	0	UF_Msa_CF_124258	contig16166___0	contig16166___0	Unknown	
1090	14	24	unmapped	0		0	AATCATAATTCTACAAGGGTGTTATTTTCAGTTTAGTGGGGACGGGCTCGGTGCTTTGCG	1000	0	UF_Msa_AF_109428	contig27630___1_nr0nt	contig27630___1_nr0nt	Unknown	
1091	14	25	unmapped	0		0	GAAGGTGCTCTGTCTGGCTGTAGCTGTAGGACACGTCAAGATGACAGAGGATGAGCTTGT	1002	0	UF_Msa_AF_104252	contig06510___1_nrnt	contig06510___1_nrnt	Unknown	
1092	14	26	unmapped	0		0	GTCAGAGGAAACGTGGCACACTCACCAGTTTGACTTCATTAAGGGTCACGCTCACAGGCT	1004	0	UF_Msa_AF_103606	contig31063___1rc_nrnt	contig31063___1rc_nrnt	Unknown	
1093	14	27	unmapped	0		0	TTGAGAAGCAGTACATGCATCTGACAAAGACCTTAAAACACTTGAGTTATCCCCACCGCC	1006	0	UF_Msa_CF_121266	contig07504___0rc	contig07504___0rc	Unknown	
1094	14	28	unmapped	0		0	AGCTGCATGAGAACACCTGCAACATGTTTATCTCCAAGACTTAAAACAAATTAAAGTCAT	1008	0	UF_Msa_CF_118395	contig08074___0rc	contig08074___0rc	Unknown	
1095	14	29	unmapped	0		0	CGTCTCCAGGACATCACTGCAGGACTGAAAAAGGCGAGACAGCCAGAAATCAAGAAGTTT	1010	0	UF_Msa_CF_122862	contig17703___0rc	contig17703___0rc	Unknown	
1096	14	30		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
1097	14	31	unmapped	0		0	GCACGAGTTTGAGGTGGCGATGACATGCGAGGGATGCTCAGGAGCTGTTACCAGAGTCCT	1013	0	UF_Msa_AF_102099	contig10198___1_nr0nt1	contig10198___1_nr0nt1	Unknown	
1098	14	32	unmapped	0		0	CGCTCCTTCTACCGCTGTAGTGAAACTGAAAACCTGCTGGCATGGGTGACAAGTGGCTTT	1015	0	UF_Msa_AF_110289	contig04745___1_nrnt0	contig04745___1_nrnt0	Unknown	
1099	14	33	unmapped	0		0	ATCCATGTTGTGGAACCAACTCCAGCCAGTATCGCCTCACTGTACTGCGCTGCTTGCCTC	1017	0	UF_Msa_AF_102992	contig05041___1_nrnt0	contig05041___1_nrnt0	Unknown	
1100	14	34	unmapped	0		0	CTGATGGGCTCATGTTACTGGAGAACCACTGGCTGAAGCGGCTAGCCGATACAGGGCCCT	1019	0	UF_Msa_AF_100019	contig24421___1_nr0nt1	contig24421___1_nr0nt1	Unknown	
1101	14	35	unmapped	0		0	TACAACAGCAGTTTAGGTTGAGAAGAAGGAAGACTAGCGCTGATACCTGTTCATCAGAGG	1021	0	UF_Msa_CF_119573	contig04772___0rc	contig04772___0rc	Unknown	
1102	14	36	unmapped	0		0	AGATCAAAATTGGACTTCTTGTGTGTTCCAGGGGTTGTTGAAGTACTTGTGTTGCCGGTG	1023	0	UF_Msa_AF_104384	contig01570___1_nr0nt	contig01570___1_nr0nt	Unknown	
1103	14	37	unmapped	0		0	TTTGTTATATCAAGAATGGTCATCCAGATTTCTGCATGTTGAAATAAAGTTTTGAGAGAG	1025	0	UF_Msa_AF_106432	contig06716___1rc_nr0nt	contig06716___1rc_nr0nt	Unknown	
1104	14	38	unmapped	0		0	AATCCTGAGTCCCTCTGGACATATAGTTAAATGCTTTCATGATGTCCACCCCGACTATGA	1027	0	UF_Msa_AF_109017	contig22938___1rc_nrnt0	contig22938___1rc_nrnt0	Unknown	
1105	14	39	unmapped	0		0	CAGTTCAAGTGACAAGATCAATAAGAAAACAAACTACACGTAATCACTGCGTCATCTATA	1029	0	UF_Msa_CF_121788	contig28375___0rc	contig28375___0rc	Unknown	
1106	14	40	unmapped	0		0	GAAGATTAGCAACATCTTAACCTTTTCAACCCTCCCCTTATGTTTGTCCATGTACTTTTT	1031	0	UF_Msa_AF_109154	contig32616___1rc_nrnt	contig32616___1rc_nrnt	Unknown	
1107	14	41	unmapped	0		0	TGTGAGCTCCTCGGCCGGAACAATAGGGATCTTTGTGTCAACCCCTGGTAGTAGTAGTAG	1033	0	UF_Msa_AF_105157	contig00635___1_nr0nt1	contig00635___1_nr0nt1	Unknown	
1108	14	42	unmapped	0		0	ACAGAGAAAAGATAAGGAATAAACCATGAGAGGAAAATATCCAGAATGAGTGTAAAATGA	1035	0	UF_Msa_CF_118454	contig19525___0	contig19525___0	Unknown	
1109	14	43	unmapped	0		0	ACCTCCTTTTTATGCTGTGCTGTACGAAAGACACGGGAGAGAAGCAACTACATGAACATC	1037	0	UF_Msa_CF_122623	LMB_S454.482.C1___0rc	LMB_S454.482.C1___0rc	Unknown	
1110	14	44	unmapped	0		0	ATCTGCTCTTCTCAATTTGGCCGCCTCTTCAAACTTGGTGATTGCCTCGTTACAGGATTT	1039	0	UF_Msa_AF_104365	contig24954___1_nr0nt	contig24954___1_nr0nt	Unknown	
1111	14	45	unmapped	0		0	AGAGTCTCTGGAGAAAGGCATCGATTTAATCAACCGCAGAGAAGCCACTGGCCCTCTATG	1041	0	UF_Msa_AF_109695	contig15956___1rc_nr0nt	contig15956___1rc_nr0nt	Unknown	
1112	14	46	unmapped	0		0	ATCACCGTGCAGTACCCACCTTGTGATGCTTTTCACTAAAGAGCTCTGCACAAATCAATG	1043	0	UF_Msa_CF_127094	contig19740___0rc	contig19740___0rc	Unknown	
1113	14	47	unmapped	0		0	GTGTTGCAGCAAGAAATGAAGTATTTGCAAGTGGAAACAGTTCAAATCTGTATGAAAGTT	1045	0	UF_Msa_AF_106891	contig28981___1_nrnt	contig28981___1_nrnt	Unknown	
1114	14	48	unmapped	0		0	TGGAGGGCTCCTGTCTTTTCGTCTGGATCCGACTCCTCTCCGTTCTCTGCTGAAAGTCTT	1047	0	UF_Msa_AF_109577	contig15894___1_nr0nt1	contig15894___1_nr0nt1	Unknown	
1115	14	49	unmapped	0		0	CACACATTGGACAATCTTATAATACCACTTGGAAACAGACACAGCAAGTTAATTTCTCTT	1049	0	UF_Msa_CF_124433	contig06642___0rc	contig06642___0rc	Unknown	
1116	14	50	unmapped	0		0	TTTTTCATCGAGAGCTTATACGGCAGCTTGAGGCGGGGAGGTAAACTTTTGGCAATATCA	1051	0	UF_Msa_CF_122645	contig22448___0	contig22448___0	Unknown	
1117	14	51	unmapped	0		0	ATGTCATCGCAGGAGCAGGGTACTATGTGGACTGCACCCACACTGAGGCCACCAAGAGAA	1053	0	UF_Msa_AF_109529	contig14055___1rc_nrnt-1	contig14055___1rc_nrnt-1	Unknown	
1118	14	52	unmapped	0		0	AAACAAGCCAAGCAGAAACTTGAGGATCGTCTAGCAGCTGCAGCCAGGGAGAAGCTGGCC	1055	0	UF_Msa_AF_101360	contig25453___1_nr0nt1	contig25453___1_nr0nt1	Unknown	
1119	14	53	unmapped	0		0	TAACAGAAGCAGCAAGCAGTATGATCCCATCTGTGGCCACCACACCTGAACCTGTCACTT	1057	0	UF_Msa_CF_117945	contig24385___0	contig24385___0	Unknown	
1120	14	54	unmapped	0		0	TCTTAATCTTTGTGGTCCTCTCATCCATGAAAACATGTCAAAACAGACCGGGACCACCCT	1059	0	UF_Msa_CF_121604	contig21785___0	contig21785___0	Unknown	
1121	14	55	unmapped	0		0	AGGTGAGGAAGACTCACTTGGGCTTGGTCTCGGCATCTGTGACTTGGCGGATGAAGATGG	1061	0	UF_Msa_AF_104872	contig12935___1_nr0nt	contig12935___1_nr0nt	Unknown	
1122	14	56	unmapped	0		0	TACTGATGCCTGGTGATCGCTTCCATTACATCAACGGTACAATCTTCTGTGAGCATGACA	1063	0	UF_Msa_AF_105199	contig04100___1_nrnt	contig04100___1_nrnt	Unknown	
1123	14	57	unmapped	0		0	ACTGACTGGAGAATCAGCTGTCAGAACTTCGTTCCGGTGTCATGGGCAACGGAAGCGCAG	1065	0	UF_Msa_CF_118978	contig00088___0rc	contig00088___0rc	Unknown	
1124	14	58	unmapped	0		0	AATACAACAGCAAGGACTTGTTCACATCCTTCTCCAGACTAAATGGACGCTGTTTCAGCC	1067	0	UF_Msa_CF_119323	contig30909___0	contig30909___0	Unknown	
1125	14	59	unmapped	0		0	AGAGGGCAGCAGTAAAACCAGCCAGGATGAATGAGGAGCGCTTACAACTAGCTCAACCCC	1069	0	UF_Msa_CF_118136	contig15155___0	contig15155___0	Unknown	
1126	14	60	unmapped	0		0	AGAGAAGAACGGGAAGAGGGAGACCAAAGTGCTGAATATGCTGCTCTTCATCAAGGTTAA	1071	0	UF_Msa_AF_100405	contig24280___1rc_nrnt	contig24280___1rc_nrnt	Unknown	
1127	14	61	unmapped	0		0	TGTGGACGTTTTCACTGAGGGGTGTCCAACACCGAAAACAAGAGCCTCCAAAGAAATCAT	1073	0	UF_Msa_CF_123672	contig18640___0	contig18640___0	Unknown	
1128	14	62	unmapped	0		0	ATTGGCAGATTCGTGGGAAACCCAATGATCCGTGTCAGCGTGGGGTGGCCATCAAGTGTG	1075	0	UF_Msa_AF_109872	contig12920___1_nr1nt0	contig12920___1_nr1nt0	Unknown	
1129	14	63	unmapped	0		0	TCACATCCTTTGACTGGAATGAGGTGGACCCAAACCTGTTAGGTACTTCCAGTATAGACA	1077	0	UF_Msa_AF_106737	contig24876___1rc_nrnt	contig24876___1rc_nrnt	Unknown	
1130	14	64	unmapped	0		0	CGCCATGCCCAAAGCTAAACCCAGGAAACCAATCAGAGCGGCAGTGACCAGTGAGAATCT	1079	0	UF_Msa_CF_123043	contig12111___0	contig12111___0	Unknown	
1131	14	65	unmapped	0		0	CCAGCAGTCCTCTACTTGTACACAGCCCCCTGAGGCTACAAATTAACCAAAGCACTACAA	1081	0	UF_Msa_CF_124200	contig23425___0	contig23425___0	Unknown	
1132	14	66	unmapped	0		0	GTGTGTGCACTCATGAAATATCTCCTACTTTTTTAAGTAAATAAAACACTTGTTGTTATA	1083	0	UF_Msa_AF_106249	contig22622___1rc_nr0nt1	contig22622___1rc_nr0nt1	Unknown	
1133	14	67	unmapped	0		0	TGCGGCAACCAAAAGCTTGTAAGCAACACATCTGATGGTCCATTGATGGTGTAATTTTTT	1085	0	UF_Msa_AF_101768	LMB_S454.sd.655.C1___1_nrnt	LMB_S454.sd.655.C1___1_nrnt	Unknown	
1134	14	68	unmapped	0		0	TGTCAACCATCCACAAGTATCTGCCCTACTCGGAGAGGAAGATGAAGAAGCACTTCATTA	1087	0	UF_Msa_AF_109099	contig01094___1_nrnt	contig01094___1_nrnt	Unknown	
1135	14	69	unmapped	0		0	TGGATTGTGTATTTATTGTTTGCAATGTACATATTAGTTTGCAGCTCTTTGCACATATCA	1089	0	UF_Msa_AF_108002	contig13261___1_nr0nt1	contig13261___1_nr0nt1	Unknown	
1136	14	70	unmapped	0		0	AAGCAGTCAATATTTCTCACAAGACATCCTCCCGTTTCACCAGCGGTTTCCAAAAGACGA	1091	0	UF_Msa_CF_126922	contig03695___0rc	contig03695___0rc	Unknown	
1137	14	71	unmapped	0		0	TGCCAGCATCCTCCTGTACAGAGAAATCACCTGCGCTCGCGTGGACGCCGCCATGATGTC	1093	0	UF_Msa_CF_122995	contig30434___0rc	contig30434___0rc	Unknown	
1138	14	72	unmapped	0		0	AACTCACATTCCAGGACATCTGGAAAAGGCTCTCCAAGCCATTAGAGACACAAGAAGACT	1095	0	UF_Msa_CF_122530	contig24885___0	contig24885___0	Unknown	
1139	14	73	unmapped	0		0	AACCAAGATCCTTTTATCTTACTGATAGTGCTAACAGCCAGCCAAAATGTCTGTCAACGT	1097	0	UF_Msa_AF_106197	contig09914___1_nr0nt1	contig09914___1_nr0nt1	Unknown	
1140	14	74	unmapped	0		0	ATGTTACTGCTAGAGCGCCTCATGATCTCCAGTGACGCCTTTGAGGTGGACGTGTGCGGA	1099	0	UF_Msa_AF_109095	contig09880___1_nrnt	contig09880___1_nrnt	Unknown	
1141	14	75		1028	E1A	0		799	1	(+)E1A_r60_n9	E1A_r60_n9	E1A_r60_n9		CONTROL
1142	14	76	unmapped	0		0	GACTATCTTGGTGCTTGCCGTGGAAACCTGCGCTTGCCGGCGATCATGATGCTGGGATAT	1102	0	UF_Msa_CF_119275	contig09757___0rc	contig09757___0rc	Unknown	
1143	14	77	unmapped	0		0	GGAACCCTCAAACTGTGGCAAGTATGGACAATTAGCTCTTTAACCATATTTATAATAATG	1104	0	UF_Msa_AD_200378	LMB_Add_94_rc	LMB_Add_94_rc	Unknown	
1144	14	78	unmapped	0		0	TATTTACATGCGCTTTATGAAATCCCACAAGTGCTACGACGTCGTCCCCACAAGTTCCAA	1106	0	UF_Msa_AF_109846	contig16384___1rc_nrnt	contig16384___1rc_nrnt	Unknown	
1145	14	79	unmapped	0		0	TTTGGCGGCAGAGACCGGCCTTTCCGTAAACCCATTAACCTCGGAGTCGGTCCGGTGCAG	1108	0	UF_Msa_AF_105010	contig05180___1_nrnt	contig05180___1_nrnt	Unknown	
1146	14	80	unmapped	0		0	AAGGACGATGCCAATTTCAAGCTGATGAGTGAGCGAATCAAATCTAACCAGATCTACAAG	1110	0	UF_Msa_AF_107341	contig15989___1rc_nrnt	contig15989___1rc_nrnt	Unknown	
1147	14	81	unmapped	0		0	TATTCCAACATTTGGTGAAAACTCAGGACCGAGGCGGCAAAGGAGAGACAGGAAGGACAG	1112	0	UF_Msa_CF_122062	contig10736___0	contig10736___0	Unknown	
1148	14	82	unmapped	0		0	CAGCTTCATCTTTGACTCAGGGCCGACACAGGACTATCCTTTTATTTACACTATTGATTG	1114	0	UF_Msa_CF_126157	contig22054___0	contig22054___0	Unknown	
1149	15	1	unmapped	0		0	AGCTCGATTTGCATGTACACTCAGTCAGAGAAAGCCAGGTAGAGTTAAGAGAACACATAG	1115	0	UF_Msa_AF_100830	contig28154___1_nrnt	contig28154___1_nrnt	Unknown	
1150	15	2	unmapped	0		0	AACGGCAATGAGACTTGCGTGATTGCTCTTCACTATGCAACACATGTAAACAAAAAAGAA	1117	0	UF_Msa_AF_106555	contig01069___1_nr0nt1	contig01069___1_nr0nt1	Unknown	
1151	15	3	unmapped	0		0	GGCTCCTTTCACAGCACGGTCAATCTCTCGTGACAAACTAAAGTGAACCATTTGCATGTT	1119	0	UF_Msa_CF_123179	contig10486___0	contig10486___0	Unknown	
1152	15	4	unmapped	0		0	TCAAGACCTTCGAGACGATACAGCTGCAACAGCAGAAAGAAACGCACGGGGAAAGAAAGC	1121	0	UF_Msa_CF_123935	contig09550___0rc	contig09550___0rc	Unknown	
1153	15	5	unmapped	0		0	GCCACAGCAGGGGATAACAAGAAAGACAAGGCGCCTGCTGCTGTTGCCAAGACTACAAAG	1123	0	UF_Msa_CF_126850	contig08917___0rc	contig08917___0rc	Unknown	
1154	15	6	unmapped	0		0	ACTACTGTGACCCTGGCCACCACAACACTAGACAAAGACAGCTGAAGGCCGCATCACAGC	1125	0	UF_Msa_AF_108474	contig32646___1_nr0nt1	contig32646___1_nr0nt1	Unknown	
1155	15	7	unmapped	0		0	AAATGATCACAGCAGAAGCAGAAGCAACTCTCTGCTGTCAGTACCCAACTAGAGCTTTCT	1127	0	UF_Msa_CF_124231	contig19550___0	contig19550___0	Unknown	
1156	15	8	unmapped	0		0	ACTAAAGATACTTAGATGGGACGGCTCAACCACAAAATTGGCAAGACCAACCCACTGGAA	1129	0	UF_Msa_CF_122143	LMB_S454.sd.33.C1___0	LMB_S454.sd.33.C1___0	Unknown	
1157	15	9	unmapped	0		0	CCAAGTGAATGCTGTCCATGTTGTATATCTCCTACATGTCACCAATATGTTCTATTTAAT	1131	0	UF_Msa_AF_108798	contig27650___1_nrnt	contig27650___1_nrnt	Unknown	
1158	15	10		1028	E1A	0		1133	1	(+)E1A_r60_a104	E1A_r60_a104	E1A_r60_a104		CONTROL
1159	15	11	unmapped	0		0	CTTTACTTGAATTTGATCCAAGTTCATTGTCTATACAGGGTATATTTACAAGATCTGAAA	1135	0	UF_Msa_AF_104997	contig06724___1_nr0nt1	contig06724___1_nr0nt1	Unknown	
1160	15	12	unmapped	0		0	AAACAGCTTACTTTAAAGAGAAGGGCATCCCTGCCAGCTGCTGTAAAGACAACACCAAAT	1137	0	UF_Msa_AF_101216	contig30022___1rc_nr1nt0	contig30022___1rc_nr1nt0	Unknown	
1161	15	13	unmapped	0		0	ACTGGGACTTGAACATCTCTTACACAACGGTGTCTTTTTCATTCTGCCTGCATCTCCTAG	1139	0	UF_Msa_CF_118544	contig15371___0	contig15371___0	Unknown	
1162	15	14	unmapped	0		0	CTTGTTTTAACTTCTGTGTCAAAGGAAGATCACAGCTGCCACGCTTCATTCGTCTGTGTT	1141	0	UF_Msa_AF_109244	contig25078___1_nrnt	contig25078___1_nrnt	Unknown	
1163	15	15	unmapped	0		0	TTTGAGACTGGTGCACGCCACCCCTTCGCACAAGCTGTCGGAGGAGCGGGTGTTGTTCCT	1143	0	UF_Msa_AF_104106	contig01824___1_nr0nt	contig01824___1_nr0nt	Unknown	
1164	15	16	unmapped	0		0	CACACACATCCTGTACACTGGTGTTTCTTCATGGATGTAAAGTCATTTTGGTTTATAATA	1145	0	UF_Msa_AF_109457	contig31170___1_nrnt	contig31170___1_nrnt	Unknown	
1165	15	17	unmapped	0		0	TCCCTATCCCACCACCAGATGCTAAGGAACTGGAACAGATTTTTTGGTTTTCCAGTGGAA	1147	0	UF_Msa_AF_106520	contig23856___1rc_nrnt	contig23856___1rc_nrnt	Unknown	
1166	15	18	unmapped	0		0	TCTAGACCAGCTTTGAGCGCATGCTCAGCCTGAAGGACCAGGAGATTGAGCAGTGGCATC	1149	0	UF_Msa_CF_122186	contig23078___0	contig23078___0	Unknown	
1167	15	19	unmapped	0		0	AATTAGCCATGCAGCGGGAGGAAACTAGGAAGAAACCCAAGATGACTATAATGGAGTCTG	1151	0	UF_Msa_AF_107335	LMB_S454.sd.454.C1___1rc_nrnt	LMB_S454.sd.454.C1___1rc_nrnt	Unknown	
1168	15	20	unmapped	0		0	TTAATTCTGCACATTCCAGTGAGCTACGTGAGTTTCATGCCCCAGCGTTAATAATGCAAA	1153	0	UF_Msa_AF_101709	contig30910___1_nr0nt	contig30910___1_nr0nt	Unknown	
1169	15	21	unmapped	0		0	AACGACGTGGAGTTCAGGGAGGTGACCGACCTGGTGAAGGTCGACAAGGTCAAAATCGTC	1155	0	UF_Msa_AF_108320	contig24389___1_nr0nt1	contig24389___1_nr0nt1	Unknown	
1170	15	22	unmapped	0		0	ACCCTCGCCAGCTTGCCGATCAACATCTGGAAACTGAAGTTGTAGGAGCCGCTAAAATTA	1157	0	UF_Msa_CF_120538	contig00674___0rc	contig00674___0rc	Unknown	
1171	15	23	unmapped	0		0	TCCAAAATGGCTTACCAGGCAATACAGCAGGAGTACTTACAGATTCCTGTTGTTACCAGG	1159	0	UF_Msa_CF_122307	contig26481___0	contig26481___0	Unknown	
1172	15	24	unmapped	0		0	CACACAGTCACAAATACATAATCCTGTTTCTAGGTAGATAAGTACACAACTCGAAAAACA	1161	0	UF_Msa_AF_107542	contig30043___1_nr0nt1	contig30043___1_nr0nt1	Unknown	
1173	15	25	unmapped	0		0	AAATTCAGATGCAAGAAGATCCACGATCACTCAGAGACCATTGATACTGGAACCGAGAAC	1163	0	UF_Msa_CF_126108	contig17007___0	contig17007___0	Unknown	
1174	15	26	unmapped	0		0	GCATAAAACAAGTGAATTCAATGAAAGCTAACATTGAGTTTTTATGGACTGCTCTGCGTT	1165	0	UF_Msa_AF_101693	LMB_S454.372.C1___1_nrnt	LMB_S454.372.C1___1_nrnt	Unknown	
1175	15	27	unmapped	0		0	CAGCTTCTGCCAATTCATAATATTTGCACTTTGAAGAACTTCTGTACAGTATGATTTGTG	1167	0	UF_Msa_AF_100968	contig06967___1_nr0nt1	contig06967___1_nr0nt1	Unknown	
1176	15	28	unmapped	0		0	GAGCGCTACGGAGGAGAGGACGCCTTCATAAACATCAAATACATGGTGCCCACTTACGAG	1169	0	UF_Msa_AF_104822	contig26785___1_nrnt	contig26785___1_nrnt	Unknown	
1177	15	29	unmapped	0		0	TACGGAGTCCATCTCTAACGGTTACACAGTTGGTGAAGGCGGGGAGGTCAGCATGTGGCT	1171	0	UF_Msa_CF_126812	contig23560___0	contig23560___0	Unknown	
1178	15	30	unmapped	0		0	TTCAGAGGAGCTGCAATACACACGCTGAAGGCCCGCAGCGTGAATGTGAAGACCCAGGTT	1173	0	UF_Msa_AF_105442	contig14759___1_nrnt0	contig14759___1_nrnt0	Unknown	
1179	15	31	unmapped	0		0	TTGAAGACAGTGGTTACCCTGCCCAGAGCAGCACAGCCACCCTCACTATCCGAGTGTGTT	1175	0	UF_Msa_AF_103327	contig03235___1rc_nrnt0	contig03235___1rc_nrnt0	Unknown	
1180	15	32		1028	E1A	0		1133	1	(+)E1A_r60_a104	E1A_r60_a104	E1A_r60_a104		CONTROL
1181	15	33	unmapped	0		0	GGCTGTCTGGAGAACATGCCATCTGCAGAGGCTAAGCTTAAAAAAGAACAGGTGTGCAAA	1178	0	UF_Msa_AF_106593	contig21599___1_nr0nt	contig21599___1_nr0nt	Unknown	
1182	15	34	unmapped	0		0	AATGACAGGGCGCGCAAAAAGAAAACCCAAATCCAGTCAGGAGTCGGCTACAGGGAATGG	1180	0	UF_Msa_CF_127785	contig07585___0	contig07585___0	Unknown	
1183	15	35	unmapped	0		0	TGAGGCCCAAAAGTTTCGGAGGCCTTAATGTAATATAACCTCCCTCTATCCTTAAAACTA	1181	0	UF_Msa_CF_120972	contig10030___0rc	contig10030___0rc	Unknown	
1184	15	36	unmapped	0		0	GGCAGGTCACCATTGGAACTCGATAAGAACTTTTCATCGAAGCAACTTTGAATAAAAGAC	1183	0	UF_Msa_AF_105695	contig09348___1rc_nr0nt1	contig09348___1rc_nr0nt1	Unknown	
1185	15	37	unmapped	0		0	TTTTCTTCTTCTTTGGAGGTCCTTGATCTGAATCGCTGCTGCTTCCTGAGTCTGAGCTTT	1185	0	UF_Msa_AF_101772	contig09547___1_nr0nt	contig09547___1_nr0nt	Unknown	
1186	15	38	unmapped	0		0	AAGTGGAGGCGCTCAAACGTAAAGTTTCAGAGTTGGAGACCTTAAAGTCCAGTGACAAAG	1187	0	UF_Msa_CF_122210	contig06528___0	contig06528___0	Unknown	
1187	15	39	unmapped	0		0	ATAAACCTTCAAGGTGAGATAGTGGACCGGGGCAGCACCAATCTCGGGGTGAACCAGGCT	1189	0	UF_Msa_AF_109211	contig24156___1rc_nrnt	contig24156___1rc_nrnt	Unknown	
1188	15	40	unmapped	0		0	TCGCCGGCTCTACGTGGGCAACATCCCCTTTGGTATCACAGAGGGGTCAATGATGGACTT	1191	0	UF_Msa_AF_109332	contig06721___1rc_nrnt	contig06721___1rc_nrnt	Unknown	
1189	15	41	unmapped	0		0	ATGGGCGTGATGGTTATGACTACGACGGCTATAGACTGCGTGTGGAGTTTCCTCGGAGCG	1193	0	UF_Msa_AF_107981	contig03269___1_nr0nt1	contig03269___1_nr0nt1	Unknown	
1190	15	42	unmapped	0		0	GAGAAGAGTACTTAATCGGCAAACATTTCAATTAGTTAAAACCTACAAACTCATTCGGGA	1195	0	UF_Msa_CF_126145	contig21913___0	contig21913___0	Unknown	
1191	15	43	unmapped	0		0	TTTTATTATGCTTGCAGTTTGAGGAGGAGGAAGAGCCATGCGCATGAGGATGAAGAGTGT	1197	0	UF_Msa_CF_120162	contig12600___0	contig12600___0	Unknown	
1192	15	44	unmapped	0		0	GTTACTTTGTTCTCCGCATCCAGGATGACAACGGCCGCAGTGCGTTCATAGGCATTGGGT	1199	0	UF_Msa_AF_103994	contig07680___1rc_nrnt0	contig07680___1rc_nrnt0	Unknown	
1193	15	45	unmapped	0		0	CCATCATGTGATTGTACATAGCTAGAACACACTCATAACTGTGTATAGAGAGAAACATAA	1201	0	UF_Msa_AF_107603	LMB_S454.191.C1___1_nrnt	LMB_S454.191.C1___1_nrnt	Unknown	
1194	15	46	unmapped	0		0	ATCATCATCTTTACTGGCATCACCGGCGACCTTGTTTAAGTGTCACTGCTGTATCATCGA	1203	0	UF_Msa_CF_118378	LMB_S454.30.C1___0	LMB_S454.30.C1___0	Unknown	
1195	15	47	unmapped	0		0	ACAGGAGCACTGACACTAGCCTCATCCTGGAGAGATCGATAAACCGGGTGCAGCTGTTGG	1205	0	UF_Msa_AF_102437	contig15787___1_nrnt	contig15787___1_nrnt	Unknown	
1196	15	48	unmapped	0		0	GCTTGGTATGTCAAAAGTAAGTTGTAATGGAGGCGCTTTGCAAATAAAATTATTCAGTGT	1207	0	UF_Msa_CF_122971	LMB_S454.sd.326.C3___0	LMB_S454.sd.326.C3___0	Unknown	
1197	15	49	unmapped	0		0	TGGACCACTTGAGGTCAAAGGTCAGCTCTTAAGGGTTAATTGTTGTTAAGGCTTCCTGTG	1209	0	UF_Msa_CF_119699	contig23579___0rc	contig23579___0rc	Unknown	
1198	15	50	unmapped	0		0	CTTCCTGCTCCTCTGTCCCCGGAGCAGCTGGACAGGATCGCCCGCAACAAGAGAGCAGCG	1211	0	UF_Msa_CF_122608	contig13163___0	contig13163___0	Unknown	
1199	15	51	unmapped	0		0	AGATGCTTGGCAATGAGGTGTGCAGTGTGTGTGGTGACAAGGCCTCTGGTTTCCATTACC	1213	0	UF_Msa_AF_101900	contig04239___1rc_nrnt	contig04239___1rc_nrnt	Unknown	
1200	15	52	unmapped	0		0	AAATCTGGAGAGGGTTTCATCGATTTCATTGGCCAGGTGCACAAAACCAAGGAGCAGTTT	1214	0	UF_Msa_AF_105277	contig02695___1rc_nrnt	contig02695___1rc_nrnt	Unknown	
1201	15	53	unmapped	0		0	GAAAAGTGTGACAAAGAGTTCCCCAACTTCAAGTACCGCCTCATCCTTTCTGCCAACATT	1216	0	UF_Msa_AF_108475	contig24198___1rc_nrnt	contig24198___1rc_nrnt	Unknown	
1202	15	54	unmapped	0		0	CACCCTCCCTAACAAGACCAACAAATTCTACTTGTAACTTGCATGTCACCCAAGTTATGT	1218	0	UF_Msa_CF_121669	contig24550___0rc	contig24550___0rc	Unknown	
1203	15	55	unmapped	0		0	CACGGGCAGGCATCACCAGTCCTCTGCTCCCTCCAATCACTCAGGGCGCCGCGAGAGGAG	1220	0	UF_Msa_CF_125775	contig09579___0rc	contig09579___0rc	Unknown	
1204	15	56	unmapped	0		0	TGAGGTGGCCCGACGTAGTGGCCCACATCACTTCCTGTTTGAGATGGTAGAGGACTGTGT	1222	0	UF_Msa_AF_106445	contig13880___1_nrnt0	contig13880___1_nrnt0	Unknown	
1205	15	57	unmapped	0		0	CTCCAGTTGGACCCCAGATGACTCCAAAATCAGGACAAGAGCTCCGTCAGCGCAATGTCC	1224	0	UF_Msa_AF_101634	LMB_S454.679.C1___1_nrnt	LMB_S454.679.C1___1_nrnt	Unknown	
1206	15	58	unmapped	0		0	GTCCTGGGGAGATGAGGGTTGGGGTGAACCGCCTAACACGGGATGAACAGTATGGGATCC	1226	0	UF_Msa_CF_117964	contig23720___0rc	contig23720___0rc	Unknown	
1207	15	59	unmapped	0		0	TTGTCTCGACGTGAGGGTTGGTGTTTTGCTGCCAAGCTGGTGCGTGGGGCCTACATGTAT	1228	0	UF_Msa_AF_106579	contig00745___1_nrnt	contig00745___1_nrnt	Unknown	
1208	15	60	unmapped	0		0	CCACCCTGGCTCTGATCGCCGTCCACCTGGCCCAGGCAATCAGTTCCCCTTTGCCTTTGG	1230	0	UF_Msa_AF_102965	contig24222___1_nrnt0	contig24222___1_nrnt0	Unknown	
1209	15	61	unmapped	0		0	ATGTTGATGTCATGAAAGAGGCTGTAAAAGAGGCTACTGACGTTGCAGCAGAGATCAAGC	1232	0	UF_Msa_AF_106545	contig17417___1_nrnt	contig17417___1_nrnt	Unknown	
1210	15	62	unmapped	0		0	TTTAACGTTGTTATCCAAAAAGCGTGGGTATCTGCAGAAGGGTGGAGTCCCCAATACTGA	1234	0	UF_Msa_AF_100111	contig11404___1rc_nr1nt0	contig11404___1rc_nr1nt0	Unknown	
1211	15	63	unmapped	0		0	TTTTCAATACAGTAATGGCACCAAAAATACCAAAGTATCTCTGCTATGCCCTCCCACCAG	1236	0	UF_Msa_CF_125536	contig01041___0	contig01041___0	Unknown	
1212	15	64	unmapped	0		0	CGAAAACAACTTCGCAACATGATCACAACATGGGAGGAGTCGTCACCGGCGAGAAGAGTG	1238	0	UF_Msa_CF_118149	contig10048___0	contig10048___0	Unknown	
1213	15	65	unmapped	0		0	ATTCAGGACAAGGGCCCATGATGAGCGGAGGGCCCACCTTACAGCAGGTCACCATTGGCG	1240	0	UF_Msa_AF_102432	contig02606___1_nr1nt0	contig02606___1_nr1nt0	Unknown	
1214	15	66	unmapped	0		0	AAATCATCTGGAGTACGGCTACCTGGAGGGCGAGTGCATCGGGGAGTATTTCGCTGAGGA	1242	0	UF_Msa_CF_120429	contig14826___0rc	contig14826___0rc	Unknown	
1215	15	67	unmapped	0		0	CTCTGGTGGTGTCAACTTCAGTTCCTGCAAAACCTGAAAAAGAAAAATGCGAAACAACCA	1244	0	UF_Msa_CF_121217	contig12335___0	contig12335___0	Unknown	
1216	15	68	unmapped	0		0	TCTGATCTCTATGGATCGGAATGTCCTGGATAACAAAGATCACCATGTTGCAGCCTATAA	1246	0	UF_Msa_CF_124798	contig00654___0	contig00654___0	Unknown	
1217	15	69	unmapped	0		0	TCCACAACTCCTCGGGTAAAGCTGACATCCAGTCCATGTCGCATCACCACTTCTGAATAC	1248	0	UF_Msa_CF_126558	contig13866___0	contig13866___0	Unknown	
1218	15	70	unmapped	0		0	AATGTTCCCACCGGGAGTCGACCAGTACGACCAGGAATGATTTACAATAAACTGCATTCA	1250	0	UF_Msa_AF_105560	LMB_S454.sd.162.C1___1_nrnt	LMB_S454.sd.162.C1___1_nrnt	Unknown	
1219	15	71	unmapped	0		0	TTGGGTTATGAGGATTAGTTAAAGACTGTTCTTTAGGAATCTCATGGCCTGGAACAGGGT	1252	0	UF_Msa_AF_109902	contig28835___1_nr0nt	contig28835___1_nr0nt	Unknown	
1220	15	72	unmapped	0		0	TTTGCTGCTACCAACTGCTGTAAGTGACAAAACAATTCCCCCCTTTTAAAACCAACGCTT	1254	0	UF_Msa_AF_106759	contig14019___1_nr0nt1	contig14019___1_nr0nt1	Unknown	
1221	15	73	unmapped	0		0	CAGTGGTGTATTTATGGATAACTGTCCTAGTGCTGGTCAGTATGTTTATTTGTTATCATA	1256	0	UF_Msa_AF_109938	LMB_S454.452.C1___1rc_nrnt-1	LMB_S454.452.C1___1rc_nrnt-1	Unknown	
1222	15	74	unmapped	0		0	CTTTGCACTCAATCCCAACACAAATTTGTAACCGTCCAAATATAAATGAAATCCCTGCCA	1258	0	UF_Msa_AF_103123	contig13638___1_nrnt	contig13638___1_nrnt	Unknown	
1223	15	75	unmapped	0		0	GTTTACCTTCCCTGAACACCGTGAAGATCATCTCCACAGTGTAATATTTATGATAAATTT	1260	0	UF_Msa_AF_102063	contig31634___1rc_nrnt	contig31634___1rc_nrnt	Unknown	
1224	15	76	unmapped	0		0	TTCAAGTAAAGCAGATTCATCCAGTCAGCATGAATTCATGTCCTCTGACGACCAGAAGCC	1262	0	UF_Msa_CF_124121	contig12006___0	contig12006___0	Unknown	
1225	15	77	unmapped	0		0	CCACAAGAGGGGGAACAATGATTGTTGCTTATGTGTTATTACACTCAAAATACTTTCTAT	1264	0	UF_Msa_CF_123197	contig20788___0	contig20788___0	Unknown	
1226	15	78	unmapped	0		0	ATATGTGATAGTGGTGACTAAGATTGACAAATGTGGGCACGGCGCACTGCTGACAAACTT	1266	0	UF_Msa_AF_103427	contig03370___1_nr1nt0	contig03370___1_nr1nt0	Unknown	
1227	15	79	unmapped	0		0	GAGTCACGAAAAAACCCTTTAAATTTGGACTTTTTCTATGAAGTTTGGCTCTAATCCTCT	1268	0	UF_Msa_CF_118481	contig28121___0rc	contig28121___0rc	Unknown	
1228	15	80	unmapped	0		0	TGCTTGTCAGGAAGATCCAAGAGGAGTCACTGAGGACTTATCTGTTCACATATAGCAGTG	1270	0	UF_Msa_AF_109691	contig19070___1_nr0nt1	contig19070___1_nr0nt1	Unknown	
1229	15	81	unmapped	0		0	ATCGACAACGTGCCCACATCTCACCTGGACATCACCGAGAGGGAGACAGGTGAGACGGCG	1272	0	UF_Msa_CF_124649	contig25844___0rc	contig25844___0rc	Unknown	
1230	15	82	unmapped	0		0	AACAGTACGCTCTCCTTCTCCACCGAAAATAGTCAACCGGAAGCCAGTGAAAGGCTTTCT	1274	0	UF_Msa_CF_118630	contig25783___0rc	contig25783___0rc	Unknown	
1231	16	1	unmapped	0		0	ATGTGATGCAGTGACTAAGGAACGCATTCAAAGGCAGATAGACGAGACACGATGATAGGA	1116	0	UF_Msa_CF_124074	contig17599___0	contig17599___0	Unknown	
1232	16	2	unmapped	0		0	ATCCATGAGGTGCCAGTGCTTCTTCACTGTTGTTCTCTATTCATTCCAAAACACAGTGGC	1118	0	UF_Msa_CF_119709	contig12134___0	contig12134___0	Unknown	
1233	16	3	unmapped	0		0	ATTTTAAGCCGTGGTTCAGCTGAATATCCTGTCACAATCTAAATTACAAGTTGGCAATTA	1120	0	UF_Msa_CF_126136	contig28936___0	contig28936___0	Unknown	
1234	16	4	unmapped	0		0	TCAGCTGTTGAAGGATCCTCAGGTTCTGTTTGCTGGTTATAAAGTTCCTCATCCTCTGGA	1122	0	UF_Msa_AF_105678	contig02343___1rc_nrnt	contig02343___1rc_nrnt	Unknown	
1235	16	5	unmapped	0		0	CACCACTTGAAATGCCTGATCAACTTTTGTTTTCAGCGGAGCATGTGGAACAAGTAATCA	1124	0	UF_Msa_CF_124793	contig10384___0	contig10384___0	Unknown	
1236	16	6	unmapped	0		0	TATCCTCCTCAACGCTGTGGGAAAGGTGTTTGCACCACTTACGCCAAAGTGGCTCCAAAA	1126	0	UF_Msa_AF_108505	contig26949___1rc_nrnt0	contig26949___1rc_nrnt0	Unknown	
1237	16	7	unmapped	0		0	GAGCTCCAGAATCTTCAAGACAGTGGAAACAAAAAGAAGGACTAGTTGTCGTAAAATCCC	1128	0	UF_Msa_AF_109245	contig07759___1rc_nrnt0	contig07759___1rc_nrnt0	Unknown	
1238	16	8	unmapped	0		0	TCATCAAATACGTTCTTCAGTCCCCGCTGTGTTAGGGCTGAGCACTCAACATATTTGACT	1130	0	UF_Msa_AD_200379	LMB_Add_69_rc	LMB_Add_69_rc	Unknown	
1239	16	9	unmapped	0		0	ATTTTGGTGACAAGCGTGTGTTTAGTGAAGGAGAAGGAATGACTCTTATGCAGAGGAGGA	1132	0	UF_Msa_AF_108392	contig24019___1_nr0nt1	contig24019___1_nr0nt1	Unknown	
1240	16	10	unmapped	0		0	GAAAGGAGCAGGGAGGTGAAGCGATGCCTTTTCTGTCTACTGACAGAATGACGCTCCAAA	1134	0	UF_Msa_CF_125226	contig26643___0	contig26643___0	Unknown	
1241	16	11	unmapped	0		0	AGACAAAGGAGTGGAAGCCACGCGGAGCTCTGTGCCGCACCTTCAGCTCATTTGGTTTCT	1136	0	UF_Msa_AF_102775	contig31328___1_nrnt	contig31328___1_nrnt	Unknown	
1242	16	12	unmapped	0		0	TCATGGCAACAACAGACCACAACACCAGAGAAACAGACTCCTCAGTTTCCATGGAGAACG	1138	0	UF_Msa_CF_122987	contig00603___0rc	contig00603___0rc	Unknown	
1243	16	13	unmapped	0		0	AACAACCAAATAATACGTGACGCCGTGTGATGTACGCACCACATCCCCAAGGACTTAATT	1140	0	UF_Msa_CF_118661	LMB_Sanger.100.C2___0	LMB_Sanger.100.C2___0	Unknown	
1244	16	14	unmapped	0		0	CAAAACAGCGCGTTTTAAGAGCTCGTTTCAGCTCAAACTACAAGTTAAAGCTCTCTTGTG	1142	0	UF_Msa_CF_120816	LMB_S454.62.C1___0rc	LMB_S454.62.C1___0rc	Unknown	
1245	16	15	unmapped	0		0	TAAAAAATTTAACCTCCCCAGCAAATTCAGTGACTTTCTGCTTGATCCACACAAGTTTTT	1144	0	UF_Msa_AF_109674	contig06955___1_nrnt	contig06955___1_nrnt	Unknown	
1246	16	16	unmapped	0		0	GCATCCGGGTCTGTTATAGCCGTCGCTGCGAGTATCAGCTCCTGGACTCCACAGAATACC	1146	0	UF_Msa_AF_101206	contig16234___1rc_nrnt0	contig16234___1rc_nrnt0	Unknown	
1247	16	17	unmapped	0		0	ATAGTGAAAGCCTTCCAGCAGCTCGCAAACCCAGAGCTTTTGAGACCAAAGCCACCATCT	1148	0	UF_Msa_CF_121638	contig09596___0rc	contig09596___0rc	Unknown	
1248	16	18	unmapped	0		0	CATAGCTAGCAATATTCAGGAGGCTCTTGATGTCTGATAAAACACTGTGAGGTAAATGTG	1150	0	UF_Msa_AF_109701	contig13356___1_nr0nt	contig13356___1_nr0nt	Unknown	
1249	16	19	unmapped	0		0	AGCACAGATTCTCTCAGAACAGCCAACCAAGAGTTAAAAGTCCAGATCACTTGAGCCTGT	1152	0	UF_Msa_CF_126832	LMB_S454.sd.10.C1___0rc	LMB_S454.sd.10.C1___0rc	Unknown	
1250	16	20	unmapped	0		0	TGAACCGGATCACTCTGGACTGGATTTGTGGATTTTAGTGGCTCAGATGTGGAACCTGGT	1154	0	UF_Msa_CF_117922	contig19231___0	contig19231___0	Unknown	
1251	16	21	unmapped	0		0	CCAAACTTCCACTGTGTTTCTTGTAAGTCAGTGGTGGACAAGCCAAACACAAAGATTCAA	1156	0	UF_Msa_AF_104102	contig06485___1_nrnt0	contig06485___1_nrnt0	Unknown	
1252	16	22	unmapped	0		0	TTTTTATCCGCCATGATGGAGGGCTGGAATGACGGACGCTAGCACCTGTGGAGCCCTCTT	1158	0	UF_Msa_AF_102540	contig12064___1_nr0nt	contig12064___1_nr0nt	Unknown	
1253	16	23	unmapped	0		0	GTACACGTCTCGTAAGTGGAAGGTGCAAAATACATTTTCGCATGGACTTCTGCAGCAGAA	1160	0	UF_Msa_CF_122634	contig00266___0	contig00266___0	Unknown	
1254	16	24	unmapped	0		0	TTGCTTGGGGGAAGTTTAAGTGCAGATAAAATGTCGTCTTGGGCGAAATCATCTGCAGCT	1162	0	UF_Msa_CF_122426	contig08797___0rc	contig08797___0rc	Unknown	
1255	16	25	unmapped	0		0	TAAAGTGCGCAAGACGTTTGTGGGAACGCCATGCTGGATGGCTCCAGAGGTCATGGAGCA	1164	0	UF_Msa_AF_102513	contig02711___1_nrnt	contig02711___1_nrnt	Unknown	
1256	16	26	unmapped	0		0	TTTAACAGTACGTGCTCGGCCACACTACAATGGTGACAGTTATGTTGCACCAGTAGACTT	1166	0	UF_Msa_CF_119577	contig18678___0rc	contig18678___0rc	Unknown	
1257	16	27	unmapped	0		0	AACAAGTTTGACGCACACCTTTTCCACACCATTGGCGTTGAGTTCCTCAACAAGGAACTT	1168	0	UF_Msa_AF_108706	contig32808___1rc_nrnt	contig32808___1rc_nrnt	Unknown	
1258	16	28	unmapped	0		0	ATTCAACACAAAACTCACTTAGGAGAGCTCTGCAATCATGTCCAGTAACGCCGAAGAGAG	1170	0	UF_Msa_CF_126954	contig15958___0	contig15958___0	Unknown	
1259	16	29	unmapped	0		0	TTCGGCCGCCCCCAGCTGAAGGCGGTGATCCTGAAGACCATGATCCGAAAGCCCAAGAAG	1172	0	UF_Msa_AF_109124	contig20781___1_nr1nt0	contig20781___1_nr1nt0	Unknown	
1260	16	30	unmapped	0		0	AATGGGAGTGGTCACTTCTGTGGTGTAGCAGAGATGCGCTCACCCGTGGACTACAACACA	1174	0	UF_Msa_AF_100916	contig09873___1_nrnt	contig09873___1_nrnt	Unknown	
1261	16	31	unmapped	0		0	TCAACATCAACAGCCTCCCACCCACCCCCATGACCCCGGTGTCGGGTGAGTTTCATCAAG	1176	0	UF_Msa_AF_100791	contig08931___1_nrnt	contig08931___1_nrnt	Unknown	
1262	16	32	unmapped	0		0	TACAGGGCTTCCACCCTTATCGACGCTGACCACCACCTTGGGGCAACGTCGCTGTGTAAA	1177	0	UF_Msa_CF_122480	contig08031___0rc	contig08031___0rc	Unknown	
1263	16	33	unmapped	0		0	GGTAACAGTGTCTAAGTTTAGACCTGGCCTAACCATAAAGGATTTCAATTTCATTTAGTG	1179	0	UF_Msa_AF_108322	contig29170___1_nr1nt0	contig29170___1_nr1nt0	Unknown	
1264	16	34		1028	E1A	0		479	1	(+)E1A_r60_1	E1A_r60_1	E1A_r60_1		CONTROL
1265	16	35	unmapped	0		0	TTACAAAGAAGAAATGGAAATGCAAAATGCCACACGTCAAACAGGAGCAGCCGCACCCAA	1182	0	UF_Msa_CF_122643	contig12443___0	contig12443___0	Unknown	
1266	16	36	unmapped	0		0	CGATTAATACATTTCGCTTAATTACACGAGCCAGTGCAGCCATACTGAAAGGAGTCCACG	1184	0	UF_Msa_AF_109677	contig15416___1_nr0nt1	contig15416___1_nr0nt1	Unknown	
1267	16	37	unmapped	0		0	ATTTCTGATCCCCGACTCACACCTTCTTCTGTCACCCAGTCTGTGGTCAAAGACTTTCCT	1186	0	UF_Msa_CF_122488	contig08407___0rc	contig08407___0rc	Unknown	
1268	16	38	unmapped	0		0	TCAGTTTGCAGAGGGGGACATTTCTTTCATCGTGGAGTTGTGCCAAGAAGAAATGAATCC	1188	0	UF_Msa_CF_120839	contig26944___0	contig26944___0	Unknown	
1269	16	39	unmapped	0		0	GACACGCCACACTTCCTGCAGCGTGATGGAGGTGTGCAGCTCTTCAAATGTTACTTTGAG	1190	0	UF_Msa_CF_124988	LMB_S454.104.C1___0rc	LMB_S454.104.C1___0rc	Unknown	
1270	16	40	unmapped	0		0	AACAACAAAGAATCCAAAGGATGCTGTGACTGATATCTTCCTGTGCACAGGTGGTCAGAG	1192	0	UF_Msa_AF_103792	LMB_S454.sd.375.C1___1rc_nrnt	LMB_S454.sd.375.C1___1rc_nrnt	Unknown	
1271	16	41	unmapped	0		0	TTTTCCATGTGGGCTTCCGGATGATACCCACAGTTTATATACGGTACTGTGTCAGCAGTT	1194	0	UF_Msa_CF_124971	contig03187___0	contig03187___0	Unknown	
1272	16	42	unmapped	0		0	GCAGCTTTGGCCGTGAAAACCCAGAAACACCGAAACTACAACAATGGGAAAGGAAAAAGA	1196	0	UF_Msa_AF_107012	contig14625___1_nr0nt1	contig14625___1_nr0nt1	Unknown	
1273	16	43	unmapped	0		0	TTTCTAGGGAAACCACATTGCCATCAATATCCGTCGCTGAGAAGTCATAATAGACGTGGC	1198	0	UF_Msa_AD_200134	AY309440_rc	AY309440_rc	Unknown	
1274	16	44	unmapped	0		0	AAGAATGCCACCAGCTACAGCAGAGGACTTGGATTTACTCCGTACCCATCACATTAACAA	1200	0	UF_Msa_CF_118436	contig21169___0rc	contig21169___0rc	Unknown	
1275	16	45	unmapped	0		0	TCTCGAACAACAAACCACCATGGCCCTCCACCGGACCAGTTTATTAAACCAAATGGATTA	1202	0	UF_Msa_CF_123614	contig03331___0	contig03331___0	Unknown	
1276	16	46	unmapped	0		0	ACTGCAAGATGGCTGCTGCCACAGAGTGTGGGGTTGATGCAAATACTTCAGAAAACAACA	1204	0	UF_Msa_CF_126426	contig14875___0	contig14875___0	Unknown	
1277	16	47	unmapped	0		0	ATAAAGAGCTTCCAGGCAAGCCTAGAGTTGAGCTGACCTACGACAAGATGTACACAGTAA	1206	0	UF_Msa_AF_103373	contig15229___1_nrnt0	contig15229___1_nrnt0	Unknown	
1278	16	48	unmapped	0		0	AGGAGGAATAGAATTGTTCGTTGGAGGTATTGGCCCTGACGGTCACATAGCTTTCAATGA	1208	0	UF_Msa_AF_106849	contig15976___1rc_nrnt	contig15976___1rc_nrnt	Unknown	
1279	16	49	unmapped	0		0	CTGTTCGACTAATTCAAATACTGAACAGAACCAGATAAGAATCAAATAAGACCGTGATTC	1210	0	UF_Msa_AF_106223	LMB_S454.sd.78.C1___1_nr0nt1	LMB_S454.sd.78.C1___1_nr0nt1	Unknown	
1280	16	50	unmapped	0		0	ACCAGTGGAACCAACAGACTACATCGTCTCTGATCGAGTTGTTATGGAAACTGCCTTACT	1212	0	UF_Msa_AD_200272	LMB_Add_164	LMB_Add_164	Unknown	
1281	16	51		1028	E1A	0		42	1	(+)E1A_r60_n11	E1A_r60_n11	E1A_r60_n11		CONTROL
1282	16	52	unmapped	0		0	CCTGCCTGTGTAGGTTGGATATGGAAAAACTTTACAGTACATAATACAAATAAGAAAAGC	1215	0	UF_Msa_CF_119907	contig27324___0rc	contig27324___0rc	Unknown	
1283	16	53	unmapped	0		0	TTTTTGTTGGATGCTAGCAGAATGAGAGAGAGATCCCTGATAGCAATAGCTTGGTAGTTT	1217	0	UF_Msa_CF_120557	contig31797___0	contig31797___0	Unknown	
1284	16	54	unmapped	0		0	AAGGAAGCCAACACCGCAATCAAGATGATTCCAGGGGTGGTGGAGACGGGGCTTTTCGTC	1219	0	UF_Msa_AF_105266	contig22095___1_nrnt	contig22095___1_nrnt	Unknown	
1285	16	55	unmapped	0		0	GAAATAAGTTGACGCTTCAAAGCAACTGACACTTGTTATGTGCCTGAGCTATGTGCAATA	1221	0	UF_Msa_AF_109653	LMB_S454.sd.237.C1___1_nrnt	LMB_S454.sd.237.C1___1_nrnt	Unknown	
1286	16	56	unmapped	0		0	TGGCAGATGCCTCTTCGAAACAACAGTCAATTGTCGTCTACTTACGAACTGTTTCTCCTC	1223	0	UF_Msa_CF_125173	contig13502___0	contig13502___0	Unknown	
1287	16	57	unmapped	0		0	TAACGTCTTCCTGCTGCGGCAGGTCGCTTTGTCTCCAGATCTTCTGCTGTTCAGGGACCA	1225	0	UF_Msa_AF_103904	contig18606___1_nr0nt	contig18606___1_nr0nt	Unknown	
1288	16	58	unmapped	0		0	ATGATTTTGAGGTGGTGTCAGAACTTTACTTCCAAAATGTCATGCAGTACTACAACTTCT	1227	0	UF_Msa_AF_100384	contig25114___1rc_nrnt	contig25114___1rc_nrnt	Unknown	
1289	16	59	unmapped	0		0	AATGTTTCTGTGCTGTTGTTTCTACATAAAGAACTGTGTGAAGCCATTAAAGTGCTGCTG	1229	0	UF_Msa_AF_107456	contig27780___1rc_nrnt	contig27780___1rc_nrnt	Unknown	
1290	16	60	unmapped	0		0	ACCCGAACCAACTGTTTTTATTTTTTCTTCTTTCTTCTGGACCATTAAACAAAATGTCCG	1231	0	UF_Msa_AF_101171	contig30176___1rc_nrnt0	contig30176___1rc_nrnt0	Unknown	
1291	16	61	unmapped	0		0	TTTGCTGTTCTTCACCAGCACTGCTACAGAGAAGTTTGGGGAAAATAATACAGAAGAAAG	1233	0	UF_Msa_AF_103060	contig31476___1_nrnt	contig31476___1_nrnt	Unknown	
1292	16	62	unmapped	0		0	GGTATAGTGGATGATATCTCCTCCATGCTAAAAGTTCCTCGCAGATCACTACATGTGTTA	1235	0	UF_Msa_CF_118268	contig04512___0	contig04512___0	Unknown	
1293	16	63	unmapped	0		0	TTAGTAGTACTTTATGTGACAAATGAACCGAACTTCATGGGCAAAATTGGTGGAGTCAGA	1237	0	UF_Msa_CF_119641	contig11109___0rc	contig11109___0rc	Unknown	
1294	16	64	unmapped	0		0	AAGCTTTTTGGAAGAAATACACTGCAGATAAGGACAAAGGCCCATCGCGCGTTGATGTGA	1239	0	UF_Msa_AF_106074	contig26049___1rc_nrnt0	contig26049___1rc_nrnt0	Unknown	
1295	16	65	unmapped	0		0	TAGGCTCGGTTACCTATAACGTCCCCATCCATCAACTTAAATTATATTACATATCCTCCA	1241	0	UF_Msa_CF_118958	contig10756___0rc	contig10756___0rc	Unknown	
1296	16	66	unmapped	0		0	CACATCTACCTACAATAGTGGGAAGACTACTGCAGATACAGTTTGTAATGTATAAGTGTT	1243	0	UF_Msa_CF_120386	contig17676___0rc	contig17676___0rc	Unknown	
1297	16	67	unmapped	0		0	AATCCAACAGGCTTTCTGTCAAGCACTCGAGTTTGGTTCTTGACAGTGGTGGAAACCACT	1245	0	UF_Msa_CF_124591	contig12701___0rc	contig12701___0rc	Unknown	
1298	16	68	unmapped	0		0	CTAATGAGAGGTTGAATTAACAAAGATTTCAGGGAGACTGAAAATAGACCAAGACATATC	1247	0	UF_Msa_CF_121371	contig03942___0	contig03942___0	Unknown	
1299	16	69	unmapped	0		0	TTTTCATATGTGGCTGATACCAGCGACAGAAGGTCCCGCACCTTCAGGGTGGCGGTCTTG	1249	0	UF_Msa_AF_103360	contig25693___1rc_nrnt0	contig25693___1rc_nrnt0	Unknown	
1300	16	70	unmapped	0		0	CTCCTCCTCAGAATCTGAAGACGAGGATAGAAAAGAAGAGTGTGAAGAAAAAGCGGAAGA	1251	0	UF_Msa_AF_100483	contig31143___1_nr0nt1	contig31143___1_nr0nt1	Unknown	
1301	16	71	unmapped	0		0	AAGGACCGGTCAGAGTGCCCAGACATTCACATCAATATCCTGGCAGTCACACCTTTTCTC	1253	0	UF_Msa_CF_125905	contig18170___0rc	contig18170___0rc	Unknown	
1302	16	72	unmapped	0		0	GTCAACTGCTACCTGTCATGGAGACGACGTGAGAGCGCCGGTAAAAACCGTCCGGTTATC	1255	0	UF_Msa_CF_127357	contig05436___0rc	contig05436___0rc	Unknown	
1303	16	73	unmapped	0		0	ATCAAATGCTCTGCTCCCAAGTATATTGATTACCTCATGACCTGGGTGCAAGACCAGCTT	1257	0	UF_Msa_AF_106533	contig21578___1rc_nrnt	contig21578___1rc_nrnt	Unknown	
1304	16	74	unmapped	0		0	ACAATTCTGTCTCTGAGCTCTTCAGGCAGTTCCTTTGACCTCATGATTCTCATTTGCTCT	1259	0	UF_Msa_AF_109805	contig00718___1_nr0nt1	contig00718___1_nr0nt1	Unknown	
1305	16	75	unmapped	0		0	AGAGAGGAGTTCGGGGACGATTAAGGTTACCATCATAATGTACCTCTCCATTTTGGGTCT	1261	0	UF_Msa_AF_109733	contig07473___1_nrnt	contig07473___1_nrnt	Unknown	
1306	16	76	unmapped	0		0	AATGCCTCATCCTCAAAACATGAAGGGGGAAAAATAGACAAAAGAGGAGAGGCTTTTTTG	1263	0	UF_Msa_CF_121733	contig01421___0rc	contig01421___0rc	Unknown	
1307	16	77	unmapped	0		0	AAGACTCGCTTGCTGTGCGAGATCGCTCAGTATGCGATTCCTCATTGCGCCAGCTTGGGT	1265	0	UF_Msa_CF_126640	contig02389___0	contig02389___0	Unknown	
1308	16	78	unmapped	0		0	GTGATACGTTGACACTTGCTTCGGTCATTGTAAATGATTTCATTTTCTACTTTTACTGTG	1267	0	UF_Msa_AF_100071	contig27441___1_nrnt	contig27441___1_nrnt	Unknown	
1309	16	79	unmapped	0		0	GGATTACTGAGGAAGCGCCTGCCGATAACTAATGAAATGGTACACAATTTAGTAGCAATA	1269	0	UF_Msa_AF_108785	contig05539___1rc_nrnt	contig05539___1rc_nrnt	Unknown	
1310	16	80	unmapped	0		0	TGATGCAAAGCCTGACAGCTCTTCCAGCCCTCACTTGGTCTGAACTGTGATATTAATGTT	1271	0	UF_Msa_CF_125297	contig22979___0	contig22979___0	Unknown	
1311	16	81	unmapped	0		0	ACCCAGTGAGTCTAGCCCTCGTGAAGAATGGCCAAGACTGTTGCGACAGCCTATGACCAC	1273	0	UF_Msa_CF_126770	contig21046___0rc	contig21046___0rc	Unknown	
1312	16	82	unmapped	0		0	CCAAAGACGCCTTCATTAATGTTCTGAAGAGAAAAGAAAAATAGACTGCAATACTAACAG	1275	0	UF_Msa_CF_125975	contig31873___0	contig31873___0	Unknown	
1313	17	1	unmapped	0		0	AACCTCATACCAATCGATATTCGGCAGTGATGGGTACAGTCTGTGGGTCTGTCTGTTTAT	1276	0	UF_Msa_CF_123838	LMB_S454.247.C1___0rc	LMB_S454.247.C1___0rc	Unknown	
1314	17	2	unmapped	0		0	GGCAAGAAAAACAGCACTCCTACCACCTGATGATGAGAAATAAAATATTCACCCGCCCTC	1278	0	UF_Msa_CF_122559	LMB_S454.511.C1___0	LMB_S454.511.C1___0	Unknown	
1315	17	3	unmapped	0		0	GCGTTGCGATTGTAATACCAATATGCTTTGACTGCATTTATTTAATCACACTTAGTGGAA	1280	0	UF_Msa_CF_126559	contig32606___0rc	contig32606___0rc	Unknown	
1316	17	4	unmapped	0		0	CTACCAGCTCATCAAGGAAGACGTGGACAGCGTCATGGAGATCAGTGTCTGGGGCGACAA	1282	0	UF_Msa_CF_120684	contig22846___0rc	contig22846___0rc	Unknown	
1317	17	5	unmapped	0		0	CCTTCCCTGTCATTCAGTTCTGTGACGTAGGACGCACATACGTAACGTTACAGCGTAACG	1284	0	UF_Msa_CF_121687	contig23504___0	contig23504___0	Unknown	
1318	17	6		0		0		1286	1	ETG05_66023	ETG05_66023	ETG05_66023		CONTROL
1319	17	7	unmapped	0		0	TTTTTAGTGAGCACTCTTGTAAAGGAAAAGTAAGCGCAAATGGTTTTAGACCCCAAAGCA	1288	0	UF_Msa_CF_121237	contig26188___0rc	contig26188___0rc	Unknown	
1320	17	8	unmapped	0		0	GATCAGAGAATACCAGGACCTGATGAATGTCAAGACTGGCTCTGGACATTGAGATCGCCC	1290	0	UF_Msa_AF_109705	contig20733___1rc_nr0nt1	contig20733___1rc_nr0nt1	Unknown	
1321	17	9	unmapped	0		0	AAACAACTTGTCTACATTAAGATGTCAAACACGGGAGGTCGGAGACTGAAACAGTGGCTG	1292	0	UF_Msa_CF_124916	contig18999___0rc	contig18999___0rc	Unknown	
1322	17	10	unmapped	0		0	CCCCAGGAAGACCACCAAGTGGGAACATGATCCTGCTGTGCCTTTGATGAACCTTGTGGA	1294	0	UF_Msa_CF_120549	contig25323___0rc	contig25323___0rc	Unknown	
1323	17	11	unmapped	0		0	ACAAGGTGAAGACGCAGTTGCAGAAAACCATGGACGGCATTCAGTACACTAGCCCTTGTA	1296	0	UF_Msa_CF_122867	contig06332___0	contig06332___0	Unknown	
1324	17	12	unmapped	0		0	ATCTTATCCATCTTTATCTAGGTGCAATGTCATTGGTTACTCTGTTACGCCTGATGCAGA	1298	0	UF_Msa_CF_125070	contig14021___0rc	contig14021___0rc	Unknown	
1325	17	13	unmapped	0		0	TATGCCTGAAGGGGGTCTGCTTGGAGCTGGTTGTAGAAGAGGGAGAAATGAAGGTGTACA	1300	0	UF_Msa_AF_106739	contig24486___1_nr0nt	contig24486___1_nr0nt	Unknown	
1326	17	14	unmapped	0		0	ATAGGAGTGGTTTCGGACGCTCTGAGGAAGACGGACTCCTTCCTGTGGCAGTTTCGCTCT	1302	0	UF_Msa_AF_106764	contig25828___1rc_nrnt-1	contig25828___1rc_nrnt-1	Unknown	
1327	17	15	unmapped	0		0	TTAGCATTTTGTTACAGTTTCTACCATGGAAAAATAACATGTAACATAAGACTGTATTTA	1304	0	UF_Msa_AF_103699	contig03365___1_nr0nt1	contig03365___1_nr0nt1	Unknown	
1328	17	16	unmapped	0		0	GAAGAAGCCACTGTCCCAATTCTTTACTACATACAAATAATGAGTGTATGTACTACTAAC	1306	0	UF_Msa_CF_125309	contig01968___0rc	contig01968___0rc	Unknown	
1329	17	17	unmapped	0		0	AACTTCTGTTTCTCCTCCTGTATTGAAATCCTGGTAAGGGCACTTTCCATCCCTGCTAGA	1308	0	UF_Msa_CF_120048	contig31827___0rc	contig31827___0rc	Unknown	
1330	17	18	unmapped	0		0	TTTCAGTATGGCGCTTAGTAAGACGTTCGGACAAAAGCCGGTCAAATTTCAGCTTGAGGA	1310	0	UF_Msa_AF_105088	LMB_S454.197.C1___1_nr0nt1	LMB_S454.197.C1___1_nr0nt1	Unknown	
1331	17	19		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
1332	17	20	unmapped	0		0	TCTTGAACAATATGCAAAGGACACGTTGTTTCAGAAGGATGGAAATGGGCCAAGCGCACT	1313	0	UF_Msa_CF_121722	contig12035___0	contig12035___0	Unknown	
1333	17	21	unmapped	0		0	AATGGCACCACAGACCTTTCTTTACGGGTGCGTGCTGGAAGCTGGTAAAGAGGTGGTGTT	1315	0	UF_Msa_CF_120166	contig16209___0	contig16209___0	Unknown	
1334	17	22	unmapped	0		0	CCCATGAAGAATTTCTTGGACAGAACAAGGTCCTTCAAATTTAAAATAGGTTCTAGTTGG	1317	0	UF_Msa_AF_105527	LMB_S454.1094.C1___1_nrnt	LMB_S454.1094.C1___1_nrnt	Unknown	
1335	17	23	unmapped	0		0	AGCTCAGAAAGGATCCCTGATTCAAAAAGCTGTGACACAGAGAAGAGTCCAAACCAAAGA	1319	0	UF_Msa_AF_109050	contig27891___1rc_nrnt0	contig27891___1rc_nrnt0	Unknown	
1336	17	24	unmapped	0		0	ATTTTTGAGTTTCTTCGTACTCGTATCCTCGGGCCGCCGCAGCCCTCACCCCCTGGTCGG	1321	0	UF_Msa_CF_121085	contig20120___0	contig20120___0	Unknown	
1337	17	25	unmapped	0		0	GCTTCTAAAAGGCTGTTTGAGAAAATAAAGACTGAAGAGCAAGAAGAGAATGACCCTGAA	1323	0	UF_Msa_AF_107255	contig16446___1_nrnt0	contig16446___1_nrnt0	Unknown	
1338	17	26	unmapped	0		0	CTTTTTAATTAGGCAGTCGCCTACAGACATTTTTCAGACCCTTTTGTTTAGAAAGGTTAG	1325	0	UF_Msa_AF_104596	contig16640___1_nr0nt	contig16640___1_nr0nt	Unknown	
1339	17	27	unmapped	0		0	ACACATCTGTGGAAGAAGAAAGATGCGGGTAAGAAAGTTGGTTCCATGTCGGTTTGACTG	1327	0	UF_Msa_AF_106081	contig15745___1_nr1nt0	contig15745___1_nr1nt0	Unknown	
1340	17	28	unmapped	0		0	GCCTGGAAGACACCTCCCTCTCTTTAGACTCATCCTTCCCAGAACCTGACCGAAAAAAGA	1329	0	UF_Msa_CF_122490	contig26180___0rc	contig26180___0rc	Unknown	
1341	17	29	unmapped	0		0	CAACTTCAACCACCAGTGCTTCAATAATCCAGTCATATGTTCATGAAATGTATTGTATCA	1331	0	UF_Msa_CF_123109	contig28669___0rc	contig28669___0rc	Unknown	
1342	17	30	unmapped	0		0	TATGGTATCATGTGGAAAATAAAAAAGCAGAGCGACAGTCCCACTACCCCTCTCTAAGCC	1333	0	UF_Msa_CF_127575	contig27079___0rc	contig27079___0rc	Unknown	
1343	17	31	unmapped	0		0	TTCACTCAGCTGAAGAAACAAGAGGATGCTGCGATTCCCAGGAGAAAAGAGGCCCTGCAG	1335	0	UF_Msa_AF_105099	contig02823___1_nrnt	contig02823___1_nrnt	Unknown	
1344	17	32	unmapped	0		0	TTGACAGAGAGACACAGGCCATGTTCAGTACCAGCGCCAAAATAGTGAAGCCTAATGGCG	1337	0	UF_Msa_AF_103777	LMB_S454.615.C1___1_nr0nt1	LMB_S454.615.C1___1_nr0nt1	Unknown	
1345	17	33	unmapped	0		0	AGTGGAGATGACAGATGTGACAGACAGAGCCAACGACATAGTCCGGAAAGCCGAGACCCC	1339	0	UF_Msa_CF_119747	contig10635___0	contig10635___0	Unknown	
1346	17	34	unmapped	0		0	TGTGGAGACCTGTGGCAACTGTGAAGAGACAGATGACGATGGGACAGACGCGACTGGCTT	1341	0	UF_Msa_CF_126233	contig03950___0rc	contig03950___0rc	Unknown	
1347	17	35	unmapped	0		0	ACGATGATGAAGAGACTTGTGACTGAAGTTGAGCAGCTCCTACTGTGTGAAATCAAGCCT	1343	0	UF_Msa_CF_123155	contig14208___0rc	contig14208___0rc	Unknown	
1348	17	36	unmapped	0		0	TATGGGCCGATAGTAGATGTCTACATCCCACTTGACTTCTATACACGTCAACCAAGAGGA	1345	0	UF_Msa_AF_109347	contig13670___1rc_nrnt	contig13670___1rc_nrnt	Unknown	
1349	17	37	unmapped	0		0	ATAGCATCAGAGATCAGCAAACTAGAGCCGAACCTGAGAGCCAGCGGTGTAGCGCTGGTG	1347	0	UF_Msa_AF_103022	contig05813___1_nrnt0	contig05813___1_nrnt0	Unknown	
1350	17	38	unmapped	0		0	AACAACCTCCTTTCAAATGCCACCTCAGCCCTGCGCAGATTTATGACGTAGCAAGCCGTC	1349	0	UF_Msa_AF_101267	contig31347___1_nr0nt	contig31347___1_nr0nt	Unknown	
1351	17	39	unmapped	0		0	TGGCTCGAGTCAACGTTAGGTCGCACCGTTTCCTGGTGAACTCCAAAGGCTCGGTGCTAA	1351	0	UF_Msa_CF_119958	LMB_S454.731.C1___0	LMB_S454.731.C1___0	Unknown	
1352	17	40	unmapped	0		0	GGTAACTCCAAGGCAGCTGAAGCAGCAGGCAGTGCGTACTACAATCCCAGCAATCCACAC	1353	0	UF_Msa_AF_102141	contig10745___1rc_nrnt0	contig10745___1rc_nrnt0	Unknown	
1353	17	41	unmapped	0		0	TTTGTACTGTCACAAGAAGTTCCATCAGTCAAATCAGCTGAAGTCCCACATGCAGGTCCA	1355	0	UF_Msa_AF_107628	contig24730___1_nrnt0	contig24730___1_nrnt0	Unknown	
1354	17	42	unmapped	0		0	TTGAGAGCAATGTCTTTATGTACTACGGCTTATCCAACTTCTATCAGAACCACAGACGCT	1357	0	UF_Msa_AF_101680	contig19990___1rc_nrnt	contig19990___1rc_nrnt	Unknown	
1355	17	43	unmapped	0		0	TGAAGAGGAAAAGAACCGACAGCCACAACAAACCACTGGATATAAATAAACTGGTCAAAA	1359	0	UF_Msa_CF_121598	contig32324___0rc	contig32324___0rc	Unknown	
1356	17	44	unmapped	0		0	GGCCGTGCTAACTTTCAAACTGAAGAACACCGGCAGGTTGGAACAGATCCTACCAAACCC	1361	0	UF_Msa_AF_108822	contig10691___1rc_nr1nt0	contig10691___1rc_nr1nt0	Unknown	
1357	17	45	unmapped	0		0	AGTCTCTTGGCAGGCACATGAGAAGTGTGCATAAGAGAGAGAATGTACCTGTATGACTGT	1363	0	UF_Msa_AF_106634	contig23143___1_nrnt	contig23143___1_nrnt	Unknown	
1358	17	46	unmapped	0		0	TTCAGGCAGTCCTCGAGGAAGAAGGAGTGACGTTAGAAGCAATTCTCTGTACACACAAGC	1365	0	UF_Msa_AF_109119	contig03903___1rc_nrnt0	contig03903___1rc_nrnt0	Unknown	
1359	17	47	unmapped	0		0	AATGAAGCTGGCCTTGAGGAGGAAGCCAGTGTCTCGTTCCATGAGCATATCTTCTTGGAG	1367	0	UF_Msa_AF_102809	contig01018___1rc_nrnt0	contig01018___1rc_nrnt0	Unknown	
1360	17	48	unmapped	0		0	ATTGGGATCAGCTCTGTCCTGCTTCGTAAGATCATTGGCTCTCTGGAGGTGGGCTGCGGT	1369	0	UF_Msa_AF_105532	contig07071___1rc_nrnt	contig07071___1rc_nrnt	Unknown	
1361	17	49	unmapped	0		0	AAGTAATATATTCATTTGCCAACGTCCCAGTACAAGTGCAGCAGGTGAAGGGGAGAGTGA	1371	0	UF_Msa_AF_105577	contig09850___1_nr0nt1	contig09850___1_nr0nt1	Unknown	
1362	17	50	unmapped	0		0	CATCCACACGTTCGGAGCCTATTTCGGTCTCATGGTGACTAGAATCCTGTACCGGCCCCA	1373	0	UF_Msa_AF_108705	contig20005___1_nrnt	contig20005___1_nrnt	Unknown	
1363	17	51	unmapped	0		0	CGCCCAACTACAGACTCAAGTCCGTACAGAAGAAGGTGTCGTCGTCTGCCAGCAGGATAT	1375	0	UF_Msa_AF_103811	contig02002___1rc_nrnt	contig02002___1rc_nrnt	Unknown	
1364	17	52	unmapped	0		0	TGGAGGAACAAGCTCTAAGATGGGACAGCCCAGCAACCCAGTGAGACAAGTGGATGCCAG	1377	0	UF_Msa_CF_126096	contig24935___0	contig24935___0	Unknown	
1365	17	53	unmapped	0		0	GCCGAAGGGATTACCTGGGTTTTAGTGTATCGGACTGAAAAGTACAAGAGGTTAAAGGCT	1379	0	UF_Msa_AF_109388	contig14560___1rc_nrnt-1	contig14560___1rc_nrnt-1	Unknown	
1366	17	54	unmapped	0		0	GCTCAGCACCACCAATGGAGGACTATCTATAATTGTTTCTGAAAGTTAACACATCCCAAA	1381	0	UF_Msa_AF_104089	LMB_S454.401.C1___1_nrnt	LMB_S454.401.C1___1_nrnt	Unknown	
1367	17	55	unmapped	0		0	TTTCCAGAGGAGCTCCACATCGCAACGCGTCGTTCACCGAAGTGCTGAGATTTAACAAAG	1383	0	UF_Msa_CF_125064	contig19875___0	contig19875___0	Unknown	
1368	17	56	unmapped	0		0	CGCCAGAGCCGCCGTACCCCAGGACCAGACTCCGCTCAGGGACGGAGAACGACGGCTACA	1385	0	UF_Msa_CF_125269	contig17360___0	contig17360___0	Unknown	
1369	17	57	unmapped	0		0	AAAGTAAAGAGAAAGGCAAAGGCAAAGTACCCCCATTCCCTCACCCACCCTCCTCCCCTT	1387	0	UF_Msa_CF_127133	contig13161___0	contig13161___0	Unknown	
1370	17	58	unmapped	0		0	GGGGACCGCCTGGTTACTTTGGTGAGGAAAAAGGACCAGTTCCTGCACCACATAGACTTG	1389	0	UF_Msa_AF_108398	contig00191___1_nrnt	contig00191___1_nrnt	Unknown	
1371	17	59	unmapped	0		0	AGAGAAAGAGACTGTTCCTACCATCCATGCGGAAAAAGGGCGGCCTCAGCACCACAGAGG	1391	0	UF_Msa_AF_105292	contig18813___1rc_nrnt0	contig18813___1rc_nrnt0	Unknown	
1372	17	60	unmapped	0		0	GGTTCTTCAGAAATGTGCCGTGATCTGGCTGGGGAGGTAGAGAAGCTGCTCAAAACATCC	1393	0	UF_Msa_AF_100085	contig21928___1rc_nrnt	contig21928___1rc_nrnt	Unknown	
1373	17	61	unmapped	0		0	TTTTGTCTCTCTCAAACACACACAAAAACAAGAAGGACTACGCTATCAAGCCATCAACAC	1395	0	UF_Msa_AF_101502	contig25439___1_nr0nt	contig25439___1_nr0nt	Unknown	
1374	17	62	unmapped	0		0	TCTGCTAAGAGGAGAGCAGTGGGTTTGGGTGAAAATCCTGAGGAAAGCGGCAACAGCTCC	1397	0	UF_Msa_AF_106875	contig31287___1_nr0nt1	contig31287___1_nr0nt1	Unknown	
1375	17	63	unmapped	0		0	GACAGGCACCATGCCGTTCAGGGCCGACACTGTGGCCAAACTGAAGCGATGCATCCTGGA	1399	0	UF_Msa_CF_123901	contig00812___0	contig00812___0	Unknown	
1376	17	64	unmapped	0		0	ACCACAATGTTTCATCCCTGGCCCTCAGCATTGCACTCTGTCCCTTTCTCTGGCTCTACC	1401	0	UF_Msa_CF_124081	contig27040___0rc	contig27040___0rc	Unknown	
1377	17	65	unmapped	0		0	AGCTGACGTCACACCCAGCATGGCGGTCAAGGTGCAAGCAACAAAAAGAGCCGACCCCAA	1403	0	UF_Msa_AF_100097	contig14209___1_nr0nt	contig14209___1_nr0nt	Unknown	
1378	17	66	unmapped	0		0	AACACAGCCCTTTCCACCAGGTGGATGCGGACACGTGCTGGCATGAGCTCCATATCCCGG	1405	0	UF_Msa_CF_119754	contig09913___0rc	contig09913___0rc	Unknown	
1379	17	67	unmapped	0		0	ACACAATGTTCTGTCCCGTTCACACTCTCGACCCAACATGCTGAACAAAGTGGAGCATCG	1407	0	UF_Msa_AF_109670	contig17971___1_nr0nt	contig17971___1_nr0nt	Unknown	
1380	17	68	unmapped	0		0	GAGAATGGAGAATGAACATGTAGAGGTCTTGAGTGAGATAAATGAAGTGAACTGTTTTTT	1408	0	UF_Msa_AF_104158	contig29624___1_nrnt	contig29624___1_nrnt	Unknown	
1381	17	69	unmapped	0		0	AGATCTTGTCCTACAACAGGGCCAACAGGGCTGTGGCCATCCTGTGTAACCATCAGAGGG	1410	0	UF_Msa_AF_101209	contig21140___1_nrnt	contig21140___1_nrnt	Unknown	
1382	17	70	unmapped	0		0	AGTGTTGTTGGTTTTAGTTGTGTCTGTGTGGTGCCTCTCCTCTTTAGGATCTTAAACGTT	1412	0	UF_Msa_AF_100848	contig31289___1_nr1nt0	contig31289___1_nr1nt0	Unknown	
1383	17	71	unmapped	0		0	GAGGCAACTGGATAGCCTTAGACTATCTCACCTGCCATAATGTTGATGGACTCGTTTTAT	1414	0	UF_Msa_CF_122174	contig05595___0	contig05595___0	Unknown	
1384	17	72	unmapped	0		0	AAGGAGAGCTACATTCCTTACAGGAACCCTAAGCTTACCTACCTTCTACAGAACTGCTTG	1416	0	UF_Msa_AF_102839	LMB_S454.160.C1___1_nrnt	LMB_S454.160.C1___1_nrnt	Unknown	
1385	17	73	unmapped	0		0	CCCTGCTAAGCAGCTCCTGTTTGCAGAGGACGCTTGGATGTACAGTAAACTACCCCGAGT	1418	0	UF_Msa_CF_121594	contig16818___0rc	contig16818___0rc	Unknown	
1386	17	74	unmapped	0		0	TTTCCCATTGTTAGCGTAAGGGGTTTTAAAGGTAGACAGCATGACAAAAGCGGCTAGCAG	1420	0	UF_Msa_CF_117687	contig11813___0rc	contig11813___0rc	Unknown	
1387	17	75	unmapped	0		0	TTGAAAAGACGACTGCTTTGGCCTGGCCCCCGCCTTAGCTCAGCTAGCAACACAACCTGA	1422	0	UF_Msa_CF_125290	contig03382___0rc	contig03382___0rc	Unknown	
1388	17	76	unmapped	0		0	TCCAAAACAAGCTACAAACAATTCACTGACACAACTCAATACAGTCATAAAGAAACAGTG	1424	0	UF_Msa_AF_109982	contig12025___1_nr0nt	contig12025___1_nr0nt	Unknown	
1389	17	77	unmapped	0		0	AAATGATAACATGGCAGTAGCAAATTGACAAAACGCATGCTCAGTATTAGGACACAGTTG	1426	0	UF_Msa_AF_109634	LMB_S454.sd.642.C1___1rc_nr0nt1	LMB_S454.sd.642.C1___1rc_nr0nt1	Unknown	
1390	17	78	unmapped	0		0	CCTGCGTGGCTGCAGTGTTTGTATCATGTTACTCCTGTGTGACCCTCACCTACGGAGAGG	1428	0	UF_Msa_AF_107463	contig29845___1rc_nr1nt0	contig29845___1rc_nr1nt0	Unknown	
1391	17	79	unmapped	0		0	TTTCTTCCTAAAGAGTCCAAAGACTCGAGCCAACCCATGTTCTTCTGTTCCAAATGGAGC	1430	0	UF_Msa_AF_104498	contig12949___1rc_nr1nt0	contig12949___1rc_nr1nt0	Unknown	
1392	17	80	unmapped	0		0	CGCTCTGTCCTGGTGTGAACCTGCTCTCTCTCTACAAAGACCAGCAGGGAAAGTTCATCA	1432	0	UF_Msa_AF_105044	contig08591___1rc_nrnt-1	contig08591___1rc_nrnt-1	Unknown	
1393	17	81	unmapped	0		0	AATTCAGAGTTTGGAATCAGGAACAGCGGAGAACAGAAACAAGCGGACAAACAGGTGCTT	1434	0	UF_Msa_CF_119501	contig28955___0rc	contig28955___0rc	Unknown	
1394	17	82	unmapped	0		0	AGACAGATGCATTGTCTCTAAGGCGTGAGGCTTGGTTTACAAAAAGATCCCTTGCTGTGT	1436	0	UF_Msa_AD_200200	DQ666527_rc	DQ666527_rc	Unknown	
1395	18	1	unmapped	0		0	CCGCACCTTCTTCAAAGTCGGACCGGGCTCAGCAGATCAGAAGGAGGCCAGTCCGTTTGT	1277	0	UF_Msa_CF_118119	contig20523___0rc	contig20523___0rc	Unknown	
1396	18	2	unmapped	0		0	TGTCTGCTGTGGAATCCTACAGGTTTCTGGGATCCACTATATCCCTGGACCTAATGTGGG	1279	0	UF_Msa_CF_121461	contig04173___0rc	contig04173___0rc	Unknown	
1397	18	3	unmapped	0		0	CTGAAGTTTGACTGTCACATACTGCTGCATGATGTTGGCCACCTGAGCCATGTTGTACAG	1281	0	UF_Msa_AF_103005	contig09672___1_nr0nt	contig09672___1_nr0nt	Unknown	
1398	18	4	unmapped	0		0	AAACCAATCCTCGCCTGCAGTGGTGTTTGTGCCCAGTAGAGTCTGACCAGTTATAATGTC	1283	0	UF_Msa_CF_117799	contig14395___0rc	contig14395___0rc	Unknown	
1399	18	5	unmapped	0		0	AGACTCCAGCATCGGACCAGTACATGATGACATCCTGATAGCTCAGCTCCGACCGGGACA	1285	0	UF_Msa_AF_102821	contig00348___1rc_nrnt0	contig00348___1rc_nrnt0	Unknown	
1400	18	6	unmapped	0		0	AGAGGTTGCCTATATGCCTGGAAACCTCTTCAAAGCACACCGCCAAATTCTTCTGTATCA	1287	0	UF_Msa_CF_126715	contig01224___0rc	contig01224___0rc	Unknown	
1401	18	7	unmapped	0		0	CTGAAAGTCAGCAAAGACGAGCTCAGCTGGTGTCAAACTTACACTTAAAGAACAAACTGG	1289	0	UF_Msa_CF_126684	contig31626___0	contig31626___0	Unknown	
1402	18	8	unmapped	0		0	GACGTATCAGGCTCCACATCACTGCTCCGTGACAAAGTCCTTTCAGGGTCTTGCCTCACC	1291	0	UF_Msa_CF_120040	contig00079___0	contig00079___0	Unknown	
1403	18	9	unmapped	0		0	TTCACAAAGAGAAGACATCCTACTCAAGTTCCTTAAGGAGAGGAAAGGAGGGTCAGAGGA	1293	0	UF_Msa_CF_121712	contig03562___0	contig03562___0	Unknown	
1404	18	10	unmapped	0		0	ATCGCCCAGACCCCCGCCGAACTGTACAACGCCATCCTGGTGGACACGCCCCTGGCTGCA	1295	0	UF_Msa_AF_102944	contig11174___1_nrnt	contig11174___1_nrnt	Unknown	
1405	18	11	unmapped	0		0	TTGACACGGTGTGTGAAGATGAAACTCCCATTGTTGATGGCAGGGCCTGATGTGAATAGG	1297	0	UF_Msa_CF_121794	contig11029___0	contig11029___0	Unknown	
1406	18	12	unmapped	0		0	CAATCGTCATCATGGGAAGCTTCACCAAAACCCCAGCAACAGAAGCCCCAAAGGAAAGGA	1299	0	UF_Msa_CF_122861	contig19970___0rc	contig19970___0rc	Unknown	
1407	18	13	unmapped	0		0	ATGACCGGGACAACCCTGACAGCTACGTCACAGAGGACAGCTATGAAAGTCAGGACCAAG	1301	0	UF_Msa_CF_125961	contig12818___0	contig12818___0	Unknown	
1408	18	14	unmapped	0		0	AGAGAATTCAGAGACCGCTGGGGAGGAGAAGACTGGGAGCTACCTCGACAGAATTCTCCA	1303	0	UF_Msa_AF_100412	contig08518___1_nrnt	contig08518___1_nrnt	Unknown	
1409	18	15	unmapped	0		0	AAGCCAAGGCGGGTAAAGGAGGGTTATGTCCCCCAGGAAGAAGTACCAGTCTATGAAAAC	1305	0	UF_Msa_AF_103163	contig13231___1rc_nrnt	contig13231___1rc_nrnt	Unknown	
1410	18	16	unmapped	0		0	AGATATCATCCAGAAGAATAAGGCTAAACTTACGCGAGAGCAAGAGGAGTTGGAGGAGCT	1307	0	UF_Msa_AF_102392	contig31789___1rc_nr0nt1	contig31789___1rc_nr0nt1	Unknown	
1411	18	17	unmapped	0		0	ATCCTTATGAGATAACCGTACCCATTAGAAGGTTAAAACTATTGTGGTGTCCCAGCAAAG	1309	0	UF_Msa_CF_125645	contig03674___0rc	contig03674___0rc	Unknown	
1412	18	18	unmapped	0		0	CAGCGTGAACACAGCCAATCAGAATCGAGAAAAAGTGTCGCCGAAACTGCTTCCGGGTCC	1311	0	UF_Msa_CF_124197	contig04841___0rc	contig04841___0rc	Unknown	
1413	18	19	unmapped	0		0	ACGGCTACGAGGATGAGTACATAGATGCAGGAAGATGACTGGGACAGGGACATGCTGCTG	1312	0	UF_Msa_CF_118038	contig26485___0	contig26485___0	Unknown	
1414	18	20	unmapped	0		0	AGTCTGCCTGAAGGAGTGTGACAAGCAGGCTGAAGAACGTATGAAAAAGATGTTTGAGAG	1314	0	UF_Msa_AF_108427	contig03086___1_nr1nt0	contig03086___1_nr1nt0	Unknown	
1415	18	21	unmapped	0		0	GCATGATTCAAGGATGAATGGTTGAGCGTATGAGTGCAAATGTGACGGTCACTTCATACC	1316	0	UF_Msa_CF_120955	contig12554___0rc	contig12554___0rc	Unknown	
1416	18	22	unmapped	0		0	GTAAACCCAGACCTGTTCCCCATTCCACATGACTATAACCACCTAATGGGCTATGATAAA	1318	0	UF_Msa_AF_103666	contig02597___1rc_nr1nt0	contig02597___1rc_nr1nt0	Unknown	
1417	18	23	unmapped	0		0	AGACTAGAATACTTAATGGCAGAGGAGAGGGTTCGTCTAGAGGAGAGCCACCGAGAGGCC	1320	0	UF_Msa_CF_123906	contig08047___0rc	contig08047___0rc	Unknown	
1418	18	24	unmapped	0		0	AGCTGCTGAAGCTTTACCCTTGGCAGTGCACACCCTCCATCTGCCCCATCACGACCCAGG	1322	0	UF_Msa_CF_122877	contig10861___0	contig10861___0	Unknown	
1419	18	25	unmapped	0		0	ATCCCAGAACCCTCTCTCCATCATGATGTCACGCATGTCCAAGTTTGCAATGCCCAGCTA	1324	0	UF_Msa_AF_103724	contig19075___1rc_nr0nt	contig19075___1rc_nr0nt	Unknown	
1420	18	26	unmapped	0		0	AATATGCTTGCCAGTCATTTGTTGTGTGAGAGCGATAAAGTCCAGCTTTTCTCATTTTCT	1326	0	UF_Msa_AF_107496	contig07380___1_nr0nt1	contig07380___1_nr0nt1	Unknown	
1421	18	27	unmapped	0		0	ACAAGCTCAGCGGTTTGTCTCCACCTGAAGAGCAGCAAGAATTTTATTTCAAACCCTCGA	1328	0	UF_Msa_CF_126231	contig29431___0	contig29431___0	Unknown	
1422	18	28	unmapped	0		0	CCTCAGTCAAGATGCTCTTGTGCTAAGCCAACACACACGGTAAATACTTATCCTTTATCA	1330	0	UF_Msa_CF_123317	contig13130___0rc	contig13130___0rc	Unknown	
1423	18	29	unmapped	0		0	TGCGATGAACACCAGCAACAGTCCCAGTGCAAGGCCAGAGAACAGTGTGGCCAAGCCAAA	1332	0	UF_Msa_AF_104913	contig09978___1_nr0nt	contig09978___1_nr0nt	Unknown	
1424	18	30	unmapped	0		0	CTGCCTCGACCCAGCACTCACCATCGCCGCCAAGTCTGGCCTTCAAATCACCATTTGTGT	1334	0	UF_Msa_AF_106008	contig25454___1rc_nr0nt	contig25454___1rc_nr0nt	Unknown	
1425	18	31	unmapped	0		0	GAAACAATTGATTGCAATGTGTTCTTGAATGCATTACAGACGGAAATGTTTGTCGTATCA	1336	0	UF_Msa_AF_108255	contig05148___1_nr0nt	contig05148___1_nr0nt	Unknown	
1426	18	32	unmapped	0		0	AATGGACCACACAGCAAATCCATATTGTTAAACCTGCAGGTTTGTTCGACGAGCTCCCCG	1338	0	UF_Msa_CF_119173	LMB_S454.12.C1___0rc	LMB_S454.12.C1___0rc	Unknown	
1427	18	33	unmapped	0		0	CCTGAGACAGCATTTTACATTCAAGTGCAACACGGACTCTGGATTCTGGACAATAATGTT	1340	0	UF_Msa_CF_122579	contig16678___0	contig16678___0	Unknown	
1428	18	34	unmapped	0		0	ACTGGAGTTAATGATTATTGTTGTGTTCTGGAGAGAATCAGAGACGTGCAGAGAAACAGA	1342	0	UF_Msa_AF_109562	contig29060___1_nrnt	contig29060___1_nrnt	Unknown	
1429	18	35	unmapped	0		0	GTTCACTCAAGAGCAAAATGGCCAATGGTTATCCCCAGCATGTACAGAAAATAGGTAAAG	1344	0	UF_Msa_CF_120741	contig22082___0rc	contig22082___0rc	Unknown	
1430	18	36	unmapped	0		0	TTCTAGGATTTGGCTTCTATGTCGTGTTGGGAATAACCTCTCTTCCTTCTGTCAGCAATG	1346	0	UF_Msa_AF_102805	contig00418___1_nrnt0	contig00418___1_nrnt0	Unknown	
1431	18	37		1028	E1A	0		1348	1	(+)E1A_r60_a20	E1A_r60_a20	E1A_r60_a20		CONTROL
1432	18	38	unmapped	0		0	TATAAGTTTTGAGAATTAGCAATGCGACAGACACGTTACGCAGTTCGGCGAAACGACGGA	1350	0	UF_Msa_CF_124925	contig07258___0rc	contig07258___0rc	Unknown	
1433	18	39	unmapped	0		0	CTCAGGGGAAGAAGGTGCTGCTCCTCCCGTAGGAGCAGAGGGCAACATGGAAGCTACAAA	1352	0	UF_Msa_AF_101552	contig09521___1_nr0nt	contig09521___1_nr0nt	Unknown	
1434	18	40	unmapped	0		0	ATGTTTGGCCAGTTGAGCGGTATCACACACTTCAGTGACATCAGCGCGCTGACAGGTGGC	1354	0	UF_Msa_CF_122449	contig08534___0	contig08534___0	Unknown	
1435	18	41	unmapped	0		0	TGTACCGTAATTCCATGCTGCAGCCCTTTTTACGTTCCTGTTACCTCCAACACCCACTAT	1356	0	UF_Msa_CF_127306	contig31654___0rc	contig31654___0rc	Unknown	
1436	18	42	unmapped	0		0	ATTGTGTGTAAAATGTTGTGTTCAAGGCTCCTGCTGTACATCTGTGTCCTCCCATGTTAC	1358	0	UF_Msa_AF_105357	contig02138___1_nr0nt	contig02138___1_nr0nt	Unknown	
1437	18	43	unmapped	0		0	GTGTATATATTTTTTATTTCTAAGTGCAATTACATAATTACAAAGACTGAATGCTAGGTG	1360	0	UF_Msa_AF_104689	contig32344___1_nr0nt1	contig32344___1_nr0nt1	Unknown	
1438	18	44	unmapped	0		0	ACCAACTATAACTCAGCTTATTGTTTGTCGATCAAACGATGGAACTTGTGAAGTTTCATG	1362	0	UF_Msa_AF_101961	contig23741___1_nr0nt1	contig23741___1_nr0nt1	Unknown	
1439	18	45	unmapped	0		0	TTGGCCCTGCGCTGCCACACCAACCCCGCTTATTTTATGAAACCTGTTCCCAAGGGACAG	1364	0	UF_Msa_CF_127309	contig01352___0	contig01352___0	Unknown	
1440	18	46	unmapped	0		0	TCCGAAGCTACGTCACATCGAACGAATCCTCTCCCGCCGACGTGCTGATTGCATAATCAC	1366	0	UF_Msa_CF_127225	contig06526___0rc	contig06526___0rc	Unknown	
1441	18	47	unmapped	0		0	AAACATGGCTGCCTCCGTGGATGACATGTTTTCCTTCTGCGTGGACCCCGGCAAAGTTGC	1368	0	UF_Msa_CF_119685	contig08356___0	contig08356___0	Unknown	
1442	18	48	unmapped	0		0	AGATCTGGACCTGCTGCTGCTACTGCCAGTGGAAGCGCTGCGGCGTCTTTTTACTTTCTC	1370	0	UF_Msa_CF_122134	contig10980___0	contig10980___0	Unknown	
1443	18	49	unmapped	0		0	GAACAGTTGTCAGAACAGCAGAATTAGGAGTTATTTGGGAATGAAAAATGTTTTCACAGA	1372	0	UF_Msa_AF_102016	LMB_S454.sd.519.C1___1_nr0nt1	LMB_S454.sd.519.C1___1_nr0nt1	Unknown	
1444	18	50	unmapped	0		0	TTTTGTACAATATATATTGTCATGAAATCCATTCATACATCCACCCCCTCCATCCACATA	1374	0	UF_Msa_CF_119391	contig13303___0rc	contig13303___0rc	Unknown	
1445	18	51	unmapped	0		0	TCCGCCCGCTCCAAATACATGACCATGTCCTCCAAGCTCAGTAATTGATTTAGATGATGT	1376	0	UF_Msa_CF_127364	LMB_S454.sd.383.C1___0	LMB_S454.sd.383.C1___0	Unknown	
1446	18	52	unmapped	0		0	ATGCCACGATAATCTTAAGATAAACAGAAACCAAATTGCTGCTTCAATGGGTAATGGAGA	1378	0	UF_Msa_CF_121949	contig15855___0	contig15855___0	Unknown	
1447	18	53	unmapped	0		0	CCCTCCAGAAGGAAGTTTTGTTGCTGCCACACAGTCCTCTGTGGAATGTTAAAATAACTT	1380	0	UF_Msa_CF_121026	contig29902___0	contig29902___0	Unknown	
1448	18	54	unmapped	0		0	TCGATGACCACTTCCTGTTCGACAAGCCCGTCTCCCCGCTGCTGCTGGCGTCCGGCATGG	1382	0	UF_Msa_AF_102227	contig10523___1rc_nr0nt1	contig10523___1rc_nr0nt1	Unknown	
1449	18	55	unmapped	0		0	GAAATATTGTTTTACTATTCACACAGGCTGTTCCACCACCCAGGCCTCTACAAGCATTTC	1384	0	UF_Msa_AF_100356	contig26125___1_nrnt	contig26125___1_nrnt	Unknown	
1450	18	56	unmapped	0		0	ACATCATGGCGGACCGGTTCAATAAGGTTCTGCTGCTTGATGGCAGGGGCCATCTACTCG	1386	0	UF_Msa_AF_104349	LMB_S454.804.C1___1rc_nr0nt1	LMB_S454.804.C1___1rc_nr0nt1	Unknown	
1451	18	57	unmapped	0		0	TATTCACACAGTGGAACCCATGCTTCACATGATAGCAGAGGTCGACAACCAAAAGCCAAT	1388	0	UF_Msa_CF_119913	contig28324___0	contig28324___0	Unknown	
1452	18	58	unmapped	0		0	GAAAGGACAGGCAGAGCCGCGGCTTGGAGCTCATTGCATCTGAGAATTTCTGCAGTCGAG	1390	0	UF_Msa_AF_103100	contig09150___1_nr0nt	contig09150___1_nr0nt	Unknown	
1453	18	59	unmapped	0		0	ATGACTGTAATCCAGCGTGAGGAGCAGCGGGCAGCCGAGGACGCCATCATTCCTTCATCT	1392	0	UF_Msa_CF_119485	contig05894___0rc	contig05894___0rc	Unknown	
1454	18	60	unmapped	0		0	TCAGGAAAAGACAGAGAGAGTTCCAGTAGTGCTGAGCAGGGCAGCAAGGTATACAAAAAG	1394	0	UF_Msa_CF_127804	contig04899___0	contig04899___0	Unknown	
1455	18	61	unmapped	0		0	TACAAAACAAATGAGTTGGGTTCGAGTTACCCTGGTAATCAGCATGCAAATATCAGAAGG	1396	0	UF_Msa_CF_121363	contig18796___0	contig18796___0	Unknown	
1456	18	62	unmapped	0		0	GATGAGAGCTGCTCAACCGATTGCTCTGGTACTTCACCACAGCTGAAAAATGTGTGCTGG	1398	0	UF_Msa_CF_120070	contig05428___0rc	contig05428___0rc	Unknown	
1457	18	63	unmapped	0		0	AAACACCTGTAGAGAGCGACAGGTGAGATTACAGACGTGACAGTGGAGTCCACCTGTCTG	1400	0	UF_Msa_AF_105483	contig08885___1_nr0nt	contig08885___1_nr0nt	Unknown	
1458	18	64	unmapped	0		0	ATCAAGACAAGAGATTATCTGTCTGATGGGAACAGCCGTGATGAAGGAGGGAAGAAGAAC	1402	0	UF_Msa_CF_127227	contig26076___0rc	contig26076___0rc	Unknown	
1459	18	65	unmapped	0		0	CAGTTTGGATGTAGTTCCCTCTGTTTTGAGATATTTGCTGGCAATCAAGAATTGTTTTTA	1404	0	UF_Msa_AF_100638	contig21050___1_nr0nt1	contig21050___1_nr0nt1	Unknown	
1460	18	66	unmapped	0		0	AGGAGAGCTTCTGAGGAGCTACGCAAACAGGTCTCTAAAGTGAATGGGCTAGACGCGGGC	1406	0	UF_Msa_CF_123333	contig21153___0rc	contig21153___0rc	Unknown	
1461	18	67		1028	E1A	0		1348	1	(+)E1A_r60_a20	E1A_r60_a20	E1A_r60_a20		CONTROL
1462	18	68	unmapped	0		0	GGTTCACTGGAGCAAGATGGAGGGACGAAACTTTGTCTACAAGATGGAGTCTCCTCATGG	1409	0	UF_Msa_AF_107658	contig05196___1_nr0nt1	contig05196___1_nr0nt1	Unknown	
1463	18	69	unmapped	0		0	ATCCAGATCTACTCTGCAGAACTACCGTGAAGAGACATGAAGGAACTGATGTGAACAAGG	1411	0	UF_Msa_CF_123183	contig01382___0rc	contig01382___0rc	Unknown	
1464	18	70	unmapped	0		0	AAAGGTTTTGACAAGGCGTACGTTGTACTCGGGCAGTTTCTAGTGCTAAAGAAAGACGAG	1413	0	UF_Msa_AF_105401	contig07461___1rc_nrnt-1	contig07461___1rc_nrnt-1	Unknown	
1465	18	71	unmapped	0		0	GTTTCAAGACGAAACCACACCTTTAAGAAAGGAAACAAGGAAAATGCTCAGCCTGCATAT	1415	0	UF_Msa_CF_125759	contig30311___0	contig30311___0	Unknown	
1466	18	72	unmapped	0		0	GAAAATGAGCAAACTAAACTCATTGCAATGGTTTCACTAAACTCATGTGCATTCTCCTGT	1417	0	UF_Msa_AF_100239	contig04124___1_nrnt	contig04124___1_nrnt	Unknown	
1467	18	73	unmapped	0		0	GCCACTAAGAAAATGAGAATACATACTGTATAGCTGGAGGACAATGCGTATGATAATTAT	1419	0	UF_Msa_AF_108607	contig19460___1_nr0nt1	contig19460___1_nr0nt1	Unknown	
1468	18	74	unmapped	0		0	CGGAGGCGAACAGGGAGTCACCGCGGGCGCATCTGTCGCTTTACATCTCGACGCTTCACG	1421	0	UF_Msa_CF_124188	contig07009___0	contig07009___0	Unknown	
1469	18	75	unmapped	0		0	CCAGAGGACACTTTCAGTGTTCAGCCTAGTTCCGCCTGCTATGCCATGTCGGTTTCCAAA	1423	0	UF_Msa_CF_117855	contig04174___0	contig04174___0	Unknown	
1470	18	76	unmapped	0		0	TAACAAGTGTTTTGAGCCGGAGAACACAGGCCACGGCCTTGTCCTCATCGACCTCGGACA	1425	0	UF_Msa_AF_107394	contig06727___1_nr1nt0	contig06727___1_nr1nt0	Unknown	
1471	18	77	unmapped	0		0	TATGCGACTACAGGAGCGCGGCGTCACCCGTGTGCATCACAGCCTGATCATAAGTTCACT	1427	0	UF_Msa_CF_123500	contig09473___0rc	contig09473___0rc	Unknown	
1472	18	78	unmapped	0		0	ATAACAGAAGCTTTGGAGGAGCGAGAACATCAGAAGGCAACAGAACCCATAAGTGGTGAT	1429	0	UF_Msa_CF_119700	contig09714___0rc	contig09714___0rc	Unknown	
1473	18	79	unmapped	0		0	AGGCGCCTTACCCCTGCAGGCAGTGCGGTGCCATCTTGCGGCAGCCCTCCCTCATCATCT	1431	0	UF_Msa_CF_120151	contig19187___0rc	contig19187___0rc	Unknown	
1474	18	80	unmapped	0		0	TTCAAAAATACCAGATGGAGAAAAAGGAGCAGCAGAACAAGACTGACTATCAGGTGGAAG	1433	0	UF_Msa_CF_126569	contig00447___0	contig00447___0	Unknown	
1475	18	81	unmapped	0		0	CGTGTAGCTGTGAGGCTACACGGAGTATCAGGGTATGGACCCAAGGGCAGACACGGAAAA	1435	0	UF_Msa_CF_125059	contig18038___0	contig18038___0	Unknown	
1476	18	82	unmapped	0		0	TTCAGGTCAGAGGCTGAGTGCTGAACACATGAGTACAGACTAGTGGAGATGTTTTATGAG	1437	0	UF_Msa_CF_126338	contig13908___0rc	contig13908___0rc	Unknown	
1477	19	1	unmapped	0		0	CAGGGATGGTCAAAAATACATCAAAATGTATTTTAAAATCAAATTACAAATACTCAGAAA	1438	0	UF_Msa_AF_108544	contig10927___1_nr0nt1	contig10927___1_nr0nt1	Unknown	
1478	19	2	unmapped	0		0	CAAAATGCCAAACATGACCGCCATGCTGGCTTCATTCATCAGATGAAGCTGGAGAGTGCT	1440	0	UF_Msa_AF_109531	contig14176___1rc_nrnt	contig14176___1rc_nrnt	Unknown	
1479	19	3	unmapped	0		0	GGCTGAAATTGGTCCAAGATGGCGCCCCGGCATTGGAGTAATAAATACAAGTGGTTTTTA	1442	0	UF_Msa_CF_118904	contig22999___0	contig22999___0	Unknown	
1480	19	4	unmapped	0		0	AAGTGTCAGAGGTGCTGCACAAGGCTGTGATTGAGGTGGATGAGACAGGGACCACTGCAG	1444	0	UF_Msa_AF_101116	contig19147___1rc_nrnt-1	contig19147___1rc_nrnt-1	Unknown	
1481	19	5	unmapped	0		0	GGCATCGCTGATTCTGTGTTTCAGCTGGTGTTGAATGTGCGCAGATGTGCCAGAGAGGTG	1446	0	UF_Msa_CF_122258	contig17451___0rc	contig17451___0rc	Unknown	
1482	19	6	unmapped	0		0	GGATGTGTGGCTCTGAAGTCCAACTACATCATCAAGTGTTGGACCTTTATACAGCATAGA	1448	0	UF_Msa_CF_120716	contig31137___0rc	contig31137___0rc	Unknown	
1483	19	7	unmapped	0		0	GCAGATCTGTAATGGCCGCGGTACTTGTGAATGTGGAGTCTGCAAATGCACCAACCACCA	1450	0	UF_Msa_AF_109003	contig21004___1rc_nr1nt0	contig21004___1rc_nr1nt0	Unknown	
1484	19	8	unmapped	0		0	CTGAGAAAGCAGAGACCACAGTGATGAAGGAAAAGATGTGTAGATGATTGATGGAATGTT	1452	0	UF_Msa_CF_126486	contig13358___0	contig13358___0	Unknown	
1485	19	9	unmapped	0		0	AGTCTTCAAACAGACCCTTGCTAAAACCTCAGACAAGCTGACCGGTGCCAACATCAAAAT	1454	0	UF_Msa_AF_103694	contig20762___1rc_nrnt0	contig20762___1rc_nrnt0	Unknown	
1486	19	10	unmapped	0		0	TGGTAGCAGTGCTCAAGAAATCTGTGGAAGGAGCAGATCTTCCCAACTTGCTTTTCTATG	1456	0	UF_Msa_AF_108390	contig05383___1rc_nrnt	contig05383___1rc_nrnt	Unknown	
1487	19	11	unmapped	0		0	CACGCAAGTTGGTAAAACATCATGTTTACCGAACCTGGTGTTTTTATTGATGCATTTAAA	1458	0	UF_Msa_AF_102511	LMB_S454.0.C1___1_nrnt	LMB_S454.0.C1___1_nrnt	Unknown	
1488	19	12	unmapped	0		0	ATAGGCTACAGAGCAACCATCAGTGCACCACACATGCATGCTCATGCTTTGGAGCTGTTA	1460	0	UF_Msa_AF_105007	contig06234___1rc_nrnt	contig06234___1rc_nrnt	Unknown	
1489	19	13	unmapped	0		0	GAGAAAGAGCTGAAATCAATCTGCAACGACATTCTGGATGTACTGGACAAGCACCTCATC	1461	0	UF_Msa_AF_109240	contig28022___1rc_nrnt	contig28022___1rc_nrnt	Unknown	
1490	19	14	unmapped	0		0	TTCAATTCCATGAAAACTAAACTCCACTGTCCTGATGTGGAGGCAGAAATCTCCAAAGAC	1463	0	UF_Msa_CF_118993	contig16711___0	contig16711___0	Unknown	
1491	19	15	unmapped	0		0	GGCTTTATAAACTCCATGGGCTGAACATCAACTACAACTGTGAGATCTGTGGAAACTACC	1465	0	UF_Msa_AF_105575	contig00529___1rc_nrnt	contig00529___1rc_nrnt	Unknown	
1492	19	16	unmapped	0		0	ATTTTTTGACAGTATGACCCCGTTAATCCCATCAGGCTTCATACTTCTTCCCTGCTCGGT	1467	0	UF_Msa_AF_109459	contig01138___1_nr0nt1	contig01138___1_nr0nt1	Unknown	
1493	19	17	unmapped	0		0	GAACATGGCTCTGGAGCCCTGACAGCTGAACTGCACTGATCCACGTACAGTGAAGGATGA	1469	0	UF_Msa_CF_119750	contig30067___0rc	contig30067___0rc	Unknown	
1494	19	18	unmapped	0		0	AATCTACATCTTTGTGAGCCACCTTTATCCAGTTGTTATCTGGCTGACAGAAGCGTGCTG	1471	0	UF_Msa_AD_200255	LMB_Add_99	LMB_Add_99	Unknown	
1495	19	19	unmapped	0		0	GTGAAGGCTTTGAAGATAATGAGGAGAAAGAGATGTTTGTGGAGAATGTTCTCACAGAAG	1473	0	UF_Msa_AF_102793	contig16681___1rc_nrnt0	contig16681___1rc_nrnt0	Unknown	
1496	19	20	unmapped	0		0	TGGTTAGGCTTGAAACCAACACATGGGGGTTCGATTCCTCCCTTTCTCGTTAGTTTGATT	1475	0	UF_Msa_AF_102745	contig24133___1_nr0nt1	contig24133___1_nr0nt1	Unknown	
1497	19	21	unmapped	0		0	CAGCAGCAGTAAAGACAAAGGGTCAATAAAGAACTCAAATCAAGACTCTGCAAAGAAGGA	1477	0	UF_Msa_CF_126020	contig12876___0	contig12876___0	Unknown	
1498	19	22	unmapped	0		0	AGGAGTCTCAATCTTACAAGCAATCCCAAAAATATCTCACAGACGATGACAGGTCTTGGC	1479	0	UF_Msa_CF_127820	contig25006___0rc	contig25006___0rc	Unknown	
1499	19	23	unmapped	0		0	AGACAGGACTTCAGCCCTTCAGCTGCTGTCCTGTTTGCTACCTGCCAGAAACTTCTCCTG	1481	0	UF_Msa_CF_123311	contig03731___0	contig03731___0	Unknown	
1500	19	24	unmapped	0		0	CTTCACACCAACTGCTATAATCGGCCTCAACAAGGACCTCAAGATGCCTAAGGTGCAGTA	1483	0	UF_Msa_AF_109814	contig02629___1_nrnt	contig02629___1_nrnt	Unknown	
1501	19	25	unmapped	0		0	GAAGTTTGGTATGATGATAAGGATAGCTGTGAAAGAGGGTGGATCCGACCCAGACATGAA	1485	0	UF_Msa_AF_106814	contig11083___1_nrnt	contig11083___1_nrnt	Unknown	
1502	19	26	unmapped	0		0	AAGAAGTTTGACTCCCTGCTTGCTAAGGAGGTAAGGGATATCTTATCCCTGATTGAGGGT	1487	0	UF_Msa_AF_103786	contig21368___1rc_nrnt0	contig21368___1rc_nrnt0	Unknown	
1503	19	27	unmapped	0		0	ATGCTGAACTTTATCTACCAGAAAGAGCTCTTCTTCCTTCCACTAGGCTTTGCGCTCAAG	1489	0	UF_Msa_AF_105573	contig22026___1_nrnt0	contig22026___1_nrnt0	Unknown	
1504	19	28	unmapped	0		0	TTTGGGAAGCCAAGGATTTGTCTATGTCATGGCCAATAAACAGCCATTGTGGAACGAAGC	1491	0	UF_Msa_AF_110181	contig24917___1rc_nrnt	contig24917___1rc_nrnt	Unknown	
1505	19	29	unmapped	0		0	CCCCAAGAAGGACTTGCCTGATTCTGTCCAGTCTCAGCCCTCGAGGAAGGGCAAACTAAG	1493	0	UF_Msa_AF_104378	contig02359___1_nrnt	contig02359___1_nrnt	Unknown	
1506	19	30		1028	E1A	0		418	1	(+)E1A_r60_a135	E1A_r60_a135	E1A_r60_a135		CONTROL
1507	19	31	unmapped	0		0	ATAACAATGAGCTCTCACAGTCGGTCAGTGGACGTGAGCACTGCAGCACTGCCCATGCAG	1496	0	UF_Msa_CF_121062	contig01919___0	contig01919___0	Unknown	
1508	19	32	unmapped	0		0	GAGGGAATCACTCCCTAACACTGGTGGCTGAACTTCTGTTAAAGACGCAGCAAAAACAGG	1498	0	UF_Msa_CF_125688	contig04043___0	contig04043___0	Unknown	
1509	19	33	unmapped	0		0	GGTGATGCAAATGGGTATTGACAAAGGCGATTTCATTGAGAATGCAGAGTTTTCTGGGAA	1500	0	UF_Msa_CF_122474	contig20494___0	contig20494___0	Unknown	
1510	19	34	unmapped	0		0	ATGAACTGTAGGACAAAGGAATACAGAGCAGGGATTTTCTACAAGGTAGGTAGGAAGGGA	1502	0	UF_Msa_CF_122708	contig17615___0	contig17615___0	Unknown	
1511	19	35	unmapped	0		0	CTTCAAGATGCAGCACATGCACTGGCTGAGACAAAACCCCTATAGCTGCCATGAGAACTT	1504	0	UF_Msa_AF_108704	contig14980___1_nrnt	contig14980___1_nrnt	Unknown	
1512	19	36	unmapped	0		0	GTCCGAGAAGAAAGACATAAGGAATACATTAAAATGCTGAAGGAGAGGAAGGAAGCACTT	1506	0	UF_Msa_AF_102842	contig05020___1rc_nrnt-1	contig05020___1rc_nrnt-1	Unknown	
1513	19	37	unmapped	0		0	CTCTTTATGCCATGAACTCGTAGGGGATGGGCTCCAGCAGCAGTGGCACGTTCTTCTTGG	1508	0	UF_Msa_AF_109753	contig04828___1_nr0nt1	contig04828___1_nr0nt1	Unknown	
1514	19	38	unmapped	0		0	CGACACATGAAGTCACATCCATTAATGGTCAGAAAATGGAATGTGACAAATCTTATAACA	1510	0	UF_Msa_CF_123346	contig22217___0rc	contig22217___0rc	Unknown	
1515	19	39	unmapped	0		0	CAGGAGCTACAGGAAGCACTGCATGCCAAAGTCAACAGCCCTGGAGAGTGAACTCAAGCG	1512	0	UF_Msa_CF_125121	contig21876___0rc	contig21876___0rc	Unknown	
1516	19	40	unmapped	0		0	CTACGCACACTTCCGGGACGTCACAATAAAAGTACAACGCTTGTTTAACTTTTAGCTTCC	1514	0	UF_Msa_CF_117919	contig12348___0rc	contig12348___0rc	Unknown	
1517	19	41	unmapped	0		0	ATCGACCCAGGTGTCTTTCTCCATGATAGTTTGGATGGAAGCAACGAGTGCTTCACTAAT	1516	0	UF_Msa_CF_124844	contig13442___0	contig13442___0	Unknown	
1518	19	42	unmapped	0		0	TATGAACATTACCAGCTTTGTGTCAGCTCATTCACCTACACAGTTCTTTGGAGAGAGCTC	1518	0	UF_Msa_CF_123010	contig12954___0	contig12954___0	Unknown	
1519	19	43	unmapped	0		0	CCTCGCCAAGGACAAGCAGCGTACCTTCATTCCCAACATGGTCAACAACGAGACCTATGG	1520	0	UF_Msa_CF_123657	contig18600___0	contig18600___0	Unknown	
1520	19	44	unmapped	0		0	TACGACAACAACAGGAAGACGGAGAACTAACACGTTGCCGGTGATGGCTCAGCAGGCGAA	1522	0	UF_Msa_CF_126956	contig23789___0	contig23789___0	Unknown	
1521	19	45	unmapped	0		0	GCAGAGGCACCGACGCACTTTCAGGAGTTCATCCGTCTGCACGGCGCTTCATCATAGATA	1524	0	UF_Msa_CF_124420	contig11213___0	contig11213___0	Unknown	
1522	19	46	unmapped	0		0	ATTTTAAAATGCTACAAGGCAAACACAGGAAAGACTCTGTCCTGCTCGAGTATCGCCTCG	1526	0	UF_Msa_AF_100967	contig25653___1_nrnt0	contig25653___1_nrnt0	Unknown	
1523	19	47	unmapped	0		0	GGAATGTGTAGCAGAAAGTGTTACCACATTCATTTCTTCCTTTCTGATTATGAACTTACT	1528	0	UF_Msa_CF_120215	LMB_S454.sd.566.C1___0	LMB_S454.sd.566.C1___0	Unknown	
1524	19	48	unmapped	0		0	GGTTGTCCGTTTTCCTTTAATTCATTTGATCCATCAAAGGATTTACAAAGCCTGCTATTT	1530	0	UF_Msa_AF_102932	contig22703___1_nr0nt	contig22703___1_nr0nt	Unknown	
1525	19	49	unmapped	0		0	TTCTGAGTGTGGTGTTGATGTACACAATTGTCCCACAATGCATTGCACGGCGGAAATATG	1532	0	UF_Msa_CF_119500	contig32766___0rc	contig32766___0rc	Unknown	
1526	19	50	unmapped	0		0	CCTGAAATGTATGGACACTTATTGATGATCTTGAAAATCAACCTGCCGTTTGTTAATTTG	1534	0	UF_Msa_AF_109604	contig28516___1_nrnt	contig28516___1_nrnt	Unknown	
1527	19	51	unmapped	0		0	GTGATGTGACCACGTCATCCACATGTTAAATTTCTTCAAAATACTAAAGTGTATCATCAC	1536	0	UF_Msa_AF_109311	LMB_S454.sd.140.C1___1_nrnt	LMB_S454.sd.140.C1___1_nrnt	Unknown	
1528	19	52	unmapped	0		0	GGTATAATGTAGATCCCATCATTAGCATGACGGCATGTTGAATTTATGCCATTTCAATAT	1538	0	UF_Msa_CF_123054	contig19526___0rc	contig19526___0rc	Unknown	
1529	19	53	unmapped	0		0	GACGCAGACAGCTTGCCCAGAGATCCGAGGAAAACAACTACATCATCGCCGTAAGGGAGC	1540	0	UF_Msa_AF_104154	contig14068___1_nrnt0	contig14068___1_nrnt0	Unknown	
1530	19	54	unmapped	0		0	ACTTCCACCAGACTCCCAGCTGCCGGAGGCTGGAGCTGCAGCACCACAGAAGTAACTCTC	1542	0	UF_Msa_CF_117900	contig08088___0rc	contig08088___0rc	Unknown	
1531	19	55	unmapped	0		0	AATCCTCTGCTGCTGTGTTAGCAGCTTTGGCATTGAGCATGGAGTGTGCATTTATTTTCA	1544	0	UF_Msa_AF_107276	contig28725___1rc_nrnt	contig28725___1rc_nrnt	Unknown	
1532	19	56	unmapped	0		0	CCAGCGCTGACCAGGATGGTCTGGAAACTACTATGAGCAGCCAGGGGCAGGGAGAGGAAA	1546	0	UF_Msa_CF_125264	contig07615___0	contig07615___0	Unknown	
1533	19	57	unmapped	0		0	CGGTGCACAGAAAGGAAAAAGACTTAAAAGATTCTGGTGGAAAGAAATCTACTGATGGGG	1548	0	UF_Msa_CF_122958	contig23080___0	contig23080___0	Unknown	
1534	19	58	unmapped	0		0	GCCGAATGATGTGAACTGTATCGTCTCCGGGACGGGTTGATATATTTTGTTTGTGATTGT	1550	0	UF_Msa_CF_118016	contig12692___0	contig12692___0	Unknown	
1535	19	59	unmapped	0		0	AAATGCGAAGTGTGTAAGTTTCTGACAGTAGAGCTGCAGGATGCTCTGGAGAAAACTGGT	1552	0	UF_Msa_AF_103030	contig16425___1rc_nrnt0	contig16425___1rc_nrnt0	Unknown	
1536	19	60	unmapped	0		0	ATACCATTTCTACCATGTGGTCTTTTTCTTAATCGGCGCGTATTTCTTCTGCTGCCCTCA	1554	0	UF_Msa_AD_200191	LMB_Add_4	LMB_Add_4	Unknown	
1537	19	61	unmapped	0		0	GAGAGAGAGGCTCTCTGGAGCCACAGGTGTTCGGCCCTTGTGGAGGCTCCTGGACACGAG	1556	0	UF_Msa_CF_120670	contig03560___0	contig03560___0	Unknown	
1538	19	62	unmapped	0		0	AGAGATTGACATAGATGAGCTTTTGGAGCTGACGGACGAGGGGCAGAGAACCCGGCTGCA	1558	0	UF_Msa_AF_104361	contig11575___1_nr0nt	contig11575___1_nr0nt	Unknown	
1539	19	63	unmapped	0		0	CGATTAAGAAGCAACGACTTGAGCCGAAGCCCTGTAAACTCTGCTCTAAAGTCTTCCGGA	1560	0	UF_Msa_CF_124293	contig16734___0	contig16734___0	Unknown	
1540	19	64	unmapped	0		0	ACCACCAGTCCCAGTCTCAGCACATTACTACAATGAGCAGCATGCAGGAGACCAACACCT	1562	0	UF_Msa_CF_122455	contig00702___0rc	contig00702___0rc	Unknown	
1541	19	65	unmapped	0		0	TCAGGACTCGACAAGAAAATGTGTATGTCAGAACGTAGACAGAATGCCCTAAAGACTCCG	1564	0	UF_Msa_CF_125527	contig26146___0rc	contig26146___0rc	Unknown	
1542	19	66	unmapped	0		0	AGAAAATGGCAGCAATTCCATCAAGTGGCTCCCTCATCGCCACCCATGATTACTATAGAA	1566	0	UF_Msa_AF_106946	LMB_S454.sd.127.C1___1rc_nr0nt1	LMB_S454.sd.127.C1___1rc_nr0nt1	Unknown	
1543	19	67	unmapped	0		0	TTTTCGGGGAGATGGGTGTGTGATGGCACAGATGACTGCGGAGACGGCACAGATGAGCTT	1568	0	UF_Msa_AF_109898	contig13989___1rc_nr0nt	contig13989___1rc_nr0nt	Unknown	
1544	19	68	unmapped	0		0	CAACAGGAGATTGGCCACAATTTTTTGATTGACTTTTTATTCTTCATCCCTCATGAAAAC	1570	0	UF_Msa_AF_103842	contig11673___1_nr0nt	contig11673___1_nr0nt	Unknown	
1545	19	69	unmapped	0		0	ACACACAGACTGAGGGTTTATTTGTCCCCACTGATTATAAAGAAATATGTAAACAAACAC	1572	0	UF_Msa_AF_108318	contig20631___1_nrnt	contig20631___1_nrnt	Unknown	
1546	19	70	unmapped	0		0	TTCAGTCGATGCAGGCGTTGGTCCACCCTGTGCGGCTGCAGAGGCTCACCATCCAGCCGA	1574	0	UF_Msa_CF_118029	contig21079___0rc	contig21079___0rc	Unknown	
1547	19	71	unmapped	0		0	GGAGCTGGCTGCAGCTGGCAACCGTCGCTGAGGCCGAGGCCGAAGCCCTGCTTCCACCTA	1576	0	UF_Msa_CF_118918	contig29745___0rc	contig29745___0rc	Unknown	
1548	19	72	unmapped	0		0	CTTGCAGAAAGGCGGATCCCTCTCTGCCTCTCAGAACTTCTTTTGAGCCTATTTTTACCT	1578	0	UF_Msa_CF_121586	contig10201___0	contig10201___0	Unknown	
1549	19	73	unmapped	0		0	AATGAAAAGGGCACGAAGTTGTGAACATTTGTCATAGATCAAGAGACCTGGCTGTGACCC	1580	0	UF_Msa_CF_119342	contig31617___0	contig31617___0	Unknown	
1550	19	74	unmapped	0		0	ATGGCTGAGGAGCAGTTATAGTTTGCATCATCTATACAACAGGCTATAAAACACCACTTT	1582	0	UF_Msa_AF_109277	contig11858___1_nr0nt1	contig11858___1_nr0nt1	Unknown	
1551	19	75	unmapped	0		0	GTCCAACTCCAGAGTAAAAATCTATCAAGTGCAAACTATAGAACCATGCTCAGGTCAGAG	1584	0	UF_Msa_CF_124160	contig28644___0	contig28644___0	Unknown	
1552	19	76	unmapped	0		0	TGACCTGCCTGAAGCCTGCAGCATCATTGCTGTCCTGGAGGAGTTCCTCAAGGAACAGTC	1586	0	UF_Msa_CF_121301	contig30270___0	contig30270___0	Unknown	
1553	19	77	unmapped	0		0	TCCCCAACGACTACGAGAAGGTGGTGAAGCGGCACCGAGAAGAACGGCAACGGCAGAGGA	1588	0	UF_Msa_AF_109371	contig06458___1_nr0nt1	contig06458___1_nr0nt1	Unknown	
1554	19	78	unmapped	0		0	ATCCTGACGAATGGGAACGATGGAACAGCTCGTGAACGGGTGACAGCAGGTAATGGAGAC	1590	0	UF_Msa_CF_124209	contig03491___0	contig03491___0	Unknown	
1555	19	79	unmapped	0		0	ACCAGTGGAACCAACAGACTACATCGTCTCTGATCGAGTTGTTATGGAAACTGCCTTACT	1592	0	UF_Msa_AF_104994	LMB_S454.sd.86.C1___1_nrnt	LMB_S454.sd.86.C1___1_nrnt	Unknown	
1556	19	80	unmapped	0		0	AAACTAAACCCACAGAGCAGCTTCTGTTGAGTCCCTAATGTTCGCTTTCAACGTCATGTC	1594	0	UF_Msa_CF_121969	contig14542___0	contig14542___0	Unknown	
1557	19	81	unmapped	0		0	AGAGAACCCCTGAAGATGTCGGAGACACTCTATGACGGCTTTGAGAAGATGGGAAAGAAA	1595	0	UF_Msa_AF_109918	contig26302___1_nrnt0	contig26302___1_nrnt0	Unknown	
1558	19	82	unmapped	0		0	TGGTGATCGGAGGCACAGCCATGCTGCCAGGTTTCCTGCACCGTCTGCTGGCAGAGATAC	1597	0	UF_Msa_AF_101843	contig01803___1_nrnt0	contig01803___1_nrnt0	Unknown	
1559	20	1	unmapped	0		0	TTCAAGAAAATACGACACAGATTTCAGAAGCATTAGAGACGACTTCTTTTACTGCTGTCA	1439	0	UF_Msa_CF_124152	contig12890___0	contig12890___0	Unknown	
1560	20	2	unmapped	0		0	AGTGGAGATGTTGCAGGGTGGAAAGCTGGACTCACAGACATTTCCCTGGCGAGACTGGGA	1441	0	UF_Msa_CF_122027	contig16449___0	contig16449___0	Unknown	
1561	20	3	unmapped	0		0	GATCTCAGCGCGCAAATGTATTTTCTAATGTTGATAAACCTTCCTTGTTTGGATTGTATT	1443	0	UF_Msa_AF_107872	LMB_S454.344.C1___1_nr0nt	LMB_S454.344.C1___1_nr0nt	Unknown	
1562	20	4	unmapped	0		0	TTACTGAGGCTGACACATACACACACGACCATATTGCATCTGATCCGACTTCATAGTGAG	1445	0	UF_Msa_CF_123756	contig29794___0	contig29794___0	Unknown	
1563	20	5	unmapped	0		0	TGGTCATGGATAAATTCTACAAGGATGGAAAAAGGCTGAAATACCACACCATGCCCTGGG	1447	0	UF_Msa_AF_102744	contig06759___1_nrnt0	contig06759___1_nrnt0	Unknown	
1564	20	6	unmapped	0		0	CATCAGGAAAGCGTTGAGCGTTTCCTTGATTGTGTTTGAGAGGATGGATGTAGACAAATT	1449	0	UF_Msa_AF_101673	contig24914___1rc_nr0nt1	contig24914___1rc_nr0nt1	Unknown	
1565	20	7	unmapped	0		0	TAAACCGGATATCCGTTCTGCTCCCCGAGCGACGAGAAACTTCGCCACACGTGGAGTTCA	1451	0	UF_Msa_CF_121764	LMB_S454.245.C1___0	LMB_S454.245.C1___0	Unknown	
1566	20	8	unmapped	0		0	TGGTGAAGGGGATCTAGAGTTTCACATTGGACTAATGAATGCTGACTTCAGATACGGTGC	1453	0	UF_Msa_CF_120599	contig26073___0	contig26073___0	Unknown	
1567	20	9	unmapped	0		0	AGAGCCTAACCAGCAGTTTAGTCAAACCAACCAGATACACATAATTACTAGCTCCTCATC	1455	0	UF_Msa_CF_122256	contig31448___0	contig31448___0	Unknown	
1568	20	10	unmapped	0		0	GTCACGTTTCAAACATTAGAAACAAACGGCTCTAACATCCTGACCAGCTGACGAGTATCA	1457	0	UF_Msa_CF_127371	contig30528___0	contig30528___0	Unknown	
1569	20	11	unmapped	0		0	AAGAAACAAGAAGAGGAGCAGCTGTGAAGAATTTCCAGCCAAACGGCAGAGACTAAGCTT	1459	0	UF_Msa_AF_105942	LMB_S454.sd.278.C1___1rc_nr1nt0	LMB_S454.sd.278.C1___1rc_nr1nt0	Unknown	
1570	20	12		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
1571	20	13	unmapped	0		0	ACATCCTGGCATACAAGGAGCACTTGAAATCAAAGATTGAAAAGCAAGCGCATGACATAC	1462	0	UF_Msa_AF_101816	contig30385___1_nrnt	contig30385___1_nrnt	Unknown	
1572	20	14	unmapped	0		0	ACTTGGAAGTTTGATACAAAGTTACGGGTTTGCCTCGCTGCGCTATGCAGCTGCTGGAGC	1464	0	UF_Msa_CF_125932	contig23030___0rc	contig23030___0rc	Unknown	
1573	20	15	unmapped	0		0	AGAAAGACCGTGTTCACCACGATGAACCCCTCAGCAACCGAGAGCACGATGATGCAGAGG	1466	0	UF_Msa_AF_104104	contig22101___1rc_nrnt	contig22101___1rc_nrnt	Unknown	
1574	20	16	unmapped	0		0	GAAGTTAGGTGACGTGAAAATAATGATTCAGCTAACGGCCCGTCTCTGTTTATCAGAGGT	1468	0	UF_Msa_AF_110222	contig28282___1_nr0nt1	contig28282___1_nr0nt1	Unknown	
1575	20	17	unmapped	0		0	CATGAAGCAGTATTCAACATTGGCAGCAGAGCACGTCTAAGTGGGCATTTAGTCTTTTTT	1470	0	UF_Msa_AF_106229	contig21099___1_nr0nt1	contig21099___1_nr0nt1	Unknown	
1576	20	18	unmapped	0		0	TTATTCCCTGTTGTAAGGATGTATTCAGACAGATAAATTACTGTCGGGGCGGCCTGTGGT	1472	0	UF_Msa_CF_123324	contig25655___0	contig25655___0	Unknown	
1577	20	19	unmapped	0		0	CTACGGCTCACCGCCGCAGTAATGATCACTAGGAGGTGGTGCAGGACAAGATCTTGCACA	1474	0	UF_Msa_CF_117881	contig31292___0rc	contig31292___0rc	Unknown	
1578	20	20	unmapped	0		0	CCCTCTGCAAAGCGTCCAGACTGCCCCGGAGACGACAACACGCCTGTCAGGGTGAAGAGG	1476	0	UF_Msa_AF_108633	contig24319___1_nr0nt1	contig24319___1_nr0nt1	Unknown	
1579	20	21	unmapped	0		0	GGAGGACCCAAACCACACAGACAAAGAGACAAAGTGTTGGGGTGATAATGATCCCATTGA	1478	0	UF_Msa_AF_106013	contig14185___1rc_nrnt	contig14185___1rc_nrnt	Unknown	
1580	20	22	unmapped	0		0	TGCTCAGACATACTACTACACTGAGATCCGGCGAGTCAAATCACACAAAGAGTTCCTCAA	1480	0	UF_Msa_AF_102806	contig19662___1rc_nrnt	contig19662___1rc_nrnt	Unknown	
1581	20	23	unmapped	0		0	CTTCCATGCTCGTTTAAAACCCACGGAGAAAGAACCACCAACAATGACAACTTGGAAATG	1482	0	UF_Msa_CF_124997	contig09749___0rc	contig09749___0rc	Unknown	
1582	20	24	unmapped	0		0	CCCAGCTCATCCAGGACATGAATTCAAAGCCATTTCAGCCCTCACTAGTTCTTCCAGCAG	1484	0	UF_Msa_CF_124409	contig19783___0	contig19783___0	Unknown	
1583	20	25	unmapped	0		0	TCTTCACTGTGCCGCTCGTCTGGACTCTTACCAATGTCATCCACAACCTGGTGATGTACC	1486	0	UF_Msa_AF_103546	contig01404___1rc_nrnt	contig01404___1rc_nrnt	Unknown	
1584	20	26	unmapped	0		0	AAAGAGCCATGGCGGCCACGGGTGGAGGGAAAATTAGGAGCAGGAGATATCACATCGCCT	1488	0	UF_Msa_CF_124345	contig26289___0	contig26289___0	Unknown	
1585	20	27	unmapped	0		0	CTGGACGTGTTCCTGGGTCTGATGGCAGCAGCGGCCCACGACGTGGACCATCCAGGGGTC	1490	0	UF_Msa_AF_104847	contig00904___1rc_nrnt0	contig00904___1rc_nrnt0	Unknown	
1586	20	28	unmapped	0		0	CACCATGGTCGTGTGTGTGGTGGTGGTCGTTGTTGTCAGCGTGCTTGTGGGTTTTGTCGT	1492	0	UF_Msa_CF_120977	contig19418___0rc	contig19418___0rc	Unknown	
1587	20	29	unmapped	0		0	TCTGCCATCTTGGCTCGCCTGTGCTCAACCGGCAGCAACAGCGACAAGACTTCCGTCCCA	1494	0	UF_Msa_CF_123409	LMB_S454.408.C1___0rc	LMB_S454.408.C1___0rc	Unknown	
1588	20	30	unmapped	0		0	GGAATACTAGCGGAGTTAATACTCGTGTTACTGAGTTGCTGTGATTAAAATTTTCAATCA	1495	0	UF_Msa_AF_106743	LMB_S454.sd.362.C1___1rc_nr0nt1	LMB_S454.sd.362.C1___1rc_nr0nt1	Unknown	
1589	20	31	unmapped	0		0	TCAGCAGACCTCTCAGAGATTTAAACAAACTCTCCCTCTTGGCTGCCAGGCGGCGCTGTC	1497	0	UF_Msa_AF_109535	contig05688___1_nr0nt1	contig05688___1_nr0nt1	Unknown	
1590	20	32	unmapped	0		0	TGTCATAACTGCGTGTGGATCGAACATGCAGAGCAGCTGCTGGCGTACTACCACGACGGA	1499	0	UF_Msa_AF_107110	contig15413___1_nrnt	contig15413___1_nrnt	Unknown	
1591	20	33	unmapped	0		0	AGACATCCATTGCCCAGCCACAACACCTCAAGTCACAGCGGTCCATTAACACTCCAGCCA	1501	0	UF_Msa_AF_110153	contig04917___1_nrnt0	contig04917___1_nrnt0	Unknown	
1592	20	34	unmapped	0		0	TTTATTACACTGAATTTAAACAAGCTACAATGCATGTGTGAGTGTGTGAGTGTGAATGTG	1503	0	UF_Msa_AF_107891	contig26400___1_nr0nt	contig26400___1_nr0nt	Unknown	
1593	20	35	unmapped	0		0	ATGATAAATGCTGTTTCAAATGGCCAAGTGAGGGGAGACAGTTACAGCGAAGGCTGCATA	1505	0	UF_Msa_AF_109052	contig09946___1rc_nrnt	contig09946___1rc_nrnt	Unknown	
1594	20	36	unmapped	0		0	ACTACCCCAGGACGATCTATGACGCAGCAGATGCCATTGGCATGCTGAAGAAGTTTCAGG	1507	0	UF_Msa_AF_108405	contig06362___1rc_nrnt-1	contig06362___1rc_nrnt-1	Unknown	
1595	20	37	unmapped	0		0	TTACTGTAGTTATGACAGTGACCTCAGAGCTTTAGACTCTTATGTGCAGGGGCCAACTTC	1509	0	UF_Msa_CF_123622	contig26570___0rc	contig26570___0rc	Unknown	
1596	20	38	unmapped	0		0	GATCATGATCCAGCCCATCCTCTACTCATACTCCTTCCATGGACCACCAGAGCCCGTTCT	1511	0	UF_Msa_AF_107597	contig13339___1_nrnt	contig13339___1_nrnt	Unknown	
1597	20	39	unmapped	0		0	CAGGTTGTTATGATCACAAGTCTTCCCTTGGGCTACACTATTCTGATGAGAAGCCATGCT	1513	0	UF_Msa_CF_126229	contig17286___0	contig17286___0	Unknown	
1598	20	40	unmapped	0		0	GTACGGCCTCTCCCTTCCACTTTTTTCATACTGTATTGCATTTGTGTAATTACACTTAAA	1515	0	UF_Msa_AF_103356	LMB_S454.112.C1___1_nr1nt0	LMB_S454.112.C1___1_nr1nt0	Unknown	
1599	20	41	unmapped	0		0	CTACAAGCAGCAGTTTAGCCTGCATGTCAACATCTTCACTGTCTGTCTCAACCTCCCGCA	1517	0	UF_Msa_AF_104567	LMB_S454.475.C1___1_nr0nt1	LMB_S454.475.C1___1_nr0nt1	Unknown	
1600	20	42	unmapped	0		0	AAATTCTGGTGTTCCTGTTTTCTGTGTCTGGGGTGTTTCTGCTTGTGACCTGGTTGATCA	1519	0	UF_Msa_AF_104499	contig07062___1_nrnt0	contig07062___1_nrnt0	Unknown	
1601	20	43	unmapped	0		0	ACACTGCGTGTCAGTTTTTCATTACATACCAGCTGCCATAGAGTCTCAGAGTGGGACTAT	1521	0	UF_Msa_CF_121864	contig28188___0	contig28188___0	Unknown	
1602	20	44	unmapped	0		0	TTACCAAGAACTGAAGTTCATGTCATGGACGCTATTCGCAGGAATGTGACACAGGAAGCT	1523	0	UF_Msa_CF_123850	contig15358___0	contig15358___0	Unknown	
1603	20	45	unmapped	0		0	AAACCTTTACTGTGTATTCAGCCCTGGGACCAGACAAATTGCATCAAATGCCAGGTTCAC	1525	0	UF_Msa_CF_121193	contig30244___0	contig30244___0	Unknown	
1604	20	46	unmapped	0		0	GAGGAGTCGATCTTTTGGACAATCCTAATCGGACTTTTGAAAATTATACTTGAGATTTTG	1527	0	UF_Msa_AF_109912	contig27249___1_nrnt	contig27249___1_nrnt	Unknown	
1605	20	47	unmapped	0		0	TTTGTGTGCAAGTCAACAAGCTGCCCATCAGTTTGAGTCAGTGACCATGTTGGAACACGG	1529	0	UF_Msa_CF_118489	contig08069___0	contig08069___0	Unknown	
1606	20	48	unmapped	0		0	AAACATCCATGGTCTTGACAGGACTAGAGGGCAACAGTCTGTATCTCATCACAGTTAGAG	1531	0	UF_Msa_CF_125538	contig11985___0	contig11985___0	Unknown	
1607	20	49	unmapped	0		0	AAAGAGAGTGTTGAGGAAAGGAACAGAGAGACTCTACAGAGCTGACTGGCAAGATTTGTA	1533	0	UF_Msa_CF_126779	contig07042___0	contig07042___0	Unknown	
1608	20	50	unmapped	0		0	TTGTACAGCAACAACAGGGCTCACCTAATTTGGGACAACAACAGCAAGTCTTCAGGACTA	1535	0	UF_Msa_CF_120838	contig14782___0	contig14782___0	Unknown	
1609	20	51	unmapped	0		0	CTGGCTCAAACCAAACCTGGGCCATTAAAATCAATTTTATAGAATATGGAAAGTGAAGAT	1537	0	UF_Msa_CF_124184	contig17866___0rc	contig17866___0rc	Unknown	
1610	20	52	unmapped	0		0	AAGGAGTTGCCTTACGTCGGCCTCAATTCCAGGCCGTTCTCCAGCTGGATCTAAGCCACA	1539	0	UF_Msa_CF_121894	contig03668___0	contig03668___0	Unknown	
1611	20	53	unmapped	0		0	TAAGCTGAAGAAGCAGTTCCAGGAGAAGACAGCAGAGCTCGCCCACGCCAACAGGAGAGT	1541	0	UF_Msa_AF_106494	contig19277___1_nrnt	contig19277___1_nrnt	Unknown	
1612	20	54	unmapped	0		0	TTGTGCAGCAACTAAGTGAGAAGGAGCAACAAAGGGCGGTCAGTCAGTCAACAAAACAAT	1543	0	UF_Msa_CF_121221	contig19663___0	contig19663___0	Unknown	
1613	20	55	unmapped	0		0	ATCAGAAGATGACTCTGCTGAACACAATGGACCGCATTCTTTATGAGTCACAGAGACAGG	1545	0	UF_Msa_AF_100598	contig07689___1_nrnt	contig07689___1_nrnt	Unknown	
1614	20	56	unmapped	0		0	AAGTGAGTTCTACTGATCGTGTTCCTGCAGGACAGGAAGTCAGCAGATCCACATTAAACA	1547	0	UF_Msa_CF_117898	contig22493___0rc	contig22493___0rc	Unknown	
1615	20	57	unmapped	0		0	TTCTACAGACTCAGAGACATCCGATAGTGACGATGAGTGGACTGTGGGTGGCACAAAAGG	1549	0	UF_Msa_AF_101875	contig20393___1rc_nr0nt	contig20393___1rc_nr0nt	Unknown	
1616	20	58	unmapped	0		0	AAGCCGATTTCTGTCTCGGAAATCAGTGAACGTGGCTTGAAGTACACACTGAATCTCAGT	1551	0	UF_Msa_CF_122199	contig13949___0rc	contig13949___0rc	Unknown	
1617	20	59	unmapped	0		0	AAACAAGATTCTCAAGGATGAGCAGGGCAACGACATCTCCTCCCCCCGCCTGTCCGACAA	1553	0	UF_Msa_AF_109946	contig19280___1_nrnt0	contig19280___1_nrnt0	Unknown	
1618	20	60	unmapped	0		0	TTAATTCCAACACTGGAGTTGTGTCTGTGGTGACTGCCATAGACAGAGAGGAGATGAACA	1555	0	UF_Msa_CF_122491	contig00482___0	contig00482___0	Unknown	
1619	20	61	unmapped	0		0	AAAGTTCAGTTCAGCAAATCAGCCTCAGAGGCCTTTGTTGAAGTAGACGCGTTGTACTGT	1557	0	UF_Msa_AF_103117	contig16246___1_nr0nt	contig16246___1_nr0nt	Unknown	
1620	20	62	unmapped	0		0	CATTCCAGCCCTGTATCTACATTAAATGTGGTTAGAAGTCATGTTTATTAAACTGTAGAC	1559	0	UF_Msa_AF_109068	contig31364___1_nr0nt1	contig31364___1_nr0nt1	Unknown	
1621	20	63	unmapped	0		0	GGCAAAAATCTAAAGTTCAAGTAATCGAAAAGATAAGCAAAGAGCACAAATCATTGAGGC	1561	0	UF_Msa_CF_121390	contig21718___0rc	contig21718___0rc	Unknown	
1622	20	64	unmapped	0		0	TTGAGAACAGAATTTAGCGTTCCTTCAGATTCCTTTTTCCACTTTCCCCAGCTCACACTA	1563	0	UF_Msa_AD_200286	LMB_Add_112	LMB_Add_112	Unknown	
1623	20	65	unmapped	0		0	AAAGTGAAATGGGCAAGAACGGCACCAAGATGAGGCTGACCATCAGCTCGCAGGGCATCC	1565	0	UF_Msa_AF_102867	contig11915___1rc_nrnt	contig11915___1rc_nrnt	Unknown	
1624	20	66	unmapped	0		0	CGCTGTGTGACTTGTATGAAACCCTGACAATCACACAAGCTGTCATCTTCATCAACACAA	1567	0	UF_Msa_AF_110158	contig11220___1rc_nrnt	contig11220___1rc_nrnt	Unknown	
1625	20	67	unmapped	0		0	CCATGCTGCCCGACACTGCCACCAACTTTACTTAAAACCCTGAGTTCATGATGCAAAAAT	1569	0	UF_Msa_CF_124547	contig05542___0	contig05542___0	Unknown	
1626	20	68	unmapped	0		0	AAGAAACATCCAGTGAATGTTCACTTCCTCGGTATCTACATTCCCACCGACAACGAGTCA	1571	0	UF_Msa_AF_104715	LMB_S454.sd.401.C1___1_nrnt	LMB_S454.sd.401.C1___1_nrnt	Unknown	
1627	20	69	unmapped	0		0	CCACGAACTCTGCAAGAGTTATGTTCGATTACAGTGACCTTAATTGCTACTATTATATAT	1573	0	UF_Msa_AF_103512	contig31573___1_nr0nt1	contig31573___1_nr0nt1	Unknown	
1628	20	70	unmapped	0		0	CGCTCTCACCACTGTTGCCTGCTGTGTCACTTGTTAAATAGTAAAAATGTATTTAAGGCC	1575	0	UF_Msa_AD_200248	LMB_Add_70_rc	LMB_Add_70_rc	Unknown	
1629	20	71	unmapped	0		0	TGAGTACGAGTTGAGAAAGAACAACTTCTCAGATACCGGAAACTTCGGCTTCGGTATCCA	1577	0	UF_Msa_AF_103001	LMB_S454.sd.210.C1___1rc_nrnt-1	LMB_S454.sd.210.C1___1rc_nrnt-1	Unknown	
1630	20	72	unmapped	0		0	TATAGGAGTGATGTAGGGTCCTTATAGATGTGCCCTTTGGGCCGTACTGAGAGTATGTAT	1579	0	UF_Msa_CF_121359	LMB_S454.sd.31.C3___0rc	LMB_S454.sd.31.C3___0rc	Unknown	
1631	20	73	unmapped	0		0	CTATTAGTAATCCAGGATGACTCTCTGCCTGCAGCACCCCCACCACAAATTCGAATTTTG	1581	0	UF_Msa_AF_108815	contig00630___1rc_nrnt0	contig00630___1rc_nrnt0	Unknown	
1632	20	74	unmapped	0		0	ATAATGGGAACTGAAATCACCAATGAGCAGCTGGATGAGATGGTGGACAAAGGTGGTGAA	1583	0	UF_Msa_AF_105316	LMB_S454.sd.604.C1___1_nr1nt0	LMB_S454.sd.604.C1___1_nr1nt0	Unknown	
1633	20	75	unmapped	0		0	TGAAGGCCAAACTGTACCACAAACAGAGACATGCAGAGAAGATCCAGATGAAGAAGACCA	1585	0	UF_Msa_AF_100353	contig16527___1rc_nrnt	contig16527___1rc_nrnt	Unknown	
1634	20	76	unmapped	0		0	GTTCACAGTTTCTGTCAGTGTAATTGCAGGAATTATAAGAATCCCGAAATATTGAGAGGT	1587	0	UF_Msa_AF_100140	LMB_S454.sd.657.C1___1_nrnt	LMB_S454.sd.657.C1___1_nrnt	Unknown	
1635	20	77	unmapped	0		0	ATGGAAGCAGAAGCATCGCAGACCTGCCTTACCTGCATGGCCTCTTTCTGTGAGGAGCAC	1589	0	UF_Msa_AF_107419	contig14951___1_nrnt0	contig14951___1_nrnt0	Unknown	
1636	20	78	unmapped	0		0	GCACAGGAGAAAAGCTCCCCAAGGTCAGAGACAGAACACTGGAGGAAACAATATGAGGAA	1591	0	UF_Msa_AF_109665	contig30374___1_nr0nt	contig30374___1_nr0nt	Unknown	
1637	20	79	unmapped	0		0	GGAGGTGCAGCAAGATGCGATGTGTTTGCGAGTGATGTGGTGGTCAGTGTGTGTGCAGGG	1593	0	UF_Msa_CF_121854	contig01456___0rc	contig01456___0rc	Unknown	
1638	20	80		1028	E1A	0		571	1	(+)E1A_r60_a107	E1A_r60_a107	E1A_r60_a107		CONTROL
1639	20	81	unmapped	0		0	TGCAGTGATGAATCTGGACCATGGTGACCCACTGACAAGAGACCACATGGCCGCCGTGTT	1596	0	UF_Msa_AF_105258	contig17143___1rc_nrnt0	contig17143___1rc_nrnt0	Unknown	
1640	20	82	unmapped	0		0	TCAACACTACCCTAATGGATGGAATCATGAACGATTACTTGTCTTGTAAACGGAGATAAA	1598	0	UF_Msa_CF_119161	contig12427___0	contig12427___0	Unknown	
1641	21	1	unmapped	0		0	ATTCTCAGTCAGCGTTTCACAGGAGATTAGTGATGACACGATCCGGGAGGAAGATAAAAG	1599	0	UF_Msa_AF_103179	contig26575___1_nr0nt	contig26575___1_nr0nt	Unknown	
1642	21	2	unmapped	0		0	CTGTCTGTTTGTTTCTCGGTGGTGTGCGAAGGAGACTGGAGAAAGATGAGCACTGCAGTC	1601	0	UF_Msa_CF_127735	contig26336___0rc	contig26336___0rc	Unknown	
1643	21	3	unmapped	0		0	ATGATAGACACAAACTACGAAATCTGCCCAGACAACATCTCGCCATCAGAAGGCCTCATT	1603	0	UF_Msa_AF_104718	LMB_S454.sd.100.C1___1_nrnt	LMB_S454.sd.100.C1___1_nrnt	Unknown	
1644	21	4	unmapped	0		0	TATGGGAGAAGATGCATAAAATCGTCAAATACACCCCAGTGACTCTGAACCCCAACACTG	1605	0	UF_Msa_AF_102204	contig07626___1_nrnt0	contig07626___1_nrnt0	Unknown	
1645	21	5	unmapped	0		0	GTATATTTATTGATAATAAGACCACTGATGGTGACTTAGTCAATAGTAGACAACATGGTG	1607	0	UF_Msa_AF_100766	contig03301___1_nr0nt	contig03301___1_nr0nt	Unknown	
1646	21	6	unmapped	0		0	AGAATGTAGTTTCTGTGTTCATGTCTTTCCTGTTAAAGTCTGTTTTTGGTTCTGTGTTTC	1609	0	UF_Msa_CF_126598	contig27839___0	contig27839___0	Unknown	
1647	21	7	unmapped	0		0	CTGGAGTCATGAACAGACACACAGGGGGTACTAACAGTGGCAGTAACAGCCCTGTGCCCT	1611	0	UF_Msa_CF_124488	contig16322___0	contig16322___0	Unknown	
1648	21	8	unmapped	0		0	GTATCCTAAAGTGAGTCAACAGGTCTCTATTTCAGTCCCTAAATTGGAAATATGGGCTAG	1613	0	UF_Msa_CF_125730	contig01560___0rc	contig01560___0rc	Unknown	
1649	21	9	unmapped	0		0	AAATACAAGTTGTCAGACTGGGAGAGTCAGATCACAGCGGACATCAGAAGTTTTCTTGCC	1615	0	UF_Msa_CF_123985	contig14744___0rc	contig14744___0rc	Unknown	
1650	21	10	unmapped	0		0	ACAGAAGTCCAGAGAGCAGAATTTTAACGGTTTCCTGTCTGACCTGGAAGCAAAATACTC	1617	0	UF_Msa_AF_108795	contig29965___1rc_nrnt-1	contig29965___1rc_nrnt-1	Unknown	
1651	21	11	unmapped	0		0	GTAGTCCCCCCGCCGCTCACCTTCCTCCTGTATGGTGACACAGTCACTGTCCTGGTCACT	1619	0	UF_Msa_AF_108770	contig10177___1_nr0nt	contig10177___1_nr0nt	Unknown	
1652	21	12	unmapped	0		0	CCCGATAAACGTCCTGCAGCAGCGAGGAGCAGAAAGAGTTAAACTAAACGACTCGTGTAC	1621	0	UF_Msa_CF_122235	contig30774___0	contig30774___0	Unknown	
1653	21	13	unmapped	0		0	GATTCAGTGAAGGATTTGAGTTTGTAGAGGAGTTGCCTACCCCCACTTTCCAATTTGGAG	1623	0	UF_Msa_AF_103127	contig27749___1rc_nr1nt0	contig27749___1rc_nr1nt0	Unknown	
1654	21	14	unmapped	0		0	CCCGACGATGTGAATTAGACGGGCCTTCCTTAAACCAGTGCATGTCTGGTACATGGGATC	1625	0	UF_Msa_CF_119388	contig10188___0	contig10188___0	Unknown	
1655	21	15	unmapped	0		0	CGAGGAGAAGTAAAAGAAAAAGGGGTGTTCTTTATGGATGCAAGAATGTACTGAGAGATC	1626	0	UF_Msa_AF_102371	contig03603___1rc_nr0nt	contig03603___1rc_nr0nt	Unknown	
1656	21	16	unmapped	0		0	CTGCACCTGACATGCACATGAAGCCATATTGAAGATGATATGTAATATCTTCTACATTTT	1628	0	UF_Msa_AF_104048	LMB_S454.31.C1___1_nrnt	LMB_S454.31.C1___1_nrnt	Unknown	
1657	21	17	unmapped	0		0	ACATGTGTACAGGTGAACATGTGGACACCACAGCCCGCAGCTAACAGCTAGTAAAAATAA	1630	0	UF_Msa_CF_122049	contig19653___0rc	contig19653___0rc	Unknown	
1658	21	18	unmapped	0		0	CACCTGTCTGAAGTTCACAGATGACAGCAGCCATTTTGTCTCTGGAGGAAAAGACAACAT	1632	0	UF_Msa_AF_107121	contig21891___1_nrnt	contig21891___1_nrnt	Unknown	
1659	21	19	unmapped	0		0	AGACTATGAGAAACTGGTGCTGGCAGCCTGGAAGTGTCCAGGCTTCTTGAGGAGGGGTTG	1634	0	UF_Msa_AF_104274	contig14378___1_nrnt	contig14378___1_nrnt	Unknown	
1660	21	20	unmapped	0		0	ACAATCTTTTGTTTTGTTTACGAGTGGGAAAAACGCTTTGGGAAAAGTTTTGAGTGTCTC	1636	0	UF_Msa_CF_123640	contig25082___0rc	contig25082___0rc	Unknown	
1661	21	21	unmapped	0		0	GGTGACATGTCAACAACAAACATGGCAGCCAGCAGCAACTACTGGGAAGATCTGCGTAAG	1638	0	UF_Msa_CF_123120	contig22176___0	contig22176___0	Unknown	
1662	21	22	unmapped	0		0	TCCAGTATTGGTCTTGCCGTGGGCATTGATAAATCAGTCAACCTAGCATGGAGACAAAAG	1640	0	UF_Msa_CF_126488	contig25503___0	contig25503___0	Unknown	
1663	21	23	unmapped	0		0	CGTGTAGATATATTTTCAAAGTTCATCTCTCTTCTGTGATAGCTTTGTGGCATGCTTTTC	1642	0	UF_Msa_AD_200386	AF375975_rc	AF375975_rc	Unknown	
1664	21	24	unmapped	0		0	TTCACCGGAGCATCTACCACTACTACACTTTATTTTGAGATATAAAACAGCCATCCGTCC	1644	0	UF_Msa_AF_101586	contig03107___1_nr0nt1	contig03107___1_nr0nt1	Unknown	
1665	21	25	unmapped	0		0	ACCGTGTAAAAACATTTACGATAATGCCCACAATAAAATTACAGAGCTCTGATGGGGAAA	1646	0	UF_Msa_AF_109405	contig20039___1_nr0nt	contig20039___1_nr0nt	Unknown	
1666	21	26	unmapped	0		0	CCGTTATGATGACTGTTAAGAAAATAAAAATGGGGTGGAGATAAAACACAGTCGGTAGAT	1648	0	UF_Msa_CF_120150	contig19036___0	contig19036___0	Unknown	
1667	21	27	unmapped	0		0	AGAAAGGAAAGGCAGGAACTCAGCACATGATGAGAACAGAGGGGAGAGAAGCACAGATAA	1650	0	UF_Msa_CF_121717	contig08104___0rc	contig08104___0rc	Unknown	
1668	21	28	unmapped	0		0	AAACTCCAAAGACTGACAAAAAGCATTGTCTCTGCACATTCTAGCAAACCCAAAGGTCGG	1652	0	UF_Msa_AF_108182	contig18506___1_nr0nt1	contig18506___1_nr0nt1	Unknown	
1669	21	29	unmapped	0		0	TGAAGGAGCTGGGCATTAAAACAGACGGACCCAGACAACAGATATTGGCTGCCATTTCAG	1654	0	UF_Msa_AF_106462	contig22454___1_nrnt	contig22454___1_nrnt	Unknown	
1670	21	30	unmapped	0		0	GTCCCACAAGGCCGTGCTGAGCGTAGATGAAACAGGAACAGAGGCAGCAGCCAGCAACCA	1656	0	UF_Msa_AF_105985	contig23270___1_nr0nt1	contig23270___1_nr0nt1	Unknown	
1671	21	31	unmapped	0		0	ACCGCTGGCCTTAACACCACGGACAAGGAAATGGGAGGGTATTTTCTAGCTGGATATCAG	1658	0	UF_Msa_CF_118216	contig26651___0	contig26651___0	Unknown	
1672	21	32	unmapped	0		0	CCAACAGCAGAACAAGCTACAGCCATCAGACGGATTATCGACAAGAGAGAACAGAAGAAA	1660	0	UF_Msa_AF_104529	contig24488___1rc_nrnt0	contig24488___1rc_nrnt0	Unknown	
1673	21	33	unmapped	0		0	GGTGACGTCCTGTGGCTCCGACGGACACTCCATGGCCCTGACTGAGACCGGGGAGGTGTT	1662	0	UF_Msa_AF_103692	contig25138___1_nrnt	contig25138___1_nrnt	Unknown	
1674	21	34	unmapped	0		0	AGAGCTCAGAAGAAAAAGGAGCTGCAGAAGGAAACTCCAGACGCCACAGGTCAACTCAGT	1664	0	UF_Msa_CF_120065	contig23443___0rc	contig23443___0rc	Unknown	
1675	21	35	unmapped	0		0	CAGTGTTGTTGTGTTGGCTTTATGTGTGACTCTGGCCCCTTATGTATCTGCAGGGGACGA	1666	0	UF_Msa_CF_127291	contig12624___0rc	contig12624___0rc	Unknown	
1676	21	36	unmapped	0		0	TCGTCGGTGGAGAAGGGGTCAAAGAAGAAGGGCAGAGGGCGAGCCAACGGAGAGCCGAGG	1668	0	UF_Msa_CF_126027	contig01758___0	contig01758___0	Unknown	
1677	21	37	unmapped	0		0	AATCCACCAAGTCTTCCTCACAAAGTGATTCTCAAACATGGCCAAGAGTTGGAGGAAGAG	1670	0	UF_Msa_AF_107467	LMB_S454.sd.465.C1___1rc_nrnt-1	LMB_S454.sd.465.C1___1rc_nrnt-1	Unknown	
1678	21	38	unmapped	0		0	ATCCTGTTTGTGCCCACTTCAGCTCCCCGTGGCTTGTTTGACGAGTACGGCTCCAAGAAG	1672	0	UF_Msa_AF_104639	contig19208___1rc_nrnt0	contig19208___1rc_nrnt0	Unknown	
1679	21	39	unmapped	0		0	AATCTGAACTATGTGTTGCCCCCTTCATTTTGCTTCAATGACCAGAGGGACTATACCAGG	1674	0	UF_Msa_AF_106608	contig10127___1_nr0nt	contig10127___1_nr0nt	Unknown	
1680	21	40	unmapped	0		0	CAGTAGAACCACTAAAACTGGAGCTATCAGTTTACAAACCACAATAACCTTTTGGCTTAT	1676	0	UF_Msa_CF_122811	contig00135___0	contig00135___0	Unknown	
1681	21	41	unmapped	0		0	GAACACAGAAAATGCACATCTCTTCATGGATCATGCAATCGATGAAGAGGTACCTCCTAT	1678	0	UF_Msa_CF_118040	contig04883___0	contig04883___0	Unknown	
1682	21	42	unmapped	0		0	ATGAAAAACCCCAAGAGGATCTCATCTGTTAAGTTCTTAAATAACTCCATTCTGGCTGTC	1680	0	UF_Msa_AF_106733	contig16542___1_nrnt0	contig16542___1_nrnt0	Unknown	
1683	21	43	unmapped	0		0	TGATAATGTATTTATGTTCTTCTATACTCACTTGTTAATCTATGAATGAGCAGAATTTTG	1682	0	UF_Msa_AF_102279	contig04155___1_nr0nt1	contig04155___1_nr0nt1	Unknown	
1684	21	44	unmapped	0		0	ATCCTCCTTCAAGTTCTCCAGTTTCCACTGATGTTGACTGGATGTAGAAACCTTTCTGGG	1684	0	UF_Msa_CF_127346	contig24273___0	contig24273___0	Unknown	
1685	21	45	unmapped	0		0	ATTCGGAAACAGAAAACTCTGATGATGGAGAGTCTTCTTGTAGAGTTGTGGTGGAGAGGG	1686	0	UF_Msa_CF_123115	contig03273___0rc	contig03273___0rc	Unknown	
1686	21	46	unmapped	0		0	GGCCTTGTGCAAGGAAAAATAACCATTGGTTATTTTGTAAAAGGATTCTATCGCATTTGT	1688	0	UF_Msa_AF_107624	LMB_Sanger.115.C1___1_nr0nt1	LMB_Sanger.115.C1___1_nr0nt1	Unknown	
1687	21	47	unmapped	0		0	TTCGGATCATGTCTGCTGGAAACAAAAATGAGGGTGTCAGTATAGAGTTCAGGCTCATCC	1690	0	UF_Msa_CF_124090	contig06369___0	contig06369___0	Unknown	
1688	21	48	unmapped	0		0	AACCAAGGAAAATACCCAGTCACATGGACAAATCACTAATGCCAGGGAAATATCCTAAAC	1692	0	UF_Msa_CF_119792	contig31786___0rc	contig31786___0rc	Unknown	
1689	21	49	unmapped	0		0	GTCAGGATTCTTTTCTTCTTCTTCAGGAAGCTGACTGTTGTTCTGTCTCCCTGCTGATCA	1694	0	UF_Msa_AF_109544	contig01959___1_nr0nt	contig01959___1_nr0nt	Unknown	
1690	21	50	unmapped	0		0	ACAGATACTCCAGCCAAAAAGAAAAAGAAACGAAAGACTGAGACCATGGACACAGCGCCA	1696	0	UF_Msa_CF_119288	contig30951___0	contig30951___0	Unknown	
1691	21	51		1028	E1A	0		479	1	(+)E1A_r60_1	E1A_r60_1	E1A_r60_1		CONTROL
1692	21	52	unmapped	0		0	TTTGTGCTTTCAACGATGGACCGTCCGGCGAGGGGAACTTCACCCGTTACGGAAGTGACA	1699	0	UF_Msa_CF_120082	contig07922___0rc	contig07922___0rc	Unknown	
1693	21	53	unmapped	0		0	GCGGAGTGTAAGAACAGCGATGAAACCGAACCAAATACATGAGAGGAACAAACTAACAAA	1701	0	UF_Msa_CF_125808	contig07307___0rc	contig07307___0rc	Unknown	
1694	21	54	unmapped	0		0	CAAGCGAGCGGCAGCTGAAGCAGCAGCTCTAAAGCAGAAGAAGCAGGCTGATGCTGAGAT	1703	0	UF_Msa_CF_120211	contig02723___0	contig02723___0	Unknown	
1695	21	55	unmapped	0		0	GCTCTTTAGCTGCTAAATGCTCCACTATGTTCAACAGCTAGTCTCTAACTGTGTTAGCCT	1705	0	UF_Msa_AF_104195	contig12216___1_nr0nt1	contig12216___1_nr0nt1	Unknown	
1696	21	56	unmapped	0		0	ATTTGTAGTAATTATGCTTTTCCTTTAATAACTCAAACAACCATAATCCTTGTCAACTTT	1706	0	UF_Msa_AF_105376	LMB_S454.882.C1___1_nr0nt1	LMB_S454.882.C1___1_nr0nt1	Unknown	
1697	21	57	unmapped	0		0	AGACCAGGACTCTGGAGTTCAGCTGTAAAGCCTGAAACCAGCAGCTGCCTCATCCCTGAT	1708	0	UF_Msa_AF_107348	LMB_S454.sd.297.C2___1_nrnt0	LMB_S454.sd.297.C2___1_nrnt0	Unknown	
1698	21	58	unmapped	0		0	ATGCCTTTGGAGAGAGATCACGAGACCGTTATGGGTCGGGAGGTTACAGAGATGGACCGC	1710	0	UF_Msa_CF_121664	contig15091___0rc	contig15091___0rc	Unknown	
1699	21	59	unmapped	0		0	AGAGAGACAAGCTGCTGCAGTCCCTATTCCTCCAGCTCCACCATTGGCCCCTGGAGGCAC	1712	0	UF_Msa_CF_126792	contig24362___0rc	contig24362___0rc	Unknown	
1700	21	60	unmapped	0		0	GGAGGGGAACTCCGGTGTTGTCGGAGAATTACTAAGCTTATCTGTTAAAAACGAGAGGCG	1714	0	UF_Msa_CF_121842	contig24892___0rc	contig24892___0rc	Unknown	
1701	21	61	unmapped	0		0	CCTTCGTAGAGAACCTGCAGAGTGAACTGCTGGAGCTCAACTTCCACGAGAAGTCAAACG	1716	0	UF_Msa_CF_127208	contig06771___0	contig06771___0	Unknown	
1702	21	62	unmapped	0		0	ACAACTCGCTTTCGGAGAAGACTGTCATTTCTTGGATCTGTACATCCAACACAACAGCAG	1718	0	UF_Msa_AF_100941	contig04827___1_nr0nt1	contig04827___1_nr0nt1	Unknown	
1703	21	63	unmapped	0		0	GTCCGGGTAGAAAACAGCTTTAACAAAGGATCAAGCAGGAAGATAAGAAGATACAAGACC	1720	0	UF_Msa_CF_123044	contig05185___0rc	contig05185___0rc	Unknown	
1704	21	64	unmapped	0		0	GGGTGTGAGTGCAGTACCTGGAGATGCTCTGGACGTAGCCCTTGAAGCTGCAACGTACAT	1722	0	UF_Msa_CF_127311	contig18395___0	contig18395___0	Unknown	
1705	21	65	unmapped	0		0	TTTGTCCTCTGCCTCCTGTTCTGATATGTCAAAGCCGCACTTGTTTTTGCGTCGATTTTT	1724	0	UF_Msa_CF_123675	contig03165___0rc	contig03165___0rc	Unknown	
1706	21	66	unmapped	0		0	GAACTACCGCAGCTTTCTCTACGTGTTTAAGCCTTAATTTTTGCCAAAATGAACCGTATA	1726	0	UF_Msa_CF_123946	contig21481___0	contig21481___0	Unknown	
1707	21	67	unmapped	0		0	CAAAATGGATCAGGTGGTTGTGCAAGTCGGCTGCATGAGTCTTAAAGATTCTCAGGAACT	1728	0	UF_Msa_AF_100768	contig09467___1rc_nrnt	contig09467___1rc_nrnt	Unknown	
1708	21	68	unmapped	0		0	GCACCTAAATGCAGCAGATACTGAGAGCTACAGTTTGTTGATAGAGATGCCTGTTCTGAT	1730	0	UF_Msa_CF_122786	contig02572___0rc	contig02572___0rc	Unknown	
1709	21	69	unmapped	0		0	AGCTGTCACACTCTGCGCAATCATCCAGCTCACCAATATGTGAGTGTTCTTGGGGTCTGG	1732	0	UF_Msa_AD_200120	LMB_Add_43	LMB_Add_43	Unknown	
1710	21	70	unmapped	0		0	CAGCAAGCTACTGCCTGTGGGCAGGGACACGTTAGGTTTGGGGCGGGGACAGAGACCCTT	1734	0	UF_Msa_AF_109973	contig26392___1_nrnt0	contig26392___1_nrnt0	Unknown	
1711	21	71	unmapped	0		0	AGGGGAGAAATCAAAACTTTGGGAAATATGATCCCTTTTAACTTTCCTGTGACGCCTCTT	1736	0	UF_Msa_CF_124540	contig18878___0	contig18878___0	Unknown	
1712	21	72		0		0		812	1	ETG04_27747	ETG04_27747	ETG04_27747		CONTROL
1713	21	73	unmapped	0		0	GGCGTCCGTGTGCCGAGTCGGGAGCCTGTGGGTCGAACCCTCGCCAAAGCCCGCAGCCCC	1739	0	UF_Msa_AF_107520	contig07182___1_nr0nt	contig07182___1_nr0nt	Unknown	
1714	21	74	unmapped	0		0	GGCCTGGCGGCAGCGGCGGGGTGCGAGGAGCTTTCTCAGAAGTAGAAAGAGTGGAAAGAA	1741	0	UF_Msa_CF_118836	contig25860___0rc	contig25860___0rc	Unknown	
1715	21	75	unmapped	0		0	CTGCTCATGTGTTTCAAGGCTGAGTAAGACCTAATATTCCACTGTCCTAAATCTTTATGT	1743	0	UF_Msa_AD_200363	LMB_Add_150_rc	LMB_Add_150_rc	Unknown	
1716	21	76	unmapped	0		0	AACATCGATGCAGCAGAACATCATCTGAGAGACAAGGAGGATTTTCGGAATAAGGTTCAA	1745	0	UF_Msa_AF_109217	contig29731___1_nrnt	contig29731___1_nrnt	Unknown	
1717	21	77	unmapped	0		0	AGCCTTGTATTTACTGGACAGATATGAGAGAGGTATCAGTCTTCTCATCAGCAGAAACTA	1747	0	UF_Msa_CF_119298	contig03047___0	contig03047___0	Unknown	
1718	21	78	unmapped	0		0	TTAAACAGAAATGGAAAAAATGGTGCAGGAGGAGAGACAGCGGGTTTCTTGGTGCATCAC	1749	0	UF_Msa_AD_200032	LMB_Add_77	LMB_Add_77	Unknown	
1719	21	79	unmapped	0		0	ATTCAGGTCAAAGTGTGGAGTTCAAACGTGTTTAATGTGGAAACTGTGGAAGGTGAGGAG	1751	0	UF_Msa_AF_105367	contig23428___1_nrnt0	contig23428___1_nrnt0	Unknown	
1720	21	80	unmapped	0		0	TGCGAGTCCCCTTCCTTCCTCCTCTTGATGGTAACACTGTTGTTCTGAGGACAGTTGGAA	1753	0	UF_Msa_CF_123371	contig14923___0rc	contig14923___0rc	Unknown	
1721	21	81	unmapped	0		0	TGTCCACGACTTTAATATCAGAGACGGCACCAAAGACCCCGACGCCAAAGCTCAGCTGTC	1755	0	UF_Msa_CF_125641	contig23649___0rc	contig23649___0rc	Unknown	
1722	21	82	unmapped	0		0	GAGCAGCTCCATCATGACTGAACCAACATGTTTAATGTTTTTCAAAAAGGGATCAACTCT	1757	0	UF_Msa_CF_125296	contig01196___0	contig01196___0	Unknown	
1723	22	1	unmapped	0		0	TGGCTCTATCTTCTCTACTCCTGTTTGGCTGCTCATCAGGGACCGTGACCTCATGTGACA	1600	0	UF_Msa_CF_126484	contig22895___0rc	contig22895___0rc	Unknown	
1724	22	2	unmapped	0		0	TCACCATTGCTCAGCCTTAGATGAGGCAAGATCAACTGTAAATTGCCAGGCTGAGCTAAT	1602	0	UF_Msa_CF_125076	contig26945___0	contig26945___0	Unknown	
1725	22	3	unmapped	0		0	AGCGGAGGAGGTTTGGTTTTGGGATAAGAGCCTTGTATGTGTTCCTGGCGGCACCGGACA	1604	0	UF_Msa_CF_127617	contig02241___0	contig02241___0	Unknown	
1726	22	4	unmapped	0		0	CACGCAGGACACCACTGGATCTACAGACAGACAGGCTAGGAAGCCATGGGATGAACAGAG	1606	0	UF_Msa_CF_118035	contig30296___0rc	contig30296___0rc	Unknown	
1727	22	5	unmapped	0		0	AGAGATATTCACATGTTACATGAGGAGGAGGAGAAACAAGAAGTGGATCACAGAGTGCCG	1608	0	UF_Msa_CF_121506	contig28213___0	contig28213___0	Unknown	
1728	22	6	unmapped	0		0	CTGTTCCGTAAGCTGCGCCTCGTCTACGACAAATGCAATGAAAACTGCGCGGGGATGGAC	1610	0	UF_Msa_AF_101986	contig01016___1rc_nrnt	contig01016___1rc_nrnt	Unknown	
1729	22	7	unmapped	0		0	AAGTGTACAGGTTGAAAGATATCGGCAACACTATATCTGGCAGGAAGGGCACAGATGACT	1612	0	UF_Msa_AF_101342	contig30753___1_nrnt	contig30753___1_nrnt	Unknown	
1730	22	8	unmapped	0		0	AAACTGCTTTGATCATCTGTCTCTGCTCGTTGCTTCTCTTCACCAGGATTGCAATGATCG	1614	0	UF_Msa_AF_104670	contig25232___1_nr0nt	contig25232___1_nr0nt	Unknown	
1731	22	9	unmapped	0		0	GGACAGCAGTCATACTTAGGGATATTATAAGCAGATGATTCAATGGAAGTTTACAAAATG	1616	0	UF_Msa_CF_123282	contig24797___0rc	contig24797___0rc	Unknown	
1732	22	10	unmapped	0		0	AGAGCGGAGGAGGATGAGGCTCATCCATGCTGAGATCATTACAGACCTACTGAACAGCAG	1618	0	UF_Msa_AF_104806	contig22940___1_nrnt	contig22940___1_nrnt	Unknown	
1733	22	11	unmapped	0		0	TACTGGGTGTTAACTCAGTACTGTGTACGTCTTTAATGCGGATACGAGAGTTAGTAGTCG	1620	0	UF_Msa_CF_123385	contig17923___0	contig17923___0	Unknown	
1734	22	12	unmapped	0		0	GTCGAGCATCCAGACCGCACCATTCCTGTCATCATTATAGGGCTACTCGTTTTCCTTCCT	1622	0	UF_Msa_AF_106312	contig13671___1rc_nrnt-1	contig13671___1rc_nrnt-1	Unknown	
1735	22	13	unmapped	0		0	TGACCTATGTGAGAATCTGCTAAAGAAGTTTTTACTTCAAGTTGCGCTCTATGATCCCCC	1624	0	UF_Msa_AF_105608	contig19131___1rc_nrnt0	contig19131___1rc_nrnt0	Unknown	
1736	22	14		130	HybridizationNegative	0		461	1	(+)eQC-41	EQC	EQC		CONTROL
1737	22	15	unmapped	0		0	CGCTGCACTGGATGGTCCGACGGATCAATCTGGAATATTTTCCCAGAGGACGCAGTTACT	1627	0	UF_Msa_AF_100974	contig01416___1rc_nrnt0	contig01416___1rc_nrnt0	Unknown	
1738	22	16	unmapped	0		0	CAGGTGAAGTGTCTGAATATGCCTCCACCTGCTGTGATGGATCCTACCAAGGAGCTTTGT	1629	0	UF_Msa_AF_101212	contig31992___1_nrnt	contig31992___1_nrnt	Unknown	
1739	22	17	unmapped	0		0	ACCAGCAACCTTTGGAGAACATACCAGATGATGACCATCTAGATAGTTCAGATGAGGGAT	1631	0	UF_Msa_AF_103908	contig04685___1_nr0nt1	contig04685___1_nr0nt1	Unknown	
1740	22	18	unmapped	0		0	CGGCGGAGCGGCTACAGTGCTTCCCCTTCTCCCTCATGTCCGGCTCTGTCCTGCCTGCAA	1633	0	UF_Msa_CF_119096	contig17145___0rc	contig17145___0rc	Unknown	
1741	22	19	unmapped	0		0	TAAATCAGTTTAACTCAACGAGTGGAGCCCAAATAATTAGAGATGGCGGATCCTGCGGTG	1635	0	UF_Msa_AF_104500	LMB_S454.sd.281.C1___1rc_nrnt	LMB_S454.sd.281.C1___1rc_nrnt	Unknown	
1742	22	20	unmapped	0		0	CGTCCGAGGTGGCCTCAGAGCGCGAGCTGCAGGCCTCACTGCTCACCTGCCTTTACCTGT	1637	0	UF_Msa_AF_109261	contig22624___1rc_nrnt	contig22624___1rc_nrnt	Unknown	
1743	22	21	unmapped	0		0	ATGTCAATGAGATCATCAACTTTGTTGCTCTGCTGCGACACAACGGCTTTGATACGCATA	1639	0	UF_Msa_AF_106144	contig24906___1_nr0nt	contig24906___1_nr0nt	Unknown	
1744	22	22	unmapped	0		0	TTGCTGCAGCCATCGATCGAACAGAAAAGTACCATTTTGATGAGATGATTTACGTGACAG	1641	0	UF_Msa_CF_121845	contig15288___0	contig15288___0	Unknown	
1745	22	23	unmapped	0		0	TGGAAGGCTGGCCAAGATGGGATAATTCAGCACTGCAAATAAATGTGTTTTTTGTCCAAG	1643	0	UF_Msa_CF_120164	contig17756___0	contig17756___0	Unknown	
1746	22	24	unmapped	0		0	TCAGTATCATTGGTGGCCCATGGCCTTGATTGTTAAGTGAGGGTCATTAATTTCGTCCAT	1645	0	UF_Msa_AD_200057	LMB_Add_71_rc	LMB_Add_71_rc	Unknown	
1747	22	25	unmapped	0		0	ACTCAATGAGGCAGATCAGGGCCGAGGTCAGCGAGTTGCCTGTCATTGAGTCGCGGTCCC	1647	0	UF_Msa_AF_106335	contig12821___1_nr0nt	contig12821___1_nr0nt	Unknown	
1748	22	26	unmapped	0		0	TGGTGGTTTTCTTTCAGATAAGTCAGAAGAAGTGACGAGTTCTTTCAGGTGGGATTTTTT	1649	0	UF_Msa_CF_120705	contig30817___0	contig30817___0	Unknown	
1749	22	27	unmapped	0		0	ATGTTCAGTCCCAGATTCTGTCCCGTCCCATCATTCAGCCCTCTGCTCTAGTATCTACAG	1651	0	UF_Msa_CF_118565	contig27058___0rc	contig27058___0rc	Unknown	
1750	22	28	unmapped	0		0	CTGTTAATTTGTTAATATCATCATACTGCTGACAGACATGCAGGCATTCTGTAATACATG	1653	0	UF_Msa_AF_107676	contig30143___1rc_nr0nt1	contig30143___1rc_nr0nt1	Unknown	
1751	22	29	unmapped	0		0	AGAGCAAGCCGCGGAGCCAGCTATCGTGAAAGCTGCTCTTTGTGGTTAATTAGTATTAGA	1655	0	UF_Msa_CF_125906	contig23352___0	contig23352___0	Unknown	
1752	22	30	unmapped	0		0	TCTTATTATAATAAAGTTATACAGAGAAGGCAAGTTAAATAAACTACTTTTGATTTAATG	1657	0	UF_Msa_AF_104915	contig24752___1rc_nr0nt	contig24752___1rc_nr0nt	Unknown	
1753	22	31	unmapped	0		0	AATGCAGGCCATAAAGTGTGTCGTTGTCGGAGACGGAGCTGTGGGTAAGACCTGCCTGCT	1659	0	UF_Msa_AF_109160	contig24326___1rc_nrnt	contig24326___1rc_nrnt	Unknown	
1754	22	32	unmapped	0		0	GCTAGTGGCTAGTAGCAGCAGGTAGATAACCCAGAAGAAGCAGAAAAATAGAAATGTTTT	1661	0	UF_Msa_CF_122845	contig28113___0	contig28113___0	Unknown	
1755	22	33	unmapped	0		0	CTCTCTCCTGCCTGCTCCTAAAAAGCCAGGATCGGCAGGAGGAAACTATGGAGCGAGCAA	1663	0	UF_Msa_CF_126432	contig22009___0rc	contig22009___0rc	Unknown	
1756	22	34	unmapped	0		0	AGGATATCGACCTCGCCCCCAGAGACTTTGGACCCAGCTTTAGACCCCTCCTCGCTGCCA	1665	0	UF_Msa_CF_123813	contig25428___0rc	contig25428___0rc	Unknown	
1757	22	35	unmapped	0		0	CTGGACGAGGATGAGAAGATATACAAACTGAGAATAGAGGTTTTGTATAAGGACAAGGTG	1667	0	UF_Msa_AF_103412	contig24632___1_nr0nt	contig24632___1_nr0nt	Unknown	
1758	22	36	unmapped	0		0	AAAGGTGATTTGTTGGGCGGAACAAGAGCGGACGCTGTGTCTCTGTGGACCGCATTGCTG	1669	0	UF_Msa_CF_125702	contig22310___0rc	contig22310___0rc	Unknown	
1759	22	37	unmapped	0		0	CTCAACCCCACAGCTTCAACTAACATCACACTCAGTCAAGTTAGGAAGAAGCAACAATGG	1671	0	UF_Msa_AF_104229	contig32414___1rc_nrnt-1	contig32414___1rc_nrnt-1	Unknown	
1760	22	38	unmapped	0		0	CTGCTCTAGACCACATGGGACCTGTCGCTGCTGTTGCTGTAACTCTGACTTAATAAAAAA	1673	0	UF_Msa_AF_104585	contig32578___1_nr0nt	contig32578___1_nr0nt	Unknown	
1761	22	39	unmapped	0		0	CTCCCACCACAGTTAGGGATGAGGGTGGTCTTGTCACCTACTCTGTGGTTAAATCTATTG	1675	0	UF_Msa_AF_109334	contig21318___1_nr1nt0	contig21318___1_nr1nt0	Unknown	
1762	22	40	unmapped	0		0	GGCGCAAACGAGCATCAAGTGTGTATTGGAAATGAAGCAGTGTGGGGCAGAGAGAGTGCT	1677	0	UF_Msa_AF_104432	contig03243___1rc_nrnt	contig03243___1rc_nrnt	Unknown	
1763	22	41	unmapped	0		0	AAAGAGAAAAAGGCTAGAAAATGATGATGAGGAGTCTTTGCTGAAAGCCAGAAACTGGGA	1679	0	UF_Msa_AF_104030	contig29292___1_nr1nt0	contig29292___1_nr1nt0	Unknown	
1764	22	42	unmapped	0		0	AGTGGTGCTGGATATCAAAAACAAACAGCTCCACCAGCAGGAAAAGAAGCTGATGGAGAT	1681	0	UF_Msa_AF_108661	contig18307___1rc_nrnt	contig18307___1rc_nrnt	Unknown	
1765	22	43	unmapped	0		0	TCTGTTAGAACAAAGTCATAAAACCACACCAGGATACAGAGAAAAACACGCAGGTCGGCA	1683	0	UF_Msa_CF_120572	contig10530___0	contig10530___0	Unknown	
1766	22	44	unmapped	0		0	AAATACCCAAGGAGTAAGCTGAGTGGCCCTGGAAACAACTAACAAAGACAGAGCTGTACA	1685	0	UF_Msa_CF_125851	contig21372___0	contig21372___0	Unknown	
1767	22	45	unmapped	0		0	CCATCAGCATAGATTAGCACCAAGCAACTCCAAGAGCTATCAGTTCTTTTCTATTTTCTA	1687	0	UF_Msa_CF_127198	contig16683___0	contig16683___0	Unknown	
1768	22	46	unmapped	0		0	CCATCAAGTTTGGTTGAGCCTGATTATCCAGAAGAAAATGAAGTAAACGAGGAAGGAATA	1689	0	UF_Msa_AF_104729	contig01682___1_nrnt0	contig01682___1_nrnt0	Unknown	
1769	22	47	unmapped	0		0	AGAGCAGCATGGAGACGCTTCTTTTTCTATTTCCTCAATTCAACTACATGGCCCCAAAGG	1691	0	UF_Msa_CF_125615	contig06172___0	contig06172___0	Unknown	
1770	22	48	unmapped	0		0	ATGTGATACATTGTAGATTAGTTGTAGTGATTCTAAAACTGAGGCTGGGTATTGGGAAAT	1693	0	UF_Msa_AF_108675	contig29826___1_nr0nt1	contig29826___1_nr0nt1	Unknown	
1771	22	49	unmapped	0		0	TGGTGCGAGAAATCATCCTGAAGAAGCGGGTGGAGCTTTGATGGAGCTTATCAAGAGACC	1695	0	UF_Msa_AF_108218	contig00683___1rc_nrnt0	contig00683___1rc_nrnt0	Unknown	
1772	22	50	unmapped	0		0	ACTTGGCTCAAGGATTTCATGTTCAGTTCCCTGGGGAGTCGTCAAGACAATATCATGAGG	1697	0	UF_Msa_CF_127385	contig01561___0rc	contig01561___0rc	Unknown	
1773	22	51	unmapped	0		0	ATCATGTCCACCGCCCTGGAGAGCTACATTAACCGTACTGTGGCCATCGTCACCTCAGAC	1698	0	UF_Msa_AF_107477	contig04757___1_nr0nt1	contig04757___1_nr0nt1	Unknown	
1774	22	52	unmapped	0		0	ATTCATGTGGCCGGTGACAATTCAGAATATAAAAATATGATCGAATATAATGCAGCCCGA	1700	0	UF_Msa_CF_122941	contig21500___0rc	contig21500___0rc	Unknown	
1775	22	53	unmapped	0		0	TGAGGAGCAGCTCTCAGAGCTCCGGATCTACACTGTGGCCGCAGAGTGGAGTCTTTATTA	1702	0	UF_Msa_CF_123977	contig18118___0rc	contig18118___0rc	Unknown	
1776	22	54	unmapped	0		0	TAACAAGTTTAAGAGTATGTTTCTGGTTGGAGAAGGTGACTGCGTGCTTAGCCAGGTGCT	1704	0	UF_Msa_AF_109935	contig06610___1_nrnt	contig06610___1_nrnt	Unknown	
1777	22	55		1028	E1A	0		390	1	(+)E1A_r60_3	E1A_r60_3	E1A_r60_3		CONTROL
1778	22	56	unmapped	0		0	GGCAGCCATGAGGGCCTGTTTGAGACCAACCAGCTGGTAAGGAGGGAGAACAGCCAGGGA	1707	0	UF_Msa_CF_126574	contig10450___0	contig10450___0	Unknown	
1779	22	57	unmapped	0		0	CGTCCAAAGATGGCAGCCTCCGTGTGGAAGCGATGTGTGACTGCAGCAGTCAAAGTTAAA	1709	0	UF_Msa_AF_103385	contig24028___1_nr0nt	contig24028___1_nr0nt	Unknown	
1780	22	58	unmapped	0		0	AAGGACCTCACATGCATGGCTCAAACGTTGGGTGTGAGGGACATCACAGAGATCAAGTTT	1711	0	UF_Msa_CF_124000	contig09869___0	contig09869___0	Unknown	
1781	22	59	unmapped	0		0	ACCTGAGACCTGGTTGTCCAGCAGAGTACCTTGCCCCACCTGTAGAGCCAAATTCTGTAT	1713	0	UF_Msa_AF_104694	contig06923___1_nrnt	contig06923___1_nrnt	Unknown	
1782	22	60	unmapped	0		0	ACCAGAACAACTTTGAAAATGAGAGAGAGTGTCTGCAGAGATGTCGCACAGAAGCTGTGT	1715	0	UF_Msa_AF_109403	LMB_S454.sd.129.C1___1_nrnt	LMB_S454.sd.129.C1___1_nrnt	Unknown	
1783	22	61	unmapped	0		0	ATGGGATTTCAATCTGTCCCTGAAACAGAAACATGGCAGCTACATTATGTCATACAATGA	1717	0	UF_Msa_CF_126523	contig10684___0	contig10684___0	Unknown	
1784	22	62	unmapped	0		0	ACCTGATGGCCAAAGTCAATGCAAGTCCAAAGAAGAAGGTGCAGGCCAAGTTAAACACTA	1719	0	UF_Msa_AF_109396	contig03200___1_nrnt0	contig03200___1_nrnt0	Unknown	
1785	22	63	unmapped	0		0	TGTGGAACGGACTCACCTTCAACTTCGAGACCATTTTACAGGCCCACGACAGTCCGGTCC	1721	0	UF_Msa_AF_104945	contig07849___1rc_nrnt	contig07849___1rc_nrnt	Unknown	
1786	22	64	unmapped	0		0	TAAAATAAAGGATGATTCAGCCTTCTGTGTCTGTTTGCTACCCGCCACCTGTTGGTTCAG	1723	0	UF_Msa_CF_118539	contig30300___0	contig30300___0	Unknown	
1787	22	65	unmapped	0		0	ATGCAATGGTGGAAGACATGAAGCTGATGTTCCGCAATGCTCGACACTACAATGAAGAAG	1725	0	UF_Msa_AF_103949	contig23043___1rc_nrnt	contig23043___1rc_nrnt	Unknown	
1788	22	66	unmapped	0		0	TAATTAGAAAGAAGAAGATGGTGGGAGACAGGATGATGACTCTGGACAGACACAACCTGG	1727	0	UF_Msa_AF_100863	contig22527___1_nrnt	contig22527___1_nrnt	Unknown	
1789	22	67	unmapped	0		0	GTCATGTTGCAACTTGAGCTAATTCTGTAGGAGTAAAAAGGTAAACATCAGTAAATACTG	1729	0	UF_Msa_CF_123168	contig29912___0	contig29912___0	Unknown	
1790	22	68	unmapped	0		0	AGACAGGCGGCGCTGTCGGCATCCCTCCTAAAGTTTACTCCTGCTCGCTGTGCGCCTTCA	1731	0	UF_Msa_CF_121038	contig10047___0rc	contig10047___0rc	Unknown	
1791	22	69	unmapped	0		0	TCTAATGGAGACTCATTACTGGAGTGGCTGAACACTTTCAGACGCACTGGTAATGCTACT	1733	0	UF_Msa_AF_108432	contig17534___1rc_nrnt0	contig17534___1rc_nrnt0	Unknown	
1792	22	70	unmapped	0		0	CCAAGCAGCTCAAACACCGAATTTCAGCAGGAGAAGCTGGAAAAGCTTGAATCAGAGTGT	1735	0	UF_Msa_CF_119188	contig02194___0	contig02194___0	Unknown	
1793	22	71	unmapped	0		0	AAGTAGGTATGGAATGGGAAGGATGCCCACCCCTTGTTTGTATTCCTGAAGGTAAAAGCT	1737	0	UF_Msa_AF_106937	contig16575___1_nr0nt	contig16575___1_nr0nt	Unknown	
1794	22	72	unmapped	0		0	ATGAAGTCTGAAGTCAAGCACCTCTGTTCTTCTGCAATGCTCCTTACATTTTTTCCCTTT	1738	0	UF_Msa_CF_126888	contig15615___0rc	contig15615___0rc	Unknown	
1795	22	73	unmapped	0		0	TTCCCCACGTGTGGATCATTCACCGTTGCCTCGCTGGAAGACGCCATCTTTATTGTCCCC	1740	0	UF_Msa_CF_123958	contig07617___0rc	contig07617___0rc	Unknown	
1796	22	74	unmapped	0		0	GTTCTGCCCCTCTAAAGATGACTACAGCAAACTGTGTCTGCTCCTCACGTTGCCTCGCCT	1742	0	UF_Msa_AF_107519	contig24206___1rc_nr0nt1	contig24206___1rc_nr0nt1	Unknown	
1797	22	75	unmapped	0		0	TACGCCTCCAAAGTGAAGGCAGCTAAGGGAACAGCTAGTGGAGCGCTGGAGGAGGACCGC	1744	0	UF_Msa_AF_103215	contig28476___1rc_nrnt	contig28476___1rc_nrnt	Unknown	
1798	22	76	unmapped	0		0	CTGGAAAATTCTCTGCCCTTCTATAAATGCTTGTCAGACGTTAGGCTGCAAGACAACGTG	1746	0	UF_Msa_CF_120908	contig26056___0	contig26056___0	Unknown	
1799	22	77	unmapped	0		0	ATTAGCAGAATAAAGACATATCGGATTTTCATTTCCTTTCCTCCGTTTCCCGACCCCCGT	1748	0	UF_Msa_AF_109082	contig17964___1_nr0nt1	contig17964___1_nr0nt1	Unknown	
1800	22	78	unmapped	0		0	TCAGGGAAGTGTACATGAAGAACATTTCAGAACAGGAGTTACTTGGCAAGAAGTTACGCG	1750	0	UF_Msa_AF_106029	contig25338___1_nrnt0	contig25338___1_nrnt0	Unknown	
1801	22	79	unmapped	0		0	TGATGATCGCCCTGCCCAACCTGGACAAGACATTTACCTGTACCCTCTTCATGCCCTTTG	1752	0	UF_Msa_AF_108406	contig21806___1_nrnt	contig21806___1_nrnt	Unknown	
1802	22	80	unmapped	0		0	GTGTCATTCCATATAATCCTGTCTCATGACGTACCAACCAACCCTACTACCGATGTCCCA	1754	0	UF_Msa_AF_104484	contig30197___1_nrnt	contig30197___1_nrnt	Unknown	
1803	22	81	unmapped	0		0	AAACGCTGTTGTGGAGGAACTGAAGGCTTGTGACAGAGGAACAACACTACAACATTCAGT	1756	0	UF_Msa_AF_104107	contig30698___1rc_nr1nt0	contig30698___1rc_nr1nt0	Unknown	
1804	22	82	unmapped	0		0	GTAACGGACGCACTGACCGCAACCTCAAGGTCTCTACATTCTGTATGGAGGCTCTGACCA	1758	0	UF_Msa_CF_121130	contig05645___0rc	contig05645___0rc	Unknown	
1805	23	1	unmapped	0		0	AAAGTAGCATTCCAGGTGGGCAAAATGGAACTGCAACCACATGTTCTTCACCTACAACAC	1759	0	UF_Msa_CF_124366	contig21545___0rc	contig21545___0rc	Unknown	
1806	23	2	unmapped	0		0	AACCGCATGGTCAACCACTTCATTGCAGAGTTCAAGCGCAAGTACAAGAAAGACATCAGT	1761	0	UF_Msa_AF_103801	contig06154___1_nr0nt1	contig06154___1_nr0nt1	Unknown	
1807	23	3	unmapped	0		0	AAATGACTCTCACTACAGTGGGTCTCGTGTGGAGACTCCAGTGTCTTATATGGGGGATGA	1763	0	UF_Msa_AF_104149	contig25472___1rc_nrnt	contig25472___1rc_nrnt	Unknown	
1808	23	4	unmapped	0		0	TCTGGATTACATAAATCTAAAGCCAGCCGCAATAAAAGCCTGTTTGACAGTGAGCGCTGT	1765	0	UF_Msa_AF_108729	LMB_S454.sd.483.C1___1_nrnt	LMB_S454.sd.483.C1___1_nrnt	Unknown	
1809	23	5	unmapped	0		0	TAGAGCTTTCCTTTCTGAGTGACGACGTCAAACTGGATGTTTTCTTCTTCTACGAGGACG	1767	0	UF_Msa_AF_102940	contig28637___1_nrnt	contig28637___1_nrnt	Unknown	
1810	23	6	unmapped	0		0	GAACGTGTGATGAAAGGATGAACAGAGATACTTTAAGGGTTAACTCAGATTACATCGGGT	1769	0	UF_Msa_CF_125551	contig20457___0rc	contig20457___0rc	Unknown	
1811	23	7	unmapped	0		0	CCTGTCTAATGATGCCATGACAGCTCTCTGTTCAGCGCTATGCAGCACAGACCCAGACAG	1771	0	UF_Msa_CF_126357	contig02443___0	contig02443___0	Unknown	
1812	23	8	unmapped	0		0	TCAAGAAAACACGCATCTTAATGCTTATATCACTGTGACAGAGGAGCTGGCACTGACGCA	1773	0	UF_Msa_CF_122391	contig13164___0rc	contig13164___0rc	Unknown	
1813	23	9	unmapped	0		0	TCAACTGAAAAGGTTAAAGGCAACCCTCAACAGGACATGAGGAGAATAAAGTTTGGAAAA	1775	0	UF_Msa_AF_104469	contig02274___1_nr0nt	contig02274___1_nr0nt	Unknown	
1814	23	10	unmapped	0		0	TTTATTAGAAAGATTTAGACATTACAAGAGTGCTTCTTTATTAATTTAATTTAGCACAAG	1777	0	UF_Msa_AF_100515	contig21984___1_nr0nt	contig21984___1_nr0nt	Unknown	
1815	23	11	unmapped	0		0	CATGTAGGAACTTTGCCAAAGACCAGGCAGCAAGAAAAAATTTCTCCAAAGACAACGGCA	1779	0	UF_Msa_AF_100957	contig21602___1_nrnt	contig21602___1_nrnt	Unknown	
1816	23	12	unmapped	0		0	GACATCCCAGCAGGGACTGAACTAACCTTTAATTACAACCTGGACTGCCTCGGCAATGAG	1781	0	UF_Msa_AF_106281	contig01923___1rc_nrnt	contig01923___1rc_nrnt	Unknown	
1817	23	13	unmapped	0		0	GAGAGGATCAGTCTCTGAGGCTCAATGCATAAGCTGTGTGGAGTTCATCACTTCCACCTT	1783	0	UF_Msa_AF_101517	contig19485___1_nr0nt	contig19485___1_nr0nt	Unknown	
1818	23	14	unmapped	0		0	TTGACGAACAGGTATCAGCAGGTCACCCGAAACTGAGACACGCAACAGGGGGTAGGCAAG	1785	0	UF_Msa_CF_120623	contig25033___0	contig25033___0	Unknown	
1819	23	15	unmapped	0		0	ATCCTGAGCACCATCGACAGAGAGCTGCTGAAACCCAATGCCTCAGTGGCCTTGCACAAG	1787	0	UF_Msa_AF_105100	contig29680___1rc_nrnt	contig29680___1rc_nrnt	Unknown	
1820	23	16	unmapped	0		0	AGCGCTGGTGTGTATGAGCTCTTGGGGCCAGGGCCACTTCCTCAGCAGCAACAGGCCAAA	1789	0	UF_Msa_CF_126900	contig26847___0	contig26847___0	Unknown	
1821	23	17	unmapped	0		0	GTTTGAGAAGTCGCTGAGCTCTCTCCAGGCCTTCTTTTATCTGACGGTCATTCTCACTGT	1791	0	UF_Msa_CF_123467	contig27084___0rc	contig27084___0rc	Unknown	
1822	23	18	unmapped	0		0	ATCCAAAGATCCAGATGTTCTGACTAAAGAGATGGCTGTGCTTGGGCATGACCTGATGTT	1793	0	UF_Msa_AF_100217	contig28258___1rc_nrnt0	contig28258___1rc_nrnt0	Unknown	
1823	23	19	unmapped	0		0	AATCAGGAGGAGTGCAGCCGGCCCCAGGAGGAGGAAGACATCATGGACATCCCCCTGGAT	1795	0	UF_Msa_AF_103938	contig18709___1rc_nrnt	contig18709___1rc_nrnt	Unknown	
1824	23	20	unmapped	0		0	CAAGAAGATCTATGAAGACTTCATCCAGTCTGAGGGACCTAGAGAGGTGAACATTGACCA	1797	0	UF_Msa_AF_106310	contig13512___1rc_nrnt	contig13512___1rc_nrnt	Unknown	
1825	23	21	unmapped	0		0	ACTGAAAGAAAATCTTAACTGCCGGGATTCAGTTACGCTTCTTCTGTCGTGCTCCGACTT	1799	0	UF_Msa_AF_106318	contig08692___1_nr0nt	contig08692___1_nr0nt	Unknown	
1826	23	22	unmapped	0		0	AACCTCACCGAAAATCTGAGAGTGCCTGAGAGATCCCTCCTCATCAAATCAGACAACTTA	1801	0	UF_Msa_CF_121520	contig10979___0rc	contig10979___0rc	Unknown	
1827	23	23	unmapped	0		0	ACCAGAGGGGAGCTCCACAGTCATCTGGTGGGAGGAGCAGAAGACCTCAGGTTTTGGGAC	1803	0	UF_Msa_CF_125511	contig12256___0	contig12256___0	Unknown	
1828	23	24	unmapped	0		0	CTCAATGTTCCCATTAAAATCTGATGCGGCCCTTCAGTCTGACAATAAAGCAAATTTTTT	1805	0	UF_Msa_CF_124653	contig22678___0	contig22678___0	Unknown	
1829	23	25	unmapped	0		0	ACACTCTTAAATAGCAGCTTTTGTACAGCACACACAAGAAGCAACAAAACAATAAATGAC	1807	0	UF_Msa_AF_100294	contig02713___1_nr0nt	contig02713___1_nr0nt	Unknown	
1830	23	26	unmapped	0		0	TTCTCGCCGGTGACCGCCTGGCATACGTGAACGGGGAGAGCGTGGAGGGGGAGAGCCACC	1809	0	UF_Msa_CF_126566	contig23808___0rc	contig23808___0rc	Unknown	
1831	23	27	unmapped	0		0	AAGACCCTGGGGGCCAATGCACAGACTCTGACCATCCTTACCACAGTGTGCCTGGAAGAT	1811	0	UF_Msa_AF_102047	contig21834___1_nr1nt0	contig21834___1_nr1nt0	Unknown	
1832	23	28	unmapped	0		0	ATCAGCTGTGCTACAATTACAGCTGCACAAAGACGTCCAGCCGACAGGGCAAATTACATT	1813	0	UF_Msa_CF_125431	contig07233___0	contig07233___0	Unknown	
1833	23	29	unmapped	0		0	CATACCTGTTAAGATACATGGATGCTTTTGTAAAACAAGTCCCAGTTTCAGAGACTATTT	1815	0	UF_Msa_AF_105661	contig11634___1_nr0nt1	contig11634___1_nr0nt1	Unknown	
1834	23	30	unmapped	0		0	ATGGGCCTGGACTTGGTGCTATACACTGTAAAGCAAAGAGGCACAGATAAAATAGCACAA	1817	0	UF_Msa_CF_125270	contig21859___0	contig21859___0	Unknown	
1835	23	31	unmapped	0		0	AGCAGGAAAGCCTCACAGAGGATTAACACTTTATTGATTCACCTTTCTCAGACACTCATT	1819	0	UF_Msa_CF_124512	contig10842___0rc	contig10842___0rc	Unknown	
1836	23	32	unmapped	0		0	AAGGTCCTCCTGAGATTAACCCCGGATGTGGGAAGTCACAACCACAACTAATCATAATGT	1821	0	UF_Msa_CF_122764	contig31033___0	contig31033___0	Unknown	
1837	23	33	unmapped	0		0	CCAACAAGACGCTCTTCGCTATGGAGGACGGCTACGTCAGGTTCACCAAGGAGGTCTAAC	1823	0	UF_Msa_AF_108018	LMB_S454.973.C1___1rc_nrnt	LMB_S454.973.C1___1rc_nrnt	Unknown	
1838	23	34	unmapped	0		0	CTTGATCCATCTTTAGTTACCCAGTTCTACTCTGTCTTCATCTTTCCAGACCCTTTCCCA	1825	0	UF_Msa_CF_118402	contig17291___0rc	contig17291___0rc	Unknown	
1839	23	35	unmapped	0		0	CAGAACCAGACACATGCCAAGAGGGCATACCGGGAGTTGGTGCTCATGAAATGTGTCAAT	1827	0	UF_Msa_AF_108440	contig20619___1rc_nrnt	contig20619___1rc_nrnt	Unknown	
1840	23	36	unmapped	0		0	TTCAATGGCCACCAACGCGACGATGAAAGAATCGACGGAGACGAAACGCCCACGAAGCAG	1829	0	UF_Msa_CF_124219	contig12713___0rc	contig12713___0rc	Unknown	
1841	23	37	unmapped	0		0	AAACCGCGACAAGATTCTAGCAGCTAGCTACCTCTGATACACAAACACAGTCAAACACGT	1831	0	UF_Msa_AF_102641	contig29563___1_nrnt	contig29563___1_nrnt	Unknown	
1842	23	38	unmapped	0		0	TAATTTGGATACCAAACATTCCATGTGATCTCGATGGCCGCTGTTTGTATTAATCTGAAC	1833	0	UF_Msa_AF_103602	contig30359___1_nrnt	contig30359___1_nrnt	Unknown	
1843	23	39	unmapped	0		0	TCAGTATCGACTTAGACTCTTCCAGCAACAACAGTGACTCTAAACGGACAGAATGTGCAG	1835	0	UF_Msa_AF_101469	contig09249___1rc_nr0nt1	contig09249___1rc_nr0nt1	Unknown	
1844	23	40	unmapped	0		0	CCTACGGTGCAGGACTTGAGGGAGGCAGCACAGGAACTGCATGTGAATTTGTTGTGAACA	1837	0	UF_Msa_AF_100081	contig21303___1rc_nrnt	contig21303___1rc_nrnt	Unknown	
1845	23	41	unmapped	0		0	ACGTGTCTAAAGAGGTAGATCAAAACAAACTGCAGAGGAATGGAATGGGGAGGGTGGTTT	1839	0	UF_Msa_CF_117792	contig20898___0rc	contig20898___0rc	Unknown	
1846	23	42	unmapped	0		0	TCATCTGCTTGCTGGTGGCATATATCACAGAAATACAACAAACTCCGTCAGCCATTCTTT	1841	0	UF_Msa_CF_120310	contig15822___0rc	contig15822___0rc	Unknown	
1847	23	43	unmapped	0		0	TGACTGTGTCCAGTTAAAGAGGCGCACCGTCACCCCTGCCTACCTTTGTTCAGGGTCATG	1843	0	UF_Msa_AF_102923	contig18208___1_nrnt	contig18208___1_nrnt	Unknown	
1848	23	44	unmapped	0		0	GTTTACGAGCCGGCGGAGGACTCTTTTCTTTTGATTGACGCTCTGGAGAAAGATGCGGAG	1845	0	UF_Msa_AF_105310	contig12520___1_nrnt	contig12520___1_nrnt	Unknown	
1849	23	45	unmapped	0		0	AAGAACGGGTAAAAGATGCAGTAAGAGCAAAGGATGTGAAGGCTGCGATTCCTTACGAGT	1847	0	UF_Msa_AF_104486	contig04399___1rc_nr1nt0	contig04399___1rc_nr1nt0	Unknown	
1850	23	46	unmapped	0		0	GATGTGCCTGAACCTTACTGGAACCAACTTCCTGATACAAAGAACTGCAGCGAGACGTCA	1849	0	UF_Msa_AF_101805	contig07990___1_nrnt	contig07990___1_nrnt	Unknown	
1851	23	47	unmapped	0		0	CTGGGAGAGGAATGCGCTGGGATGCGGAGCAGCACCGACTCTAGGAAATCGACGCAACAA	1851	0	UF_Msa_CF_124546	contig11580___0	contig11580___0	Unknown	
1852	23	48	unmapped	0		0	AACTCAGAGACCCAACATGACATGGCTCAGAAGGAGCTTATAAAATGCGATCCACCTTCA	1853	0	UF_Msa_CF_127238	contig29223___0rc	contig29223___0rc	Unknown	
1853	23	49	unmapped	0		0	TTATTTTATTTGTTTTAGTACAACAGTTCAAGTCAACTAGCCACTGTATCTATTGAGATG	1855	0	UF_Msa_AF_104814	contig05714___1_nr0nt1	contig05714___1_nr0nt1	Unknown	
1854	23	50	unmapped	0		0	GAATGCAGCATTTATATTTCGATTGTAGTGTACCAACACTTGGCTTACAAAGAGGAAAAA	1857	0	UF_Msa_AF_102966	contig32558___1rc_nr0nt	contig32558___1rc_nr0nt	Unknown	
1855	23	51	unmapped	0		0	AGAAGCTGACATGGTTCAGCTACATGCGGCGGGGCTACCTGTTGGTATCCCAAAGTGGTG	1859	0	UF_Msa_AF_109149	contig24707___1_nrnt	contig24707___1_nrnt	Unknown	
1856	23	52	unmapped	0		0	TAGTTGATGTGTGGAGGGACTGCCATACAACCAATAGGGAATATACCCACTATTCATGCG	1861	0	UF_Msa_AF_107322	contig12792___1rc_nrnt0	contig12792___1rc_nrnt0	Unknown	
1857	23	53	unmapped	0		0	TTGCTGGGCTGTTTGACCTGAAGGCAGCAGGTTTTGTGGACCCGATCCTGGTATCTGGGA	1863	0	UF_Msa_AF_108527	contig20196___1_nrnt	contig20196___1_nrnt	Unknown	
1858	23	54	unmapped	0		0	AACTCTGCCAACATTGCCCTGCCCAATCCAGTGCTGAGCTCTCTCATCTTATGTCCTTTA	1865	0	UF_Msa_CF_119811	contig19644___0rc	contig19644___0rc	Unknown	
1859	23	55	unmapped	0		0	TGGAATCGGGAAATCCTATGCGGAGGAGCTGGCTCGTCGAGGATTTGCCATGATGTTGAT	1867	0	UF_Msa_AF_107262	contig00100___1_nrnt	contig00100___1_nrnt	Unknown	
1860	23	56	unmapped	0		0	AGCTCAACTCGCCAAATAAAGCCTCAACCTGAGCGAGAGAGACTGCTCAACCTCAGCAGA	1869	0	UF_Msa_CF_124910	contig29821___0	contig29821___0	Unknown	
1861	23	57	unmapped	0		0	GCTCTGGCCTCTAGGTGTCACCTTTTATTTTGGTTGTTTTGACTTCTTTCTACAGATTTC	1871	0	UF_Msa_AF_106678	contig14992___1_nrnt	contig14992___1_nrnt	Unknown	
1862	23	58	unmapped	0		0	AGACAGTGTGCTATTTAAATAGCATAAGAAACGTGTTTGTGTAATGTGTTAGATGGGAGT	1873	0	UF_Msa_AF_101897	LMB_S454.sd.388.C1___1rc_nr0nt1	LMB_S454.sd.388.C1___1rc_nr0nt1	Unknown	
1863	23	59	unmapped	0		0	AGAAGCTAGAGCTAAATCATGGACACCGTCGCTGGTAACGTAAACAGCTTCCGCCCCCCG	1875	0	UF_Msa_CF_123999	LMB_S454.844.C1___0rc	LMB_S454.844.C1___0rc	Unknown	
1864	23	60	unmapped	0		0	GGTTCAATATGAGACAGAGTTGAGTAAAAGCTTGCTTGGGGACTTGGACGACAAAACCTG	1877	0	UF_Msa_CF_119270	contig29340___0	contig29340___0	Unknown	
1865	23	61	unmapped	0		0	TACCCAGACCCAGACGACCAGGTGGAGGATGAGATGATCAGTGTGTGGTATGTGAGGACT	1879	0	UF_Msa_AF_101319	contig17391___1_nrnt	contig17391___1_nrnt	Unknown	
1866	23	62	unmapped	0		0	ACAAAACCTGCTGAACGCCACACCCTGCTCTGCTCCTATCTTGCCTGGACTAACTCCCCT	1881	0	UF_Msa_CF_121176	contig26613___0rc	contig26613___0rc	Unknown	
1867	23	63	unmapped	0		0	TTTTCAAGTGTTTTTGTGAGATAAGCGGTAGGTAAGTGGTTTGCGACCATGTCAGGGGAG	1883	0	UF_Msa_CF_121402	contig28659___0rc	contig28659___0rc	Unknown	
1868	23	64	unmapped	0		0	TATGCTGCAAAGATACTTCTATCCTAACGGAGCACAGATGAGGGGAAGAAGGGGTTTGAT	1885	0	UF_Msa_CF_120248	contig01062___0	contig01062___0	Unknown	
1869	23	65	unmapped	0		0	TGTTGATGTTGTTTCTGCTTTACTCGCCGCGGGGTCCAAGGTCAACCCTCGCACCATCGA	1887	0	UF_Msa_AF_102522	contig10459___1rc_nr1nt0	contig10459___1rc_nr1nt0	Unknown	
1870	23	66	unmapped	0		0	AAAGACTAAAGTGATGTTTTTGTAGGAAAGTTTCCTCGCTCAGGGACACGAGGGGAGTGA	1889	0	UF_Msa_CF_120335	contig05334___0rc	contig05334___0rc	Unknown	
1871	23	67	unmapped	0		0	GATACCTCATTTTGATTTTCGCCGAGGTCTTGGGTCTCTACGGGCTCATTGTTGCCCTCA	1891	0	UF_Msa_AF_103679	contig03174___1_nr0nt1	contig03174___1_nr0nt1	Unknown	
1872	23	68		0		0		1893	1	RC11	RC11	RC11		CONTROL
1873	23	69	unmapped	0		0	AAAGATCACATTCAGTACCTGCAAAAACAACAGCACTGGCCAGAAGGGTTTATGGAGGAG	1895	0	UF_Msa_AF_109712	contig27317___1rc_nrnt	contig27317___1rc_nrnt	Unknown	
1874	23	70	unmapped	0		0	AAAGCAGCAAACATGGACAAAGAAAGTACTGGCACTCAATACGAGCCTGTGGCTGAGATT	1897	0	UF_Msa_CF_121565	contig10072___0rc	contig10072___0rc	Unknown	
1875	23	71	unmapped	0		0	GAAGTGAGAGCTTTTGGATTTGGACACATAAAAACGCATCATCTGAGTTATTTGACATTA	1899	0	UF_Msa_CF_126524	contig08602___0	contig08602___0	Unknown	
1876	23	72	unmapped	0		0	ACCTAAGGTTAGTACTGCAGGGCACAAAGTGGACAAGGGCACAGAGCGTAGGACAGCACA	1901	0	UF_Msa_AD_200351	LMB_Add_11	LMB_Add_11	Unknown	
1877	23	73	unmapped	0		0	TCATGAAACAGAAAACCTTCGCAGCCAGACCAACCAAGCTCTCTTCTACCGTGCGCAGCA	1903	0	UF_Msa_CF_122324	contig19149___0rc	contig19149___0rc	Unknown	
1878	23	74	unmapped	0		0	AGATGACTGTCTGGGCTAAAGGAAAACACCGCGGCTACTTAAAGGAGTTCAGAGATTATC	1905	0	UF_Msa_AF_104130	contig27738___1_nrnt	contig27738___1_nrnt	Unknown	
1879	23	75	unmapped	0		0	CAAAACAACTGACAAGCAAGAACATGGTTATTTCTCGGCTGTGATTCACATCCCTGAGTA	1907	0	UF_Msa_CF_127715	contig01729___0rc	contig01729___0rc	Unknown	
1880	23	76	unmapped	0		0	ACAGTTTGAGTAAGGAGCAGCTGGAGGCGATTGTGGCTGAGCTGCAGAAGAAGGTGAAGT	1909	0	UF_Msa_CF_125251	contig16398___0	contig16398___0	Unknown	
1881	23	77	unmapped	0		0	TTCTGTTATTTTCATGGTGGACTCAGCCAACATTGTTCAGATATCCTCTTCTTGTATCCA	1911	0	UF_Msa_AF_101535	contig02568___1rc_nrnt-1	contig02568___1rc_nrnt-1	Unknown	
1882	23	78	unmapped	0		0	TCACGGCTCAGAGCACTCAGGCACTGGGAGAGAAGTACCAGAGTGGACACATTCGTCCAT	1913	0	UF_Msa_CF_124277	contig16049___0rc	contig16049___0rc	Unknown	
1883	23	79	unmapped	0		0	CCGACCAAGTTCAGCTTCTACCCAACATGGATATATACTTCTAAACTTTTGATTTTGTTT	1915	0	UF_Msa_AF_107422	contig22579___1rc_nr0nt	contig22579___1rc_nr0nt	Unknown	
1884	23	80	unmapped	0		0	CCAACTGATAAGAACATTTGCAGTGAATCTGCTACTTCTTCATTGAGGTGGAGTGTGGTG	1917	0	UF_Msa_AF_108743	contig20666___1_nr0nt	contig20666___1_nr0nt	Unknown	
1885	23	81	unmapped	0		0	TTTGTGAGATGCTGCTGAAGGCCGGGGCCAAACACAACCTCACCAACATGTACGGCCTGA	1919	0	UF_Msa_AF_107949	contig17346___1_nrnt0	contig17346___1_nrnt0	Unknown	
1886	23	82	unmapped	0		0	CTCTTTGCCACTTTCCTTGAAGCCATCTTTCCTTTCTCCATTCCTTCTCTCCCTTCCATT	1921	0	UF_Msa_AF_109772	contig01743___1rc_nr0nt	contig01743___1rc_nr0nt	Unknown	
1887	24	1	unmapped	0		0	AACACGGTCGGACGGCACGGAGGAAGACTTGCAATGAACAGGATACGAATCCACGTTTTG	1760	0	UF_Msa_CF_125046	LMB_S454.261.C1___0	LMB_S454.261.C1___0	Unknown	
1888	24	2	unmapped	0		0	TATCGCTAACGTTGCCCTGGGAACCTCCAGCCGGGGAGTACTGCTGTTGCTGGTATTGTT	1762	0	UF_Msa_AF_102296	contig20884___1_nr0nt1	contig20884___1_nr0nt1	Unknown	
1889	24	3	unmapped	0		0	ATTGAAATACTGTCGTGACCACTGGGATCTTCACAGATGGTGCTGCCAGCACTTGTAACA	1764	0	UF_Msa_CF_122356	contig25269___0	contig25269___0	Unknown	
1890	24	4	unmapped	0		0	ATTTGCTATGACTTGAGGTTTGCAGAGCTTGCACAGCTCTATAGTAGGAAAGGCTGTCAG	1766	0	UF_Msa_AF_109731	contig11926___1rc_nrnt	contig11926___1rc_nrnt	Unknown	
1891	24	5	unmapped	0		0	GCAGTGCACGATGTGTGAAAAGAATTTTACTTTACTGAGGCGCTTGAGGGAACACTACGA	1768	0	UF_Msa_AF_109646	contig01124___1rc_nrnt0	contig01124___1rc_nrnt0	Unknown	
1892	24	6	unmapped	0		0	TGTCTGGAAATGTGTAAAGCCAAGGGCTTCGTGCACGGCTCTGCTCAGCAGCGTCAACAG	1770	0	UF_Msa_CF_119162	contig20889___0rc	contig20889___0rc	Unknown	
1893	24	7	unmapped	0		0	ACCTGGCTCTTGTGCCCCTCAGCCATGGATCCTTCCTAGGTTATAGAAAAAGCAGGAAAG	1772	0	UF_Msa_CF_117967	contig25074___0	contig25074___0	Unknown	
1894	24	8	unmapped	0		0	CAAAAAGGCACCAGCGAAGAAACCCAAGCCAGCCAAGCCCAAGGCAAAACCAGCAAAGAA	1774	0	UF_Msa_AF_103417	contig26639___1rc_nrnt0	contig26639___1rc_nrnt0	Unknown	
1895	24	9	unmapped	0		0	AACCAGATATGTGGATTTACGGTACTGCCACTACGTAGTAGACCTGGACACAGATGAAGA	1776	0	UF_Msa_AF_109960	contig32792___1_nrnt	contig32792___1_nrnt	Unknown	
1896	24	10	unmapped	0		0	TACTCCAAAGAGGCAAAAGGAGGACAAACAATTACCACGCTAAAAATGAAGCAGAGAGAG	1778	0	UF_Msa_CF_123159	contig07699___0rc	contig07699___0rc	Unknown	
1897	24	11	unmapped	0		0	CTCTTGGTCATCCTACTGCTGGTTGCCACTCAGCTGGTCGTCCCTTTGATCTCAGAACTT	1780	0	UF_Msa_AF_100608	contig24717___1_nr0nt1	contig24717___1_nr0nt1	Unknown	
1898	24	12	unmapped	0		0	TTTTGAAGAAGCTGCAGGAGAAGAGGGAGGAGGTGAGCCGCTCTGAGGACATCAAGATAT	1782	0	UF_Msa_CF_121305	contig14144___0	contig14144___0	Unknown	
1899	24	13	unmapped	0		0	AGCACGAAACCAGGCTTCATTTCTTTTGCCAACAGAAAGCTACACATGTACAGCACTTCC	1784	0	UF_Msa_CF_126427	contig20483___0rc	contig20483___0rc	Unknown	
1900	24	14	unmapped	0		0	TATGGTTTTACAAAATCAATTGACACATGTTGGTGAAACGTGGGCAGCTTGGCCCTCTGC	1786	0	UF_Msa_CF_119093	contig11277___0rc	contig11277___0rc	Unknown	
1901	24	15	unmapped	0		0	TGTCCGATTTTTAATGAGTCACTGCGGTCTTTATGTTGCTTTCAGGCCCAGGCAAACAGA	1788	0	UF_Msa_AF_107279	contig30312___1_nrnt	contig30312___1_nrnt	Unknown	
1902	24	16	unmapped	0		0	CCTGACAGGTCCTTCCTGCAGACATATTAAGAAGGGAACGGACCAAACTCTTTTAAAGAA	1790	0	UF_Msa_AF_101729	contig32157___1rc_nr1nt0	contig32157___1rc_nr1nt0	Unknown	
1903	24	17	unmapped	0		0	CTGGAGATGATGCCCACAGGAGAGGATAACGCTGCTAAGAAGAAGAAAAGGGTGCGTTTT	1792	0	UF_Msa_CF_124312	contig02986___0rc	contig02986___0rc	Unknown	
1904	24	18	unmapped	0		0	CGTACAATGTGCGGGACACTGGATTACCTCCCTCCAGAGATGATTGAGGGTCACACTCAC	1794	0	UF_Msa_AF_104627	contig08642___1_nrnt	contig08642___1_nrnt	Unknown	
1905	24	19	unmapped	0		0	TGTCCTGTCTGAACTTTGTTCTCCACATTCAGCATCAGTTGAAGCAGTTCCTGCTTTCAG	1796	0	UF_Msa_CF_122658	contig24652___0	contig24652___0	Unknown	
1906	24	20	unmapped	0		0	ACCTAAATGAAATGATCTTTCGACTGTATGATGTCGGCCAGCGTAGTGAGAGGAGGAAGT	1798	0	UF_Msa_AF_107660	LMB_S454.sd.569.C1___1_nrnt	LMB_S454.sd.569.C1___1_nrnt	Unknown	
1907	24	21	unmapped	0		0	CTTCTGGCGGAGATCGAGCTGAAGTCTGAGTCCAACCAGCAGAACTACTGGATGATCCAG	1800	0	UF_Msa_AF_109776	contig11747___1_nr0nt	contig11747___1_nr0nt	Unknown	
1908	24	22	unmapped	0		0	GGCATGACATCATCTCATGTCAGATGCTGTTACACTGTGGTATGGTTGGATTAGTTTATC	1802	0	UF_Msa_CF_118974	contig12921___0	contig12921___0	Unknown	
1909	24	23	unmapped	0		0	AAACCGTGCTGACATCACAGCCCAGCCCTCCAATCAGATTGACAGCCGTGACTATCTCCT	1804	0	UF_Msa_CF_119765	contig26492___0rc	contig26492___0rc	Unknown	
1910	24	24	unmapped	0		0	TGAAGACCGCTGCGTGACATTTGGTCTTAGAGGTTATTGTAGGAGGGGAGGGCTTCATTT	1806	0	UF_Msa_AF_107035	contig15641___1_nr0nt	contig15641___1_nr0nt	Unknown	
1911	24	25	unmapped	0		0	CTTTTTGGTTTCATGGTTTCTGTTGTTTTTCTAATGGACAGACGTCCTAACTGTAACCTG	1808	0	UF_Msa_CF_125946	contig00742___0rc	contig00742___0rc	Unknown	
1912	24	26	unmapped	0		0	TTTCCCGCAGTACAAAGTATAAAGCCACGGTGCGATCTGCGCAACATCAGCTTCCCATCT	1810	0	UF_Msa_CF_120311	contig25501___0rc	contig25501___0rc	Unknown	
1913	24	27	unmapped	0		0	TTGGTTTTGGGCGAAGTGCGTTGAGTCCCACAAAAAGTCTTCAAAAGATTGGATGGATAC	1812	0	UF_Msa_CF_125385	contig27674___0rc	contig27674___0rc	Unknown	
1914	24	28	unmapped	0		0	AACACGTCTGACGTGCCGACGATTCCCCAGGAACTCGTGAAGAAGTACATCATCTACGCC	1814	0	UF_Msa_CF_123713	contig11229___0rc	contig11229___0rc	Unknown	
1915	24	29	unmapped	0		0	ACCCGAGGATTCATCCGCAACCAAGGTCAAGGCGGGGAGGTGTATTGCCCCAGTGGAGAG	1816	0	UF_Msa_AF_106403	contig06180___1rc_nr1nt0	contig06180___1rc_nr1nt0	Unknown	
1916	24	30	unmapped	0		0	AGTTGATCAGATCATCATGGCTAAGGCTGCAGGGGGACCCAAGGCTCCCAAGCAGAGTAG	1818	0	UF_Msa_AF_101234	contig23986___1_nr0nt	contig23986___1_nr0nt	Unknown	
1917	24	31	unmapped	0		0	TCTTGAGTTGGCCAATAGAGTTTACCGTCAAAATCTCGGTTGTCCTCAGGTAAGTCACAG	1820	0	UF_Msa_AF_104298	contig30881___1_nr0nt	contig30881___1_nr0nt	Unknown	
1918	24	32	unmapped	0		0	CTGCTGGACTGGATGAACACCTGATTCTCTCATGGTCTTTGTACTCTGATGCTCTGCTGG	1822	0	UF_Msa_AF_106990	contig09144___1_nr0nt	contig09144___1_nr0nt	Unknown	
1919	24	33	unmapped	0		0	CTTTAACAACAGCAGGAATAGTTACCTACAAACTGGGTTTCTCAGAAGAGCACAGACTGG	1824	0	UF_Msa_CF_121692	contig15197___0rc	contig15197___0rc	Unknown	
1920	24	34	unmapped	0		0	GAAGAGCCGCGCATCTACAAGCAGATTCATCACTTATCTCTTAAAGCTCTTATCCAGGGT	1826	0	UF_Msa_CF_125934	contig01638___0rc	contig01638___0rc	Unknown	
1921	24	35	unmapped	0		0	GAAATGCTGATTTGACGTCAGATAATTGTGCCTAACCTTACTTTGATTTGTGTTCTTTGA	1828	0	UF_Msa_CF_119146	contig12137___0	contig12137___0	Unknown	
1922	24	36	unmapped	0		0	GGATGAGGCTGATCGGATGTTGGATATGGGTTTTGAGCCTGATATGCGTCGTTTGGTAGG	1830	0	UF_Msa_AF_107584	contig19604___1rc_nrnt	contig19604___1rc_nrnt	Unknown	
1923	24	37	unmapped	0		0	GCCGCTGAAACGCATCGAGGGTGTGATGGAAAGGGATCGCTACATGAGTCCCATGGAGGC	1832	0	UF_Msa_CF_123086	contig17186___0	contig17186___0	Unknown	
1924	24	38	unmapped	0		0	GCCGCTTCAGGCTTTGTCCTGCAGCCAGACACCTGGCCGTCTACCTGCTGGACCTTTTCA	1834	0	UF_Msa_AF_103604	contig15622___1_nr0nt	contig15622___1_nr0nt	Unknown	
1925	24	39	unmapped	0		0	GTATGGTTGGGAGTTTCTTCATGAAACCTACTTGTACCATCTGACCAGAAGGGACATCAG	1836	0	UF_Msa_AF_107445	contig20100___1_nrnt0	contig20100___1_nrnt0	Unknown	
1926	24	40	unmapped	0		0	ACCACAGGGGGTCGGTGGTCAGGACAAGATCAGGCCACTCTGGAGGCATTACTTCCAAAA	1838	0	UF_Msa_AF_104353	contig23304___1_nr0nt1	contig23304___1_nr0nt1	Unknown	
1927	24	41	unmapped	0		0	TTCAAAATGCAGATCTTTGTGGAGACCCTGACTGGCAAGACCATCACTTTAGAGGTTGAG	1840	0	UF_Msa_AD_200031	LMB_Add_78	LMB_Add_78	Unknown	
1928	24	42	unmapped	0		0	AGGGTAGTAAGCTATCGGCAAAAAAGATTTGTTAAGCCCACTTTTTGGTGGGTGACCTCT	1842	0	UF_Msa_CF_122198	contig16244___0rc	contig16244___0rc	Unknown	
1929	24	43	unmapped	0		0	TCTGGTCCATCTGACAAAATGACGGATAGAACGAGGGGAGTGGGTTCAGACAATTTTCTA	1844	0	UF_Msa_CF_124542	contig28866___0	contig28866___0	Unknown	
1930	24	44	unmapped	0		0	TCAGTCATGGTCAGCAAGGTGGTGAAACCTGATGGGACAGTAGAGGAGAGGCGAACAGTC	1846	0	UF_Msa_AF_106516	contig03037___1_nrnt	contig03037___1_nrnt	Unknown	
1931	24	45	unmapped	0		0	GGCTTTGCAGAAAATTCTAGCTAATGTCGAACTTACTCTTCCTTTTTGGTGTCTAATTAG	1848	0	UF_Msa_CF_124973	contig28979___0rc	contig28979___0rc	Unknown	
1932	24	46	unmapped	0		0	ACACGAGTTAAAGCTTTTGTTTTAGATGAGCTGTCTGGTGTCGTGTGTTCAGACCTTGTC	1850	0	UF_Msa_AF_104652	contig06061___1_nrnt	contig06061___1_nrnt	Unknown	
1933	24	47	unmapped	0		0	GACCTGTGATTGACAGACGCTGCTCTCGTTGTAATAAAGAAGGGATGATTTACCACACCA	1852	0	UF_Msa_AF_107903	contig30804___1_nrnt	contig30804___1_nrnt	Unknown	
1934	24	48	unmapped	0		0	TGAAATACAAGTAGACGCCAACTGTGACAAACGATTCAGGGACATTATGACATGAACCGA	1854	0	UF_Msa_CF_119874	contig17457___0	contig17457___0	Unknown	
1935	24	49	unmapped	0		0	TCCAGTGTGTAAAGACGATTACAGTGTTGGAGAAAATGTGAGGCAGCTCCCATGCAATCA	1856	0	UF_Msa_AF_102473	contig15582___1_nrnt	contig15582___1_nrnt	Unknown	
1936	24	50	unmapped	0		0	GGCAGCACAACACCAGAGCTGAACGGAACAATGGTTGAAGCAAATGGCGATGAAGCTCTC	1858	0	UF_Msa_CF_125752	contig01894___0	contig01894___0	Unknown	
1937	24	51	unmapped	0		0	GCCCTTCTCGCCACAGAAAAGCTATCTAGATGTTTTATAGAGTTTTATTTTTATCAACGT	1860	0	UF_Msa_CF_124214	contig07298___0rc	contig07298___0rc	Unknown	
1938	24	52	unmapped	0		0	CAAAGTTCTCAATGAGGGGACCAAACCTTCCTTCTCCCCAATGGCCTGCTGGACAGTGAC	1862	0	UF_Msa_CF_117943	contig06824___0	contig06824___0	Unknown	
1939	24	53	unmapped	0		0	TAGACTCAAAGGGCGCCTACCAAAATGCCTTTGATATCAGCAAAGAAGAAATGCAGCCCA	1864	0	UF_Msa_AF_100658	contig12384___1rc_nrnt	contig12384___1rc_nrnt	Unknown	
1940	24	54	unmapped	0		0	ATAAAGTCTGTCTCAATTATGGCCAGTAGCCAGACCTTCCACTCTGGAAAAATGTGCTGG	1866	0	UF_Msa_AF_103110	contig09804___1_nrnt0	contig09804___1_nrnt0	Unknown	
1941	24	55	unmapped	0		0	TCCCTGCATGAGAGCGTCAACTGGATCATCCTGAAGGAGCCTATTGTAGTTTCTGAAAAA	1868	0	UF_Msa_AF_101767	contig25187___1_nr0nt	contig25187___1_nr0nt	Unknown	
1942	24	56	unmapped	0		0	GCTTCAGCTCTGGCACCTCCTACCCGATGACATCACGCCTGTTCAGCTCCAGCGTCAGCA	1870	0	UF_Msa_CF_124970	contig27230___0rc	contig27230___0rc	Unknown	
1943	24	57	unmapped	0		0	TCCCAGGGAGGAAGGAAGAAAAGGATGGAAAGACGTCCACTGCCCTATTTCAACACGGTT	1872	0	UF_Msa_AF_102165	contig27988___1_nrnt	contig27988___1_nrnt	Unknown	
1944	24	58	unmapped	0		0	TCCTGTTTTAAAAGAGTTCTGTTTTTACCGCCTGTGCAGCTTCATTAAAAGCTCGGCTCC	1874	0	UF_Msa_AF_101297	contig08242___1rc_nrnt	contig08242___1rc_nrnt	Unknown	
1945	24	59	unmapped	0		0	CTTCAGGCTTACCTGGAGAAGGGAAGTGCCACTATCGCCGTCTCTGCTGCGGATAAAATA	1876	0	UF_Msa_AF_110062	contig00536___1_nrnt	contig00536___1_nrnt	Unknown	
1946	24	60	unmapped	0		0	TGCCAACCCCGTCTACGGCAGGTACGACCAAGTATAAACTCCCATGGAGAACATCGGCCT	1878	0	UF_Msa_AF_108274	contig29404___1_nrnt	contig29404___1_nrnt	Unknown	
1947	24	61	unmapped	0		0	TCAAACAGGAGGGAATCATGAACCCCAAGGTGGGCCTGGACTACAGGAAGTGCATCCTGC	1880	0	UF_Msa_AF_102639	contig13278___1_nrnt	contig13278___1_nrnt	Unknown	
1948	24	62	unmapped	0		0	CAAGAGACCCAACACCTTCTACTAAAAGCGTTTTTTCACTTTGTGCGGGAAAAAATAAAA	1882	0	UF_Msa_AF_106991	contig11146___1_nrnt	contig11146___1_nrnt	Unknown	
1949	24	63	unmapped	0		0	GAAGCCACGACGTCAGATTTAATCTGAGGGGCGATTTTAATTCATTTAAAAACCACTTTC	1884	0	UF_Msa_CF_125725	contig30443___0	contig30443___0	Unknown	
1950	24	64	unmapped	0		0	TTTCTCAAACCACTGAAGAGGCCAGCACATCAACAACAGTGCTGAAACCAAAGACTGAGA	1886	0	UF_Msa_CF_122385	contig32075___0rc	contig32075___0rc	Unknown	
1951	24	65	unmapped	0		0	GAGGTGAGATTTTAATGTCCAATGCTCTGGAGAAGCTGAGCCGGGCAGCTACAGCTGCCA	1888	0	UF_Msa_CF_120593	contig10579___0	contig10579___0	Unknown	
1952	24	66	unmapped	0		0	AAGGTTCTCGGCACCGATGAGCTCTTCGGCTACCTGCACAATAATCTGATTATTAAAACG	1890	0	UF_Msa_CF_125821	contig18601___0	contig18601___0	Unknown	
1953	24	67	unmapped	0		0	TCAACTGACTCAACCGCTCACTGCCACAGAGCTCCTCAGGGTCTGTCTGCAGCAGGGGGT	1892	0	UF_Msa_AF_100198	contig21985___1_nr0nt1	contig21985___1_nr0nt1	Unknown	
1954	24	68	unmapped	0		0	GAGCCGTCTTCAATGGAATCACCATTCTCATTCTCGCTGACATCCTCCTCTTTGCCGTGC	1894	0	UF_Msa_AF_100346	contig26885___1rc_nrnt	contig26885___1rc_nrnt	Unknown	
1955	24	69	unmapped	0		0	AGAGTCAGTGTTACAAATGGAACATGTAGGAGACAATAAACTATTGCTTCGACCCAGAGA	1896	0	UF_Msa_AF_101301	contig23137___1rc_nrnt-1	contig23137___1rc_nrnt-1	Unknown	
1956	24	70	unmapped	0		0	GGGTGACCAGGGGTCAGATCAAAGTTTAGGAAACCAGCAAACCGCAGTCATCAACCTGGG	1898	0	UF_Msa_AF_101501	contig02346___1_nrnt0	contig02346___1_nrnt0	Unknown	
1957	24	71	unmapped	0		0	CCGAAAGAGCAAGAAAAAGTGGTTCAACCTGGATGATGTTGTAGCTAAAACGAACTATTA	1900	0	UF_Msa_CF_123313	contig13478___0	contig13478___0	Unknown	
1958	24	72	unmapped	0		0	TTTATTCATCAGAACAAATGGCAATGTGCAGTTCCTGCTAAGTGGACACAGCGGGTCTGT	1902	0	UF_Msa_CF_127037	contig11389___0rc	contig11389___0rc	Unknown	
1959	24	73	unmapped	0		0	CACTAAAGAAGATGCATGCTGATAATGAAGCTTTAACAGATGCCATAGCAGATTTCAATG	1904	0	UF_Msa_CF_121690	contig01716___0rc	contig01716___0rc	Unknown	
1960	24	74	unmapped	0		0	AAGAATGGGCCCAGCGGCTCAGACCATCTCCTTACTGCCCTACAGAGGAGGCAATGACAT	1906	0	UF_Msa_AF_103633	contig29172___1_nrnt	contig29172___1_nrnt	Unknown	
1961	24	75	unmapped	0		0	ACAGTTTTAGATAAAATTGAGTAGAGGACCTTTGTCCCTGGACACAATCCCGACCCTTAT	1908	0	UF_Msa_CF_119400	contig15034___0	contig15034___0	Unknown	
1962	24	76	unmapped	0		0	TAGGAAAAGCTTGCAAGTTGACGCACTCATATGGTAAAGACGCTTCATCAAGCGCAGTCT	1910	0	UF_Msa_AF_102710	LMB_S454.sd.21.C1___1rc_nrnt0	LMB_S454.sd.21.C1___1rc_nrnt0	Unknown	
1963	24	77	unmapped	0		0	ATCGACAGCTACAGTGTTGGCTGTAGCGGCCTGTTGAACTTCTGCGCTGTGGCCTTGGCG	1912	0	UF_Msa_AF_104118	contig24592___1_nr0nt1	contig24592___1_nr0nt1	Unknown	
1964	24	78	unmapped	0		0	CATTGGACAGGGAAGAGTTAGGGCGTAATACCTGGTCGTTCCTGCACACTATGGCAGCAT	1914	0	UF_Msa_AF_105021	contig25389___1rc_nrnt0	contig25389___1rc_nrnt0	Unknown	
1965	24	79	unmapped	0		0	TTTCACTCCTCCACCTGGAGTTACAGAGGACGACCTGGATCTGACGCCATCTGTGGGCTT	1916	0	UF_Msa_AF_104339	contig30577___1_nrnt	contig30577___1_nrnt	Unknown	
1966	24	80	unmapped	0		0	TGTTTACATGACTGGAGTCACAGCAGGTCACTTTACTCCTTTGATGAACCCTGCATAAAG	1918	0	UF_Msa_CF_120052	contig07665___0	contig07665___0	Unknown	
1967	24	81	unmapped	0		0	TTGCAACATTTGTTGACATGGTTCCTGGATTCAGGAAACTGGGTGCCCAGTGCTTTTTAG	1920	0	UF_Msa_CF_124166	contig05220___0	contig05220___0	Unknown	
1968	24	82	unmapped	0		0	TGAAATGACTGACTGGCCTACCTACCACTCAACCTACCTAATACCTGTCAACCTACCTAT	1922	0	UF_Msa_CF_126958	contig04038___0rc	contig04038___0rc	Unknown	
1969	25	1	unmapped	0		0	CTGCATCCCTGTAACAGAGATCTCGGGCCATGAGATCCGCTCTACAGTCATCTTCAACCC	1923	0	UF_Msa_AF_103476	contig30805___1_nrnt	contig30805___1_nrnt	Unknown	
1970	25	2	unmapped	0		0	ACTGTTGCGACAGTTCGTCTCCGGTGCACACTTTACCCACAGCAAGCGCACAAGGAGTTG	1925	0	UF_Msa_CF_118967	contig05317___0rc	contig05317___0rc	Unknown	
1971	25	3	unmapped	0		0	TTTCTCATTGCTTTAAGTCTTCATGCTCTGCCACGTCAAGGGAATTCATCCGAGGGTCAA	1927	0	UF_Msa_CF_124240	LMB_S454.sd.270.C2___0rc	LMB_S454.sd.270.C2___0rc	Unknown	
1972	25	4	unmapped	0		0	CACGCTGGCCTGTAAGGTGTGCGGGAAACAATTTGAAAAGGCATCGGATCTGAATACGCC	1929	0	UF_Msa_CF_127501	contig00261___0rc	contig00261___0rc	Unknown	
1973	25	5	unmapped	0		0	TCAATGGATTACCCATTCCTAATCTTCCCATCAACAACATACCCATCAATAGCCTTAACC	1931	0	UF_Msa_CF_122876	contig21691___0rc	contig21691___0rc	Unknown	
1974	25	6	unmapped	0		0	CAAGCACTACGGCATCACCCAAGGAAAAAAGAATGAAAGTTGGAACCATATGAAGAAGAA	1933	0	UF_Msa_CF_120597	contig26316___0	contig26316___0	Unknown	
1975	25	7	unmapped	0		0	TGTGTGTGTTGGTGCGTTTTTGTTTTCGATTTGTGAACCATTAAAACCCCACTGCTGACC	1935	0	UF_Msa_AF_104631	contig01269___1_nr0nt	contig01269___1_nr0nt	Unknown	
1976	25	8	unmapped	0		0	TAAAAACGTAGTGTCTGAACCCATTGAAGGCCACGAGGACTATCACATGATGGCTTTTCA	1937	0	UF_Msa_AF_106450	LMB_S454.325.C1___1rc_nrnt	LMB_S454.325.C1___1rc_nrnt	Unknown	
1977	25	9	unmapped	0		0	TCTCTGCCAGAAATCTGCAGGGAATGCAGGATGAAGACAGATAATTAGACCTCGAGTCAA	1939	0	UF_Msa_CF_126637	contig06584___0rc	contig06584___0rc	Unknown	
1978	25	10	unmapped	0		0	AGACGGAGTTCATGAGAAGCTTCTGATGCTCCTTTCAATTCTTTTGCCTGAATCACAGCC	1941	0	UF_Msa_CF_121120	contig29030___0	contig29030___0	Unknown	
1979	25	11	unmapped	0		0	ACTTTAATTAAAACCATATTGTGACACAGACCAGAACACTACAGAGCACACAACAGAAAA	1943	0	UF_Msa_AF_104648	contig16775___1_nr0nt	contig16775___1_nr0nt	Unknown	
1980	25	12	unmapped	0		0	GGAGAGGAGCTACTGTATATCTCTCATGGTGTACAGATATTCTTTGTCACACCTGAAGGG	1945	0	UF_Msa_AF_107817	contig29692___1rc_nr1nt0	contig29692___1rc_nr1nt0	Unknown	
1981	25	13	unmapped	0		0	ATCGGACAGACCCGCCAGCCCACTATGGCAGACAGACCCAACCTGCCCTACACTGATGCT	1947	0	UF_Msa_AF_108844	contig24722___1_nrnt	contig24722___1_nrnt	Unknown	
1982	25	14	unmapped	0		0	CGGAAATCACTCTCACACTAAAAGTTCCTGTTGCAAAACTTGCGAGACTGAGGGAAAAAA	1949	0	UF_Msa_AF_104900	contig03016___1_nrnt	contig03016___1_nrnt	Unknown	
1983	25	15	unmapped	0		0	TACAACCCGATGACCAACCAGTGGAGCCAGCGAGCTTCCCTCAACATCCCCAGGAACCGG	1950	0	UF_Msa_AF_108157	contig20648___1_nrnt	contig20648___1_nrnt	Unknown	
1984	25	16	unmapped	0		0	GACAGGTCTGGCTATGCGAGACTAGATCATTATTAACACAAACTGTAAAATAAGAAACCA	1952	0	UF_Msa_CF_123909	contig19773___0rc	contig19773___0rc	Unknown	
1985	25	17	unmapped	0		0	TGGTTTCACACTAATGTCCTGGAAGATCCATGCTGACTGCCTCATCCTTAGTGATCTTCT	1954	0	UF_Msa_CF_123436	contig05621___0rc	contig05621___0rc	Unknown	
1986	25	18	unmapped	0		0	TGGGCAACTTCTTTGCCCCGAACACCGTCTCCCTAAAGAAGATCTACGACCGCGAGCAGA	1956	0	UF_Msa_AF_102005	contig17097___1rc_nrnt	contig17097___1rc_nrnt	Unknown	
1987	25	19	unmapped	0		0	TACAGCCTCCCCACCCACCAGCCGCTGCCGCATGGCTTCCCCTCAATCAGCCAACTCACA	1958	0	UF_Msa_AF_106111	contig03752___1_nrnt0	contig03752___1_nrnt0	Unknown	
1988	25	20	unmapped	0		0	GAGGAGAGGGTAGTTTAGGAACATGATAAACGCCTAAAACATTTTAATGTTCAGTATCAA	1960	0	UF_Msa_CF_125331	LMB_S454.sd.134.C1___0	LMB_S454.sd.134.C1___0	Unknown	
1989	25	21	unmapped	0		0	TTTTTGTTTTTGTTATGCAAAACCCATCGTGACCTCTTCCCCCTGTTGGAGGGTTCATGC	1962	0	UF_Msa_AF_104423	LMB_S454.sd.359.C1___1_nrnt	LMB_S454.sd.359.C1___1_nrnt	Unknown	
1990	25	22	unmapped	0		0	TCAAGTAAGTCTGGAGCAGCAGGTACATCCGTTGAAGGACTGTTTATGATTGACACACGA	1964	0	UF_Msa_AF_101649	contig08705___1_nrnt0	contig08705___1_nrnt0	Unknown	
1991	25	23	unmapped	0		0	TAGCCATTCGTTGATAAGAACCAATATCCAGATGTGTGAAGAAACTCCCAAGACAACAAT	1966	0	UF_Msa_AF_102548	contig26124___1_nr0nt1	contig26124___1_nr0nt1	Unknown	
1992	25	24	unmapped	0		0	AAGCTCGGCTGGACAAAGTACTGTCGGACATGAAGCGGCACCGCAAAATTGAGCAGCACA	1968	0	UF_Msa_AF_106514	contig06218___1rc_nrnt	contig06218___1rc_nrnt	Unknown	
1993	25	25	unmapped	0		0	TCAGCTTTACGCTGTCACCAGAGAAGGATCTGTGTACGCCTGGGGCATGGGCACCAACAT	1970	0	UF_Msa_AF_109715	contig13327___1_nr0nt	contig13327___1_nr0nt	Unknown	
1994	25	26	unmapped	0		0	AGCTCTGCTGATTCAGCACTGCTTCTGCACATTGACCCAGATTCCAATTCCAACAATGAT	1972	0	UF_Msa_CF_123004	contig21202___0rc	contig21202___0rc	Unknown	
1995	25	27	unmapped	0		0	TTGAAGCAGCACCTGTAACATCAGCAGGTGGACGCAGTGTAAACAGACAGAGGGGCCTCC	1974	0	UF_Msa_CF_118338	contig16435___0rc	contig16435___0rc	Unknown	
1996	25	28	unmapped	0		0	GGCACTCTGATACTGCCTTTAATCAGTTCAAATGGCTTTATACCTAGTTTTAATGTTTTC	1976	0	UF_Msa_AF_109296	contig14686___1_nrnt	contig14686___1_nrnt	Unknown	
1997	25	29		0		0		1978	1	ETG02_36680	ETG02_36680	ETG02_36680		CONTROL
1998	25	30	unmapped	0		0	TGATGATATGCCACCAAACGTGTGTAAACTGTCTTCAGCTGACCGCGGCTCAGAAGTCAT	1980	0	UF_Msa_CF_122321	contig11312___0rc	contig11312___0rc	Unknown	
1999	25	31	unmapped	0		0	CTGCACTTGTCAAACATGTATATACTTTTATTGTGTGTTGTGAAGTTGGAAACTGTAGCT	1982	0	UF_Msa_CF_119697	contig28778___0	contig28778___0	Unknown	
2000	25	32	unmapped	0		0	CTCTACTGTTAAAGAAAATCTAAACCATGTCTGTCTGGACGTTAGAGTTGTAGAAATACA	1984	0	UF_Msa_AF_104577	LMB_S454.993.C1___1rc_nrnt-1	LMB_S454.993.C1___1rc_nrnt-1	Unknown	
2001	25	33	unmapped	0		0	GAAAAAGAAGGAGGGCAAGAGGAAAGTCACCAGCGAGGCCTCGGGAGACAGAAAGAGAGA	1986	0	UF_Msa_CF_126040	contig09438___0	contig09438___0	Unknown	
2002	25	34	unmapped	0		0	TCGGTGTTCTTCGACGAGAGCGGCACGCTGGTGATGGACCAGTTCGAAAAGGCGGTTTCT	1988	0	UF_Msa_AF_106396	contig23363___1_nrnt	contig23363___1_nrnt	Unknown	
2003	25	35	unmapped	0		0	GAGGAGCTGAGCAACTGGTTTCAGCCTTTTGTCTCCATGATGAGTGGTAACATGTAAAAT	1990	0	UF_Msa_AF_106084	contig28385___1rc_nrnt-1	contig28385___1rc_nrnt-1	Unknown	
2004	25	36	unmapped	0		0	ATTCGCCAGAGGATCTGTGCCACCTTCGACACTGCCAATGCCAAGGGCAAGGACTGACAA	1992	0	UF_Msa_AF_110238	contig21665___1rc_nrnt	contig21665___1rc_nrnt	Unknown	
2005	25	37	unmapped	0		0	TAATGTGGTCCAAAGACGCGTGCCTCTCGAGTTAGCTCTGCTTCCTCTTCCTTTCCGCTC	1994	0	UF_Msa_CF_124107	contig27131___0rc	contig27131___0rc	Unknown	
2006	25	38	unmapped	0		0	CTTCCTGCCTGCTTTAACTGAGGATTATCTGTTTGTGAACTGTTTTATTTTAACATGTTG	1996	0	UF_Msa_AD_200207	LMB_Add_111_rc	LMB_Add_111_rc	Unknown	
2007	25	39	unmapped	0		0	AGTACAAAGAAGAGATGGAAAGGACCTTCAGTTCAAAGTTACAGAATGCCCAGCAGGCTG	1998	0	UF_Msa_AF_105983	contig07478___1rc_nrnt0	contig07478___1rc_nrnt0	Unknown	
2008	25	40	unmapped	0		0	TGCAGGACACAATCACTCTGATTGGCCAGGGCGCACCGGAGCAGAGCGATCCCTTCTTCC	2000	0	UF_Msa_CF_124565	contig19950___0rc	contig19950___0rc	Unknown	
2009	25	41	unmapped	0		0	TTCAAAATCTGCCTACTTGCCTCAAGAGCTGCTGGGAGAGAGGGGGTTTGACTGCATGGA	2002	0	UF_Msa_AF_103687	contig13711___1_nrnt0	contig13711___1_nrnt0	Unknown	
2010	25	42	unmapped	0		0	ATCACTGATAGAGCGAGAGACGGCTGTGAGGGCCCCTCCTCCCATCGCTCATATCAAACA	2004	0	UF_Msa_AF_104502	contig31388___1_nr1nt0	contig31388___1_nr1nt0	Unknown	
2011	25	43	unmapped	0		0	CCTCAGACTGACTTTGTCTACTTTTGCTCCAAACACTTCACCCCAGAAAGTTTTGAACTG	2005	0	UF_Msa_AF_102452	contig17925___1_nrnt0	contig17925___1_nrnt0	Unknown	
2012	25	44	unmapped	0		0	AGGCTGAAGCTTCGGGGTTCCAAGTTTCGCAATGCTGACATACAGCCCACCAACTACTCC	2007	0	UF_Msa_AF_110057	contig15513___1rc_nrnt-1	contig15513___1rc_nrnt-1	Unknown	
2013	25	45	unmapped	0		0	CAAAGAAAACATTACTGCCAAACATTCTCAAGTGCTGACATGCTTGGAAAATTAGAAATC	2009	0	UF_Msa_AF_106558	contig31574___1rc_nrnt	contig31574___1rc_nrnt	Unknown	
2014	25	46	unmapped	0		0	TTACGCTGCAGACCCGAAGCCAACGTGAGCACGTCCATCCAGGTGGACTCCACAGCCAGA	2011	0	UF_Msa_AF_104456	contig08365___1_nrnt	contig08365___1_nrnt	Unknown	
2015	25	47	unmapped	0		0	AATGTCTGGACAGAATTCAAGAGCCGAGCCTTCGCCAGAGGGGGACCTGGGTTCAGCAAA	2013	0	UF_Msa_AF_105142	contig08912___1rc_nrnt0	contig08912___1rc_nrnt0	Unknown	
2016	25	48	unmapped	0		0	ACACAAGAGCCTGGAGGAATCCGTATCATGACTACAGTGGGAGCCCTGCGTCCACACAGA	2015	0	UF_Msa_CF_120883	contig20409___0	contig20409___0	Unknown	
2017	25	49	unmapped	0		0	TCCCTCACACGGGATTTTCATTCTGCTTTCTGTGGTCTCACTGCTCTCTTTACACACACA	2017	0	UF_Msa_AF_104523	contig25823___1_nr0nt	contig25823___1_nr0nt	Unknown	
2018	25	50	unmapped	0		0	TGTGCACGTGGCATGCAGTCCTCCAATCACAGGCTGGGGCAGCTCCTTACGCGACCCCGA	2019	0	UF_Msa_CF_124391	contig07797___0rc	contig07797___0rc	Unknown	
2019	25	51	unmapped	0		0	AGGATGGCTGTGTGTTCAGGGCGCCATGGACCTCTACTACACCAACGGCATGGAGGCCCT	2021	0	UF_Msa_CF_119264	contig00307___0rc	contig00307___0rc	Unknown	
2020	25	52	unmapped	0		0	AAACAGCTCTGGCCTCTGAACTTCCCTGCCGCTAACGATGCTGACCATGATGTACCCCGA	2023	0	UF_Msa_CF_122953	contig23595___0rc	contig23595___0rc	Unknown	
2021	25	53	unmapped	0		0	ATGACAGTCGGCCATCTGATCGAGTGTCTGCAGGGCAAGGTTTCTGCTAACAAAGGTGAG	2025	0	UF_Msa_AF_101432	contig02731___1_nrnt	contig02731___1_nrnt	Unknown	
2022	25	54	unmapped	0		0	CCGTATCCACGTGAACAGTAACTCACATGTATCCAGCTGGTGTCACCGTTTACTCTGTCC	2027	0	UF_Msa_CF_124602	contig04976___0rc	contig04976___0rc	Unknown	
2023	25	55	unmapped	0		0	TGGGAGATGGTCCTCATTATTCATGGCTTTCCCTCTGATATTGCTGCCCTGAGGTTTGAG	2029	0	UF_Msa_AF_109448	contig20941___1rc_nr1nt0	contig20941___1rc_nr1nt0	Unknown	
2024	25	56	unmapped	0		0	GAACTGGATTTGGCTCCACCTTTTTTCTTTGAGGTTTTCTTGACAGATTTCAGAAGGACT	2031	0	UF_Msa_AF_102734	contig03302___1_nr0nt	contig03302___1_nr0nt	Unknown	
2025	25	57	unmapped	0		0	TTGGTCTGATATGACTGCTCCCTTCTCAGCCAGCAACACCAGTCTGAACTACCTGCGGGG	2033	0	UF_Msa_CF_124051	contig30073___0rc	contig30073___0rc	Unknown	
2026	25	58	unmapped	0		0	AATGAGGAAGATTTTTCAGCAAGAAAACCCGATGCCTGCTCTTCGCAAACGATCCAAGTT	2035	0	UF_Msa_AF_108081	contig22292___1rc_nrnt-1	contig22292___1rc_nrnt-1	Unknown	
2027	25	59	unmapped	0		0	TGAGGTTTCCTCCTAAAGCTTACAACAAGGACCTGGAGTCAGCAGAGGAGCGTCGGGAGC	2037	0	UF_Msa_AF_108438	LMB_S454.741.C1___1rc_nrnt	LMB_S454.741.C1___1rc_nrnt	Unknown	
2028	25	60	unmapped	0		0	AAATTCTGCACTGACAACGGAGTGATGATTGCATGGAATGGTGTAGAACGCCTGAGAGAA	2039	0	UF_Msa_AF_104334	contig32868___1_nrnt	contig32868___1_nrnt	Unknown	
2029	25	61	unmapped	0		0	ATATCAACGATGAAGTGGAATCCAACAATTCCTTGAAGTACGTCCCTGGAAAGGCGCGAT	2041	0	UF_Msa_AF_102301	contig31197___1_nr0nt	contig31197___1_nr0nt	Unknown	
2030	25	62	unmapped	0		0	ACGGGTGAGGTTTGAGGAAGAGCGTGATGAGATTTTGCAGAGACTGACAGAAGAGTGGCA	2043	0	UF_Msa_CF_126333	contig23646___0	contig23646___0	Unknown	
2031	25	63	unmapped	0		0	TTCTCTTGGAGACAGGCCGCATATGTGGACTCATTTTGTTGGGCAGCAGTACAGCAACAA	2045	0	UF_Msa_AF_109919	contig23062___1rc_nrnt0	contig23062___1rc_nrnt0	Unknown	
2032	25	64	unmapped	0		0	GTGGACAGCGAGGGAAACTTTGCTTGTCATGTATTTCTGGTCTAAGTCCTTTGATTTGCG	2047	0	UF_Msa_AF_110016	contig24247___1_nr0nt	contig24247___1_nr0nt	Unknown	
2033	25	65	unmapped	0		0	ATCTACTCTCTTCCAAACCCATGACAGTAAAGAGCACCTTGCTATGATGGAGAGAGTCCT	2049	0	UF_Msa_AF_105104	contig22839___1rc_nrnt	contig22839___1rc_nrnt	Unknown	
2034	25	66	unmapped	0		0	TTGTGTATAACCCTGGTAAACCCTGGGGTCCAGGATCACCTTCGTCTCCTCTGGGTCCTG	2051	0	UF_Msa_CF_127482	contig24401___0rc	contig24401___0rc	Unknown	
2035	25	67	unmapped	0		0	GGCAGCAGCTGGACATGCCGACAAATAAATAAATAATCAATAAAGTGAGGTCGAACAAAA	2053	0	UF_Msa_CF_118007	contig19973___0	contig19973___0	Unknown	
2036	25	68	unmapped	0		0	ATAAAGAACCTACCAGAGCAGAAAGAGCTGAATGCGCTGGCGGAACTAAAGGGTGAATAT	2055	0	UF_Msa_AF_109993	contig20160___1rc_nrnt0	contig20160___1rc_nrnt0	Unknown	
2037	25	69	unmapped	0		0	GATGGTTGCATTCCTTATTCTGTTTGCCATGTAAACCAGTTAAGCATTTGCTCTAAAGTG	2057	0	UF_Msa_AF_106429	contig32848___1_nr0nt1	contig32848___1_nr0nt1	Unknown	
2038	25	70	unmapped	0		0	TCTTCCAGTCTTCCTGTCAGCGCTGTGGTCATTACCTGCAGGATGGACTTCCCCCAACGT	2059	0	UF_Msa_AF_102904	contig29354___1_nrnt	contig29354___1_nrnt	Unknown	
2039	25	71	unmapped	0		0	TTCAGCCCAAACCTGGTTTCTGCAACAAAGACTTTATCAACTTTGCTGCAGACCACTTCG	2061	0	UF_Msa_CF_119917	contig18351___0	contig18351___0	Unknown	
2040	25	72	unmapped	0		0	GGAGGCTGCACGCCTGGCATCTATGCCGGCCTGGAGGAGAGACATGTTAAAGAAGAAAAT	2062	0	UF_Msa_CF_126927	contig01186___0rc	contig01186___0rc	Unknown	
2041	25	73	unmapped	0		0	TCTTCAAGCTCTTCAGCCAGGAGGTGATGATGAAGTTCGTCCCTCGGTACAGCCTGGTGG	2064	0	UF_Msa_AF_102794	contig03655___1_nrnt0	contig03655___1_nrnt0	Unknown	
2042	25	74	unmapped	0		0	TGAAAAGCTGCAAGCTAAACGGCTGCCTTTATGGGAAAAGAAATTTGGCCAAGTCCCAAC	2066	0	UF_Msa_AF_109950	contig22831___1rc_nr1nt0	contig22831___1rc_nr1nt0	Unknown	
2043	25	75	unmapped	0		0	GGCATTGTTGAACAACAGCTGACAGAGATGAAAATGCTGGTGATTTGTCCATGGCACATA	2068	0	UF_Msa_CF_119261	contig13571___0	contig13571___0	Unknown	
2044	25	76	unmapped	0		0	CAAAAGGGAAATACTTGTATTACAATGTTGAAATGTTTGTCTACTCGGTGAAATGACTGG	2070	0	UF_Msa_AF_109135	LMB_S454.sd.137.C1___1_nrnt	LMB_S454.sd.137.C1___1_nrnt	Unknown	
2045	25	77	unmapped	0		0	CAGCTTTCCTGGATTTGTTGAGGCGCATGGATAAAGTGGAATAATTTTTTCTTTTATAAG	2072	0	UF_Msa_AF_100214	contig00847___1_nr1nt0	contig00847___1_nr1nt0	Unknown	
2046	25	78	unmapped	0		0	ACAGATGATGCAGCAGATGGAGCTGGAGAAAAGCTTGCTGTCGGACCACGAGCTGCGACT	2074	0	UF_Msa_AF_100917	contig30038___1_nr0nt1	contig30038___1_nr0nt1	Unknown	
2047	25	79	unmapped	0		0	TCACACCTGATGCTTTGTTTTCTGCTTTGCTGCGTCTCACAGGGCCTAAAGTACGATTTC	2076	0	UF_Msa_CF_121595	contig12783___0rc	contig12783___0rc	Unknown	
2048	25	80	unmapped	0		0	CCAACTTTTCCTCTTGTTAAGTAGTTCCCACTACTGATGTTACTGATGTTGTTAATGATA	2078	0	UF_Msa_AF_105159	contig28606___1rc_nrnt-1	contig28606___1rc_nrnt-1	Unknown	
2049	25	81	unmapped	0		0	TTTCATTTAGAAACTTGAAGCTTTGTGTTTTTTCCTTCACGTCGATGACACTCTGCAAAG	2080	0	UF_Msa_CF_126594	contig16045___0rc	contig16045___0rc	Unknown	
2050	25	82	unmapped	0		0	TAAAAAAGAAAGTAGACGAGACAGATGATGACCAGCAGAGCGACTGATAGCAGCATGTTC	2082	0	UF_Msa_CF_123762	contig28099___0rc	contig28099___0rc	Unknown	
2051	26	1	unmapped	0		0	AGTGAGACTTCTCACCCATTTAAAGTTTGAGAATAGGTTGAAGGCGTTTCGCCCCCAATG	1924	0	UF_Msa_AF_105749	LMB_S454.sd.338.C1___1rc_nrnt-1	LMB_S454.sd.338.C1___1rc_nrnt-1	Unknown	
2052	26	2	unmapped	0		0	GCTTCAGACCGAATATGGCCCGCCAGCAGAGAAGAAGAAAGCACCAATCACTGTTCTCGG	1926	0	UF_Msa_AF_105572	contig22763___1rc_nrnt0	contig22763___1rc_nrnt0	Unknown	
2053	26	3	unmapped	0		0	GGCAGGAAGGTTTGGAAAGTTCACAAAGACTTTGGCATAAATTAAATAAATCTTCGCAAT	1928	0	UF_Msa_AD_200287	LMB_Add_111	LMB_Add_111	Unknown	
2054	26	4	unmapped	0		0	ACGGCGAGTAGAAACAAGAAAGTGGAGGCTGCTCCTGCCCGGCCCATTGTTGACGCTTGC	1930	0	UF_Msa_CF_119877	contig09204___0rc	contig09204___0rc	Unknown	
2055	26	5	unmapped	0		0	TTCATTGGCGAGGTAGACGAGGTTGGGAGGCTATTGGTGGAAACTGCCAGACGTTGCCGA	1932	0	UF_Msa_AF_101722	contig05247___1_nrnt0	contig05247___1_nrnt0	Unknown	
2056	26	6	unmapped	0		0	CAGCGAATCTATGTCAAGTTCCTGGAGAGTGTCAACAAGGGAAGGACTATGTTAGAGTCT	1934	0	UF_Msa_CF_122323	contig23050___0	contig23050___0	Unknown	
2057	26	7	unmapped	0		0	ATGTTCAGTGCAAATGGCATTAATGGAGACATGAATGTCACACTGTGGCCGCTGCAGAAT	1936	0	UF_Msa_AF_108112	LMB_S454.sd.433.C1___1_nrnt	LMB_S454.sd.433.C1___1_nrnt	Unknown	
2058	26	8	unmapped	0		0	TGGTAATGGTGAAGAAGCGGTGGCAACTATTGTCTCCAATAAAAGTGCAAAGAGTAACAC	1938	0	UF_Msa_AF_103438	contig32719___1_nr1nt0	contig32719___1_nr1nt0	Unknown	
2059	26	9	unmapped	0		0	AACCTGAGCTGAGCAAAGAACAGAGTCTGAAAAGAGAGAAGCTACGGAAAATGCTGCACA	1940	0	UF_Msa_CF_121615	contig01042___0rc	contig01042___0rc	Unknown	
2060	26	10	unmapped	0		0	TTTATCTTTGTTTCCGGGTTCTCCTCTCTGCAAGATAGGAGCTCCAGGATTTGGGTTGTT	1942	0	UF_Msa_AF_107895	contig03425___1_nr0nt	contig03425___1_nr0nt	Unknown	
2061	26	11	unmapped	0		0	AGACTGACAAACTAGAGAAGCTCATGATCAGAATAGGCATCTTCACGGTGCCTCTACTAC	1944	0	UF_Msa_AF_100642	contig18894___1_nr0nt1	contig18894___1_nr0nt1	Unknown	
2062	26	12	unmapped	0		0	AAGGCCAAGCTTGAGATAGACGGTGGACTGGAGAAAGAGTCAAGTGATTTAGGTGATGAT	1946	0	UF_Msa_CF_124942	contig19614___0rc	contig19614___0rc	Unknown	
2063	26	13	unmapped	0		0	GCCCAACGCAACAGCCTGGAACTGGGTTTTAAGGACTCTGACATGGACTACATCCAAACC	1948	0	UF_Msa_AF_102750	contig06905___1rc_nrnt0	contig06905___1rc_nrnt0	Unknown	
2064	26	14		1028	E1A	0		1348	1	(+)E1A_r60_a20	E1A_r60_a20	E1A_r60_a20		CONTROL
2065	26	15	unmapped	0		0	TTTACTGTGACGGACCAACATGGCCGCACTGAGGAGGCTAACAACCTGCCTCAGCCTCAT	1951	0	UF_Msa_CF_119940	contig32773___0	contig32773___0	Unknown	
2066	26	16	unmapped	0		0	TTCACCACTAAGCTTATGTGCAGAGGAAGTTCCTTGTGAGACTTTAAATGACATTGTGCA	1953	0	UF_Msa_CF_126271	contig04378___0	contig04378___0	Unknown	
2067	26	17	unmapped	0		0	GGGTGATGCTTAACATCAACCATCCTTTTGTTCTTACAAACCAAATACCGCCGCCACAGT	1955	0	UF_Msa_CF_127458	contig20096___0rc	contig20096___0rc	Unknown	
2068	26	18	unmapped	0		0	ATCCTAAAGCGCGTTCCGAAACTATCATCTTCCCTGGTCAGTGCCTGGATTGATTGATGA	1957	0	UF_Msa_CF_121726	contig17185___0	contig17185___0	Unknown	
2069	26	19	unmapped	0		0	ATTGAGGAGACACTTGAAAATGAGCAGCAGCAACATGACAAGGAGCAGCTCAAGCCAAAA	1959	0	UF_Msa_AF_106345	LMB_S454.989.C1___1_nrnt	LMB_S454.989.C1___1_nrnt	Unknown	
2070	26	20	unmapped	0		0	ACTCGTCGGTGCCTGCTTCCCCTTAACCTCCATTGCCCTCTGTCCTTGTCTGGGCTGCTA	1961	0	UF_Msa_CF_120491	contig28076___0	contig28076___0	Unknown	
2071	26	21	unmapped	0		0	TGTAAGAGTGCTCCAGCTGTGGTTGCTCTTGCAGTTCGTCTGGTTTCTGACAACATCAAG	1963	0	UF_Msa_CF_118970	contig17012___0rc	contig17012___0rc	Unknown	
2072	26	22	unmapped	0		0	ATTTCTGAAGCATGTCAAGTTTCTCTTTCAACGTTGCATCCTTCCATGTCCTCACTTCTC	1965	0	UF_Msa_AF_104755	contig15789___1_nr0nt1	contig15789___1_nr0nt1	Unknown	
2073	26	23	unmapped	0		0	AACTCCTCCCTCAGCTCGCTGAGCGACATCGACCAGGAGAACAACAACAAGGAGTTCGCT	1967	0	UF_Msa_AF_103112	contig30526___1_nr1nt0	contig30526___1_nr1nt0	Unknown	
2074	26	24	unmapped	0		0	TCATTTAATGGCGCACAGAAGATCAAAAGAAAAAGGAATGTGCTGCCAGAGGGGAGGACT	1969	0	UF_Msa_CF_124050	contig24246___0rc	contig24246___0rc	Unknown	
2075	26	25	unmapped	0		0	TACATGATAATGTTCTCGACAGGTGTGCTGGCAGGTCTCTATGTTTTTGAAGGCTTCCCA	1971	0	UF_Msa_AF_105940	contig29656___1_nrnt	contig29656___1_nrnt	Unknown	
2076	26	26	unmapped	0		0	ATGACAAGTTCACCAAAGAGGTGGAAAGAACAGCTGATATGGAACACCTCGGCATTATGG	1973	0	UF_Msa_CF_123778	contig03179___0	contig03179___0	Unknown	
2077	26	27	unmapped	0		0	ACTGACATTCATTACTGGAGAGGAATACAACTCGAGTGACACCATGAATAAGCTGCTAGT	1975	0	UF_Msa_AF_101776	contig06505___1_nr0nt	contig06505___1_nr0nt	Unknown	
2078	26	28	unmapped	0		0	CAGGGTAATGTGTGTGATGACACAGCCAAATATGAAAGATGTCAGAAAAGCAGAGAGATG	1977	0	UF_Msa_CF_119716	contig19705___0	contig19705___0	Unknown	
2079	26	29	unmapped	0		0	CGACCATGCCTGGACTTCTGCTGGGAGACGAGGTCCCCAACTTCGAGGCCGACACCACCA	1979	0	UF_Msa_AF_105186	contig21858___1_nr0nt	contig21858___1_nr0nt	Unknown	
2080	26	30	unmapped	0		0	GTGTTTGACCGCAGGATCTTCATGAAGAAACTCTGCGGTGACGGTGAAAGTGAAGGAGCA	1981	0	UF_Msa_AF_105804	contig07554___1rc_nrnt-1	contig07554___1rc_nrnt-1	Unknown	
2081	26	31	unmapped	0		0	TAACGTTACTAAGCAGGAGACAGAACAACTGCAAGCTTAAAACCCCACAAGCTTCTGCTC	1983	0	UF_Msa_CF_125430	contig10669___0rc	contig10669___0rc	Unknown	
2082	26	32	unmapped	0		0	TCAGCCTGGGTCCAAAACCTGTGGGATCTGGGAGCAGCATTATTGTCAGTCCTCGACAGA	1985	0	UF_Msa_CF_124137	contig17999___0	contig17999___0	Unknown	
2083	26	33	unmapped	0		0	TCTCTGGTTGATTACCCCCACCAGGCCCGCATTGTGGAGGCCCTCATAGTCTTCTATTCA	1987	0	UF_Msa_AF_106835	contig00575___1rc_nrnt	contig00575___1rc_nrnt	Unknown	
2084	26	34	unmapped	0		0	CTGCTGCAGCACTCACAGTGCAGCTGTGCAGCTTCTGAGATAATTTGGTTGAAACTGTTT	1989	0	UF_Msa_CF_126362	contig29390___0rc	contig29390___0rc	Unknown	
2085	26	35	unmapped	0		0	CCAGCTCATGAGTCCCCTCTGGGCGACAGGGCGAATCTGAAATCTCTGTTTGCTCTGTCA	1991	0	UF_Msa_CF_125972	contig16168___0rc	contig16168___0rc	Unknown	
2086	26	36	unmapped	0		0	AGGCAGTGGGGTAAACGGAGGGAGTATGTGGGAGATGCGGAAAGAGGAAGAGCTATGTTT	1993	0	UF_Msa_CF_125829	contig32845___0	contig32845___0	Unknown	
2087	26	37	unmapped	0		0	TAAAATGATAAAACTACCTCGTCTATTAGGGTGAACGTCCCGAAGACCCGCAGGACATAC	1995	0	UF_Msa_AF_105920	contig25378___1_nr0nt1	contig25378___1_nr0nt1	Unknown	
2088	26	38	unmapped	0		0	ACCGCTGCTGCCGACAGAAAGAGAGGAAAGAAAGTTTATTTTTCAGCTGAGAACTTCTCC	1997	0	UF_Msa_CF_120880	contig30139___0	contig30139___0	Unknown	
2089	26	39	unmapped	0		0	CATCAGATGCTTACAATCTGTGTCAACTCCAAAATAGTACTGCACAGTATGGACCTTGCC	1999	0	UF_Msa_CF_117754	contig04388___0rc	contig04388___0rc	Unknown	
2090	26	40	unmapped	0		0	GAGCTCAGACTGAAGTACACCGCCAAGCAAAGGAACAAACCAATGGACGAGCCAACCAGC	2001	0	UF_Msa_CF_125459	contig16087___0rc	contig16087___0rc	Unknown	
2091	26	41	unmapped	0		0	TTTTGGATCTGGATTGAAATAAAACCAAACAAAAATGCCGAAGGTCAAGGCGGAGAAGAA	2003	0	UF_Msa_AF_106446	contig00165___1rc_nrnt0	contig00165___1rc_nrnt0	Unknown	
2092	26	42		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
2093	26	43	unmapped	0		0	TAACACTTTGTAACACTCATATTCTGCTTAATGGAGGACAAATAAAACCCTTGACTTCTG	2006	0	UF_Msa_CF_122908	contig30236___0rc	contig30236___0rc	Unknown	
2094	26	44	unmapped	0		0	GCAGTTGTTTTTGTACAGATACTCTGGTTATGCTCATGTTTGACAATAAAAGATCTGTGA	2008	0	UF_Msa_AF_103541	contig11427___1_nr0nt1	contig11427___1_nr0nt1	Unknown	
2095	26	45	unmapped	0		0	TATCGGGATATAGTAAACAGACTTTCATAATGACCCTCGGAAGAGAAAGCATACATTGTG	2010	0	UF_Msa_CF_123628	contig24061___0rc	contig24061___0rc	Unknown	
2096	26	46	unmapped	0		0	GACGGCTGTATTTATAAAATTGGCATTTATTGGTGGGTGGACAAAATAAACTAACTTGAC	2012	0	UF_Msa_AF_106669	contig10338___1_nr0nt	contig10338___1_nr0nt	Unknown	
2097	26	47	unmapped	0		0	AGACAGTGTGCTATTTAAATAGCATAAGAAACGTGTTTGTGTAATGTGTTAGATGGGAGT	2014	0	UF_Msa_AD_200012	LMB_Add_159	LMB_Add_159	Unknown	
2098	26	48	unmapped	0		0	AGAGGCAGCATGACTGCACCAATCCTGTCACTGAGGACAGGCAAAGCTCCAGACAAGCCT	2016	0	UF_Msa_CF_123862	contig25735___0rc	contig25735___0rc	Unknown	
2099	26	49	unmapped	0		0	TATGAGGCAGATTAGTCAGCGGATGGGACAGAAAGTCTATGTACAACAGACATGCAGACA	2018	0	UF_Msa_CF_126400	contig01233___0	contig01233___0	Unknown	
2100	26	50	unmapped	0		0	TGGCCCCAGACCGGTTAACTTTTAAACTAAAATCCCTTCAACCGGAGTTGAATTCACCTC	2020	0	UF_Msa_CF_118449	contig26852___0rc	contig26852___0rc	Unknown	
2101	26	51	unmapped	0		0	AAAGGCCATGTATGGCTAGAAGGGGATAACCTTAGGAATTCCACTGACTCAAGGAGCTAT	2022	0	UF_Msa_AF_107003	contig29852___1_nr1nt0	contig29852___1_nr1nt0	Unknown	
2102	26	52	unmapped	0		0	AAGATTATTTAGCCAAGGAGAATGAGTTTGACAGACTAGTGATGCAGTACGCTCCCACCG	2024	0	UF_Msa_AF_107973	contig22896___1_nrnt0	contig22896___1_nrnt0	Unknown	
2103	26	53	unmapped	0		0	AAGACCTTCAGCGCCACCTTGAGTCTGAACCTGGTCAAGACAGGCCTGGAGTTTCCTTTT	2026	0	UF_Msa_CF_123281	contig24605___0rc	contig24605___0rc	Unknown	
2104	26	54	unmapped	0		0	AAACCTCCCCAGCACTGCTGCTTCCTGTCTGATCTACTGCTGCAGGACGTACACTGACAG	2028	0	UF_Msa_CF_119389	contig14392___0	contig14392___0	Unknown	
2105	26	55	unmapped	0		0	AAACAATGTTCTTTCTCAGTGTGCACTCCTCACAGCCCATGTTTGATAAGTCCATGCTGG	2030	0	UF_Msa_AD_200173	LMB_Add_8_rc	LMB_Add_8_rc	Unknown	
2106	26	56	unmapped	0		0	GCGGGCCGGGGCATCTCTGGGATGGATGTTCTGGAGAGCATTGTTTCAGTTGCAAGAGGG	2032	0	UF_Msa_CF_122863	contig11593___0rc	contig11593___0rc	Unknown	
2107	26	57	unmapped	0		0	GACTTTCTTACAAACCCTCAAAACGCTCCAGAGCCAGGATTCATTTGAGCAATCATCTAA	2034	0	UF_Msa_CF_123564	contig13175___0rc	contig13175___0rc	Unknown	
2108	26	58	unmapped	0		0	CAGGTAGGAGCGTTGGTGGGACGACTGACGCCGAGGAGGCGTCCAGACTGCTGGCAGAGA	2036	0	UF_Msa_AF_108178	contig13909___1_nr0nt	contig13909___1_nr0nt	Unknown	
2109	26	59	unmapped	0		0	TTTCCATCTGAGATGGCAAACCACCATGTTCGACCGGCTGTTTGCGTACTGCGCCCGCAT	2038	0	UF_Msa_AF_100829	contig07488___1rc_nr1nt0	contig07488___1rc_nr1nt0	Unknown	
2110	26	60	unmapped	0		0	TACAGATAAGATAGGTGGCCATCACCTTGCTGTCCTGACCACAGATCTTATTCACTGTCA	2040	0	UF_Msa_CF_125034	contig29739___0rc	contig29739___0rc	Unknown	
2111	26	61	unmapped	0		0	ATAGCGGCAAGCAAAGCGTGACTAATCGGTCTGTTAATACAATACAATGGAGCAGTGGCA	2042	0	UF_Msa_AD_200260	LMB_Add_87_rc	LMB_Add_87_rc	Unknown	
2112	26	62	unmapped	0		0	GGATCACCCAGAGGCTAAAGGAGACTCAGAACACCTGCGCTATGTTGACCACCTTCAACG	2044	0	UF_Msa_AF_104967	contig24262___1_nr0nt1	contig24262___1_nr0nt1	Unknown	
2113	26	63	unmapped	0		0	AAATGGAATAACAGGAGCTCATAACAACTGAGAGCGGTTCATCCACAGTTCAGACTTCCG	2046	0	UF_Msa_CF_122967	contig05807___0rc	contig05807___0rc	Unknown	
2114	26	64	unmapped	0		0	ATGTACGTCCTGGCTAACGAGCCGTCAGTGGCTACTCTACAGACTGCAGGAACACGTCAG	2048	0	UF_Msa_AF_110185	contig28661___1rc_nrnt-1	contig28661___1rc_nrnt-1	Unknown	
2115	26	65	unmapped	0		0	ATTGTAGGGGTGTTTCTCGGCGTCGCCATAGGCTATGCTTTGTGAATGTGTTTATATGCT	2050	0	UF_Msa_AF_105612	LMB_Sanger.20.C2___1_nr0nt	LMB_Sanger.20.C2___1_nr0nt	Unknown	
2116	26	66	unmapped	0		0	TGGGCTCTGCTAAACAGCATCCAGCTGGACACCAAGATGTCTGCCAAGGAGAGAAAGCGC	2052	0	UF_Msa_CF_122349	contig25237___0	contig25237___0	Unknown	
2117	26	67	unmapped	0		0	TCTGCTGGGCATCACCAAGGAGTGTGTGATGAGAGTGGACGAGAAGACCAAGGAGGTGAT	2054	0	UF_Msa_AF_104831	contig21467___1_nrnt	contig21467___1_nrnt	Unknown	
2118	26	68	unmapped	0		0	CCACAACAAGGGGCAACAGCAAGGAGCAGAAGATTGGTCACTGTTGTGATGAGGAGAATA	2056	0	UF_Msa_CF_123284	contig19351___0	contig19351___0	Unknown	
2119	26	69	unmapped	0		0	CACACACGTGGATTTCCACTGACGCCAGACAGAAACAACAATAACATGGCAAGCCATGGG	2058	0	UF_Msa_CF_117880	LMB_S454.95.C1___0	LMB_S454.95.C1___0	Unknown	
2120	26	70	unmapped	0		0	AGTGTGTATCTGCAGCACCTGGATAATTTAATGGAGAAATACAAGACTTACAAGAGCAGT	2060	0	UF_Msa_AD_200239	LMB_Add_97_rc	LMB_Add_97_rc	Unknown	
2121	26	71		1028	E1A	0		643	1	(+)E1A_r60_a22	E1A_r60_a22	E1A_r60_a22		CONTROL
2122	26	72	unmapped	0		0	ATTGTTTCCTTGACGACAGGGTCAGGGGGCAGCCAAAACGCCATTGCTGTGCAAGGACTC	2063	0	UF_Msa_AF_100153	contig06117___1_nr1nt0	contig06117___1_nr1nt0	Unknown	
2123	26	73	unmapped	0		0	TCTATGTCACTGGAGGAGCTTTGTCAAGTCTAGAGAAAATCCCTGGTTATGTCATAGTGA	2065	0	UF_Msa_CF_118397	contig23505___0	contig23505___0	Unknown	
2124	26	74	unmapped	0		0	CGTCTCGGCACTACAGACAAGCTGCGGGACATGATCTCAGCCATGATTAAGAAGGTCATC	2067	0	UF_Msa_AF_109875	contig21051___1_nrnt0	contig21051___1_nrnt0	Unknown	
2125	26	75	unmapped	0		0	CGGAAAGAGTCTTTACAGAAAGCAGTTGAAAAAGCGAAAGTGGGCCGTGAAGATACAAAG	2069	0	UF_Msa_AF_101799	contig14689___1rc_nrnt-1	contig14689___1rc_nrnt-1	Unknown	
2126	26	76	unmapped	0		0	TCTGACGGGAAGATGAGCTCCAAGAGCGAAGACACAGAGTTGAGCCTGCATGCCCAGCTA	2071	0	UF_Msa_CF_118570	contig26838___0rc	contig26838___0rc	Unknown	
2127	26	77	unmapped	0		0	AAGGTGGTACCTCGGGAACTGGCAGAGGCCACAGGAGTAGTCATGTCCTTCTTCCTCACT	2073	0	UF_Msa_AF_100045	contig26259___1rc_nr1nt0	contig26259___1rc_nr1nt0	Unknown	
2128	26	78	unmapped	0		0	TATCTTTTTCCAGAGCAAAAGAATCACACATAAATGCCCCACACTCAACCACACAAGAAT	2075	0	UF_Msa_AD_200152	LMB_Add_116_rc	LMB_Add_116_rc	Unknown	
2129	26	79	unmapped	0		0	AAGAGAATGTTTCCCCTGCTGCAGAGTTCAAAGAGAGAGTTTTTTGTTGCTCAGGAGAGC	2077	0	UF_Msa_CF_125157	contig07269___0	contig07269___0	Unknown	
2130	26	80	unmapped	0		0	AGCCGGTGGTCAGCCAGGAGTATGTTGATAACGGCCATGTGATCATGGCCTCCAGTGTAG	2079	0	UF_Msa_CF_120138	contig03250___0	contig03250___0	Unknown	
2131	26	81	unmapped	0		0	GCTCGGCGTCTCTCCGCCTGCATTTAACCCAGAGCCTAAAGGAAAACGAATCTCTGAGGA	2081	0	UF_Msa_CF_121711	contig23523___0	contig23523___0	Unknown	
2132	26	82	unmapped	0		0	TGTCGGGATGAACATCGCCGTGCAGCCACCTACAAGTCATGTCAAACGTGACTCTCACTC	2083	0	UF_Msa_CF_126746	contig20271___0rc	contig20271___0rc	Unknown	
2133	27	1	unmapped	0		0	AGGACGTGGAAAAGAAGAAGTGAAAATAATCACTATGGAACTTTGCGACATACAGTGTCT	2084	0	UF_Msa_AF_100656	LMB_S454.sd.92.C1___1rc_nrnt	LMB_S454.sd.92.C1___1rc_nrnt	Unknown	
2134	27	2	unmapped	0		0	AGTGCAACAAATCTAGAGCCAGCAAAATGGTCGAATGGACAGACTTCGAGCGCGCCACCA	2086	0	UF_Msa_AF_105895	LMB_S454.48.C1___1_nr0nt	LMB_S454.48.C1___1_nr0nt	Unknown	
2135	27	3	unmapped	0		0	AAGACTTCCTGTTTCAAGCTGCTGTCCCAAAGACCATGTTAATGAAACTTCAGCCTGCGT	2088	0	UF_Msa_CF_123148	contig03707___0rc	contig03707___0rc	Unknown	
2136	27	4	unmapped	0		0	CCAAACAGCATGGCGAACCTCGAGCATGCTGAGGACAACCCAAAACATGTGAAAATGTCG	2090	0	UF_Msa_CF_127264	contig24267___0	contig24267___0	Unknown	
2137	27	5	unmapped	0		0	GCACGTCATATCTGAAGGACGAGGGAAACATGTGTGATTGGGTCACAGGAGTTGTGGTTG	2092	0	UF_Msa_AF_109237	contig11910___1_nrnt	contig11910___1_nrnt	Unknown	
2138	27	6	unmapped	0		0	TATATACGGCGAGAGAAGAAACAAAAGTGGAAAACCCGTCAAGTGTGCTGAGTCTTTGGC	2094	0	UF_Msa_AF_100724	contig29671___1_nrnt	contig29671___1_nrnt	Unknown	
2139	27	7	unmapped	0		0	AGATGGCGACCGTGGCGCTGGTTAGCCGCCCTGCGAGTGTCCTTCCAAAAATTTCAAGTA	2096	0	UF_Msa_AF_109475	LMB_S454.45.C1___1_nr0nt1	LMB_S454.45.C1___1_nr0nt1	Unknown	
2140	27	8	unmapped	0		0	CCTTCAAAACGCAGGTGTCCCAGGAATCTGAAGGTCCAGTTGATTATGAACCAGCTGATA	2098	0	UF_Msa_CF_119629	contig08743___0rc	contig08743___0rc	Unknown	
2141	27	9	unmapped	0		0	AGAGGTAACACTGCAGCACGATGCCATGGTTAACAGCAGTTAGACCAGGACAGTCCCCCC	2100	0	UF_Msa_CF_119210	contig19261___0rc	contig19261___0rc	Unknown	
2142	27	10	unmapped	0		0	TCTGAGACACCAAAAGCCAAGAAGAAGACCCCTCAAAACCGACCGCTGCAGCGCTTCTGG	2102	0	UF_Msa_AF_105323	contig31840___1_nrnt	contig31840___1_nrnt	Unknown	
2143	27	11	unmapped	0		0	GTGGTTACCAAAACAACACGTCCACCAGCCCGGACTAGTCGTTCTTCCACTGACCAACTT	2104	0	UF_Msa_AF_101674	contig25506___1rc_nrnt0	contig25506___1rc_nrnt0	Unknown	
2144	27	12	unmapped	0		0	TCTTTGAAGTCCTCATCCTCAATCCGACTCGGCATCAGGAAGGTAGGTAAAGTACTTGAT	2106	0	UF_Msa_CF_120500	contig17648___0rc	contig17648___0rc	Unknown	
2145	27	13	unmapped	0		0	AGAGAGCGTTCGGTCTGCAGTGGAGACACAAGCAGGATCTGTCCCTGTTTGCTTTATCAG	2108	0	UF_Msa_CF_127377	contig06085___0	contig06085___0	Unknown	
2146	27	14	unmapped	0		0	CAGCTACGGGGTTGCAGACTCGTTCCCCAAAGATTTCGGTTATGGTGAAGAGGAGGCCGA	2110	0	UF_Msa_AF_101848	contig23217___1rc_nrnt	contig23217___1rc_nrnt	Unknown	
2147	27	15	unmapped	0		0	AGAAAACCCTGGGCAGAGACCATCCCGCTGTTGCTGCAACACTGAATAACTTGGCCGTGC	2112	0	UF_Msa_AF_100479	contig04909___1rc_nrnt	contig04909___1rc_nrnt	Unknown	
2148	27	16	unmapped	0		0	GACGAATCAAACGTTCGGCTCAGGAAGGGTGTAGAGTACAAGAAGAAGAATCCTTTTCAG	2114	0	UF_Msa_AF_101602	LMB_S454.653.C1___1_nrnt0	LMB_S454.653.C1___1_nrnt0	Unknown	
2149	27	17	unmapped	0		0	ACTTAACATGCCATTAACTTTTGAAACATAGCCTCATGAGCTGTGGCAGACAGAGGCTCC	2116	0	UF_Msa_AD_200073	LMB_Add_135	LMB_Add_135	Unknown	
2150	27	18	unmapped	0		0	CCCACTCTATTTTTGAACAGGGGCCCGCGGAGATGATGATGAAAAAGAGAGGGGGCTATG	2118	0	UF_Msa_AF_102884	contig05941___1_nrnt	contig05941___1_nrnt	Unknown	
2151	27	19	unmapped	0		0	GTTCTGCGAGAACATGGATGACCTGCTGAGGGACTCAGACTTTGTCATGCTGGCGGTCAA	2120	0	UF_Msa_CF_123903	contig15698___0	contig15698___0	Unknown	
2152	27	20	unmapped	0		0	CTAAGCAAGGTTGACTCGACGTAAAGGAGAGGAGACTGAATGAAAAACTAAAGCACATAA	2122	0	UF_Msa_AF_108104	contig31755___1_nr0nt1	contig31755___1_nr0nt1	Unknown	
2153	27	21	unmapped	0		0	CGCCTTGATGCAAACTGTTCCTCTCAGTGGACGAAGTTATGCATTCCCATGGGCTCTCAC	2124	0	UF_Msa_CF_127109	contig10169___0rc	contig10169___0rc	Unknown	
2154	27	22	unmapped	0		0	GGCACTAGATGATCATCAGGAAAAAGTGAATCAACAGTTTGGCTTGTAATTGTGTAATTT	2125	0	UF_Msa_AF_103425	LMB_S454.sd.294.C1___1_nr1nt0	LMB_S454.sd.294.C1___1_nr1nt0	Unknown	
2155	27	23		0		0		735	1	ETG05_36762	ETG05_36762	ETG05_36762		CONTROL
2156	27	24	unmapped	0		0	ACCAGGTTGATGACGAGGACATCCGCACCTTGAAGCGCGAGTTCGGCTCAGTCAACCGGG	2128	0	UF_Msa_CF_120785	contig05207___0rc	contig05207___0rc	Unknown	
2157	27	25	unmapped	0		0	AAATTGAAGCCTCCCGCAGCAAGGAGTGCTATCACGAAACGCAAGAAAAGCAAAAGATGA	2130	0	UF_Msa_CF_120668	contig22427___0rc	contig22427___0rc	Unknown	
2158	27	26	unmapped	0		0	TCAGTGCCAATACCACATTGTCTTAGATCCTGTCACGGCTTTGCCTTAAGCTAATACCCT	2132	0	UF_Msa_AF_101713	contig29585___1_nr0nt1	contig29585___1_nr0nt1	Unknown	
2159	27	27	unmapped	0		0	TGAAAGTCATATGGACAAATGTGTGGAGACGCAAAGTTCAACAACGGCAGCTACAGGCAT	2134	0	UF_Msa_CF_119502	contig10707___0rc	contig10707___0rc	Unknown	
2160	27	28	unmapped	0		0	TGGTGCTGCAGCATAGCAGAGTTCAGGGAGGACAGCTCGACTCTGGGGAGAAAGAGGTCC	2136	0	UF_Msa_CF_126262	contig20438___0rc	contig20438___0rc	Unknown	
2161	27	29	unmapped	0		0	TACAACAGCAATCTCTTCTTTTGGTTCTTCCCTGCACTGATGGCAAGCCAAGACAAAGCA	2138	0	UF_Msa_AF_105905	LMB_S454.sd.234.C1___1rc_nrnt	LMB_S454.sd.234.C1___1rc_nrnt	Unknown	
2162	27	30	unmapped	0		0	TCAAAAAAGCTCCTTACAGAGCCACAGAAAACACCAGCCACTGTTTTCTTAAGCTGAGCA	2140	0	UF_Msa_CF_120505	contig00771___0rc	contig00771___0rc	Unknown	
2163	27	31	unmapped	0		0	AGCATCCCTATAGAGGCCAGTGACGACATCACCGAGCTTCAGACTGTGTTCATCAACAGT	2142	0	UF_Msa_CF_126192	contig06443___0	contig06443___0	Unknown	
2164	27	32	unmapped	0		0	CATCAGAGACGGTGATTTCCTGAGAAAAACTTGTCGAGGTGCATCAATCGTCTTCCACAT	2144	0	UF_Msa_AF_109452	contig11874___1rc_nrnt	contig11874___1rc_nrnt	Unknown	
2165	27	33	unmapped	0		0	TGAAGGTTTCTCCAAGAACATTAAGCTGGGCATCCATGAAGACTCTCAAAACCACAAGAA	2146	0	UF_Msa_AF_105540	contig13426___1rc_nrnt	contig13426___1rc_nrnt	Unknown	
2166	27	34	unmapped	0		0	GTAAAGAAAAGAAAATTGGATAAAACCCGACAGGACAGGCTGTACTTTGACAGCTATACC	2148	0	UF_Msa_CF_125202	contig04250___0	contig04250___0	Unknown	
2167	27	35	unmapped	0		0	CAGGTCTTTGGAAAACTTATTTGCGGAGATGCAGAGCCGACTCCAGAGCAGGAGGAGAAA	2150	0	UF_Msa_AF_101115	contig18062___1rc_nr1nt0	contig18062___1rc_nr1nt0	Unknown	
2168	27	36	unmapped	0		0	AGACAAGAGCCAGTTTTTCTTTCTGTTGTCAGCACCTTGTGTGCAAGTCTGTGTAACTGT	2152	0	UF_Msa_AD_200058	LMB_Add_69	LMB_Add_69	Unknown	
2169	27	37	unmapped	0		0	TCGTGGTCCTCAGCATTTGGGCTCATTTTAGCACCTTTCCTGTGGAGGTGTACATACGGC	2154	0	UF_Msa_AF_109851	contig13940___1_nr1nt0	contig13940___1_nr1nt0	Unknown	
2170	27	38	unmapped	0		0	AACAAGAACAGCAGCTACTTTGTTGAATGGATTCCCAACAACGTCAAGACCGCCGTTTGT	2156	0	UF_Msa_AF_103090	contig16453___1_nrnt	contig16453___1_nrnt	Unknown	
2171	27	39	unmapped	0		0	CAAAAACTGTACTTTCTGCGAACTGTCCAAGTGGGTTTCTACTGCAGACAGCGTGCTATA	2158	0	UF_Msa_AF_107133	LMB_S454.948.C1___1rc_nr1nt0	LMB_S454.948.C1___1rc_nr1nt0	Unknown	
2172	27	40	unmapped	0		0	CCAACACCCTTATCTCACCTAAAGATGTAACCCCCACAATAAATGTTTTGTAAATTTGTT	2160	0	UF_Msa_CF_118846	contig19339___0rc	contig19339___0rc	Unknown	
2173	27	41	unmapped	0		0	GGGTCAGAAAATATTTTTAAGAACGTGGTGTAGATTGAACTTTTACTGTACAGAACACCA	2162	0	UF_Msa_AF_107272	contig06201___1_nr0nt1	contig06201___1_nr0nt1	Unknown	
2174	27	42	unmapped	0		0	TGATAAACTTAGTGTTCCGGTGATGAGAAGCTTACTGCGGAGTTGCAGCAGTCAGATGAA	2164	0	UF_Msa_CF_123864	contig29528___0rc	contig29528___0rc	Unknown	
2175	27	43	unmapped	0		0	AAAGGTGTCAGAGAGTTTATCCACGTCAGAGTCTTGCTTTGATGTTTCTCCCCTCCAAAG	2166	0	UF_Msa_CF_122817	contig11960___0	contig11960___0	Unknown	
2176	27	44	unmapped	0		0	ACTTATATTAGTGGTCATGACTGTCCAGATCAAGTGTTTCCAAGAAATCATCACCATTGG	2168	0	UF_Msa_AF_100919	contig01045___1_nrnt0	contig01045___1_nrnt0	Unknown	
2177	27	45	unmapped	0		0	ACCGCTGCCATGGCTTTGGACCGGGCTGGAAAACTGATAGAGCCAATAAACCTAGAGAAA	2170	0	UF_Msa_AF_105171	contig09060___1rc_nrnt	contig09060___1rc_nrnt	Unknown	
2178	27	46	unmapped	0		0	CTTTACCTTTCTGGAACAGGCACCACAGAGGCCTCTAGTGCCAAAGACTGTGAGGACACC	2172	0	UF_Msa_CF_120872	contig01417___0rc	contig01417___0rc	Unknown	
2179	27	47	unmapped	0		0	AATGACAGAACGCAGTTGGACAGTATTGCCAGAATGAACAGTCCTCTCCCGATCATTGTT	2174	0	UF_Msa_CF_122856	contig20512___0	contig20512___0	Unknown	
2180	27	48	unmapped	0		0	CTGACCTTTGCCAATCGGACTGAATATGTGGAGAGAGCACTGGACTACAGGCTGCATGAA	2176	0	UF_Msa_AF_102393	contig07620___1rc_nrnt0	contig07620___1rc_nrnt0	Unknown	
2181	27	49	unmapped	0		0	TACTGCATTGTCCATCTACATACAAAATAAAAGTGAAGAAACTGAACCAGGAGCAGAGGG	2178	0	UF_Msa_AF_102116	contig28775___1_nrnt	contig28775___1_nrnt	Unknown	
2182	27	50	unmapped	0		0	GTGGTTTCATCGCTTCGAGACGCTGTCCAACCACCTCATCGAGCTCATCTTCCCATTCTT	2180	0	UF_Msa_AF_102529	contig04896___1_nrnt	contig04896___1_nrnt	Unknown	
2183	27	51		1028	E1A	0		799	1	(+)E1A_r60_n9	E1A_r60_n9	E1A_r60_n9		CONTROL
2184	27	52	unmapped	0		0	GGTTTATGGGTAATGTAGTATTAAGTGAGGGGAAAAATGAGGCACATTTACTTCAGACCT	2183	0	UF_Msa_CF_118834	contig06530___0rc	contig06530___0rc	Unknown	
2185	27	53	unmapped	0		0	AGCGGGATCCATTTGAAGCTTCCAACCCCACCACCGATGACAGAATGGAAGTCGACGCAG	2185	0	UF_Msa_CF_122405	contig03712___0rc	contig03712___0rc	Unknown	
2186	27	54		0		0		485	1	RC5	RC5	RC5		CONTROL
2187	27	55	unmapped	0		0	GATCCATGTCAACAACCAGATTGTACCTAACGCGGAGACAACCCGTCATCCGGAGCAACA	2188	0	UF_Msa_CF_119523	contig22890___0	contig22890___0	Unknown	
2188	27	56	unmapped	0		0	CTGACTCTGACTGCAAGGTCTGTTCACAATACAAGAGGAAAGGGTGGAGGAAGAAGAGCA	2190	0	UF_Msa_AF_105507	contig16705___1rc_nrnt0	contig16705___1rc_nrnt0	Unknown	
2189	27	57	unmapped	0		0	AAGAAGTCTTTGGACTATGGCAATAACTCTCTGCTGAGAACAGACCTTCCCTCAGTGTCT	2192	0	UF_Msa_AF_108589	contig04884___1rc_nrnt	contig04884___1rc_nrnt	Unknown	
2190	27	58	unmapped	0		0	AGGTAAAGCGGAGCACCAGAGTGTTGAAATCACACCCATGCAGGATTCATTCTATGCAAA	2194	0	UF_Msa_CF_118388	contig08393___0	contig08393___0	Unknown	
2191	27	59	unmapped	0		0	CAGATTTGCCCTTCAGACATTTCTGGTAAATACCTAATTCACACAATCTGTAATCAATGT	2196	0	UF_Msa_AD_200259	LMB_Add_96	LMB_Add_96	Unknown	
2192	27	60	unmapped	0		0	GCTTGGAAACTGCCACCTCAGAGGGATTTGTGACAACTACCTAGTCAGTTTTCCTTCATT	2198	0	UF_Msa_CF_117865	contig26324___0	contig26324___0	Unknown	
2193	27	61	unmapped	0		0	ATTGTGGGGCAGTATTATCTGTATGGGTTTATCATGGACCCAAGAATCGTCTGCTCCAGA	2200	0	UF_Msa_AF_101695	contig20358___1_nr1nt0	contig20358___1_nr1nt0	Unknown	
2194	27	62	unmapped	0		0	AATGCTGCGGCCTAAGGTGGCCACCCTACCCGGCCACATCCAGGCAGTGTATGTGCAGAA	2202	0	UF_Msa_AF_105055	contig00768___1_nr0nt1	contig00768___1_nr0nt1	Unknown	
2195	27	63	unmapped	0		0	TCCATCTGTGTGTGGTGTGTAGCTGGCTCCGTCTTCAGCTCAGTACTTCGGTACTTTGGT	2204	0	UF_Msa_CF_121183	contig21771___0	contig21771___0	Unknown	
2196	27	64	unmapped	0		0	AAGAAGAGGACACGGTCTTCCCAGCAAACAAACAAAAAGGTGAAGTATGGCTCGTACCAA	2206	0	UF_Msa_CF_125444	LMB_S454.366.C1___0	LMB_S454.366.C1___0	Unknown	
2197	27	65	unmapped	0		0	CAGCTTACCAACAACAATGGGCGTCGTGGCAGGCATCCTGGTGCAAAATGTCCTCAAGTA	2208	0	UF_Msa_AF_102219	contig06844___1_nrnt	contig06844___1_nrnt	Unknown	
2198	27	66	unmapped	0		0	TAAAATTGGGTCTGGATCCACAGAGCAAGTCAGTGGCAAAGGCAAGATGGAAATGGATGA	2210	0	UF_Msa_CF_119070	contig07386___0	contig07386___0	Unknown	
2199	27	67	unmapped	0		0	TCACCCACTCCCGTGATGGATATGCATGCTAAAAAGCATCTGTGGGAAGACATTCAAGCC	2212	0	UF_Msa_CF_122152	contig20798___0rc	contig20798___0rc	Unknown	
2200	27	68	unmapped	0		0	ATTTTACTGCATCGCAGCACCGGGAAATTTCACTACAAAAAAGAGGGCACCTACTCCATC	2214	0	UF_Msa_AF_104566	contig04112___1rc_nrnt	contig04112___1rc_nrnt	Unknown	
2201	27	69	unmapped	0		0	CGTGAAGCCAAGATGGCCTCAATCGCCAGCCCAAGCTCTGACGGAGCCCAGATGATGGCA	2216	0	UF_Msa_CF_120979	contig15383___0rc	contig15383___0rc	Unknown	
2202	27	70	unmapped	0		0	TTCAGTCAGCAGACGTTCCTGCGAGAGTTTAGAGGGAAGATCAAAAGTAAAGTTGCATGG	2218	0	UF_Msa_CF_121936	contig21978___0	contig21978___0	Unknown	
2203	27	71	unmapped	0		0	TGCTTCTACCAATAAAATCCCAGCTAGTGTACACCAGCCAGTTAAAAGCACCAAGAAACC	2220	0	UF_Msa_CF_122239	contig26550___0	contig26550___0	Unknown	
2204	27	72	unmapped	0		0	ACAGCTGCTGGACTGCAAGATGAAGCAACCACTGGCACTGTGAGTAGTTTCAAATGGAGG	2222	0	UF_Msa_CF_123764	contig25910___0rc	contig25910___0rc	Unknown	
2205	27	73	unmapped	0		0	TACCAGAAGTTTCACAAGTACATGCAGTGAGTTGCAAATTCTTGGGTCAAAGACATCCGT	2224	0	UF_Msa_AF_106557	contig18057___1_nr0nt1	contig18057___1_nr0nt1	Unknown	
2206	27	74	unmapped	0		0	GGCTTCAGGAGGACGAAGATGTAGAGAGATTTAGCGAGGAAGTGGCCGACTCTTCCCTTC	2226	0	UF_Msa_CF_118961	contig01958___0rc	contig01958___0rc	Unknown	
2207	27	75	unmapped	0		0	AAACAAAAGTGCCTAAAGTCGCCAAAGCTAAGGACGTCGACAACAGCGAAACAAAAGCTG	2228	0	UF_Msa_CF_125142	contig13028___0rc	contig13028___0rc	Unknown	
2208	27	76		0		0		2230	1	ETG10_195139	ETG10_195139	ETG10_195139		CONTROL
2209	27	77	unmapped	0		0	TTTCTATGTTCAAGTCTCTTGATTAAGTCTGTCCCAAGTTGAAGGCAGCAGTGAGGGCCA	2232	0	UF_Msa_CF_118113	contig29988___0rc	contig29988___0rc	Unknown	
2210	27	78	unmapped	0		0	ATGAAACCCACTAAGAACATGGATTTACCTACAGATGGTGTGTCCTCCAGTTCACCCAGA	2234	0	UF_Msa_CF_119184	contig32143___0	contig32143___0	Unknown	
2211	27	79	unmapped	0		0	TGCCCTGTCCGTTCTCATTACAGTTTTATGTATGGGTTTATATGTCTGCTGATAAATTTT	2236	0	UF_Msa_AF_102882	LMB_S454.232.C1___1rc_nrnt	LMB_S454.232.C1___1rc_nrnt	Unknown	
2212	27	80	unmapped	0		0	CCTGAAGCAAAAGAGAATGTATGAAGGTCAAAGAGAGCAGCTGGCTCAGCAGTCTTTTAA	2238	0	UF_Msa_AF_101811	contig10418___1rc_nrnt	contig10418___1rc_nrnt	Unknown	
2213	27	81	unmapped	0		0	ATTAAACCAGTGCAGTCTGTGGGAGGAGTCGGTGGGTCCCAGTTCAAGACCATCATCCCG	2240	0	UF_Msa_AF_100793	contig02298___1_nr1nt0	contig02298___1_nr1nt0	Unknown	
2214	27	82	unmapped	0		0	TAAAGAGGCGGCTCTGTTGGCGCTACAAGAGGAGAACATGGAGGCTTCTGTCATCAAACA	2242	0	UF_Msa_AF_101398	contig23438___1_nrnt0	contig23438___1_nrnt0	Unknown	
2215	28	1	unmapped	0		0	GATCACTGCTTTAATAGGTGTATCTTTGGGGAGGTCAATGCAACAGTGTCAGGATTTGCT	2085	0	UF_Msa_AF_105391	contig10162___1rc_nrnt0	contig10162___1rc_nrnt0	Unknown	
2216	28	2	unmapped	0		0	CCACGGGACAGAAGCGAAAGCAACTTGGAAAGAGATCGCCTGTTCAAATAGAGCAAAAAA	2087	0	UF_Msa_CF_119575	LMB_S454.sd.230.C1___0rc	LMB_S454.sd.230.C1___0rc	Unknown	
2217	28	3	unmapped	0		0	AACCTGCAGGACCCCTTCTCTGAAGGAAATGACCCCGCTTTCCCCAGGAAGAACATGACG	2089	0	UF_Msa_AF_108755	contig13738___1rc_nrnt0	contig13738___1rc_nrnt0	Unknown	
2218	28	4	unmapped	0		0	CAAACGACACCGGTTGTCTCTCCATCCCAGGGAAGCCCAGAGGCTAAAGAAGAAAGCAGC	2091	0	UF_Msa_AF_109530	contig05974___1_nrnt	contig05974___1_nrnt	Unknown	
2219	28	5	unmapped	0		0	AGAAAGCCTTCTTTGATCTCAAGACGACAAAACGAGTGTACAACTTCTGTGCCCAGGACA	2093	0	UF_Msa_AF_104205	contig26686___1_nrnt	contig26686___1_nrnt	Unknown	
2220	28	6	unmapped	0		0	CAGCCAGCAGCATCATTCAGATGAAACATGACTATGACAAGATGTTCAAACTAAGTGAGA	2095	0	UF_Msa_AF_104899	contig04073___1rc_nrnt0	contig04073___1rc_nrnt0	Unknown	
2221	28	7	unmapped	0		0	AACCCAAATGTGATAAAGGCTTCATACGCAGAGGGAACCATTCCAAGGTGGACTTAGGTT	2097	0	UF_Msa_CF_125271	contig14229___0rc	contig14229___0rc	Unknown	
2222	28	8	unmapped	0		0	AGGACGGCTTCTGTAGACTCCATCACTTTAAGTAAGCCTTGTATGTCTTCTTGACTTTCG	2099	0	UF_Msa_CF_120749	contig00548___0rc	contig00548___0rc	Unknown	
2223	28	9	unmapped	0		0	GTCATCAAACTGTTTGAGGCAGGAAGTTACTCCTAGAGCTTCTCTGTTAATTAGATGTGT	2101	0	UF_Msa_CF_120032	contig31818___0	contig31818___0	Unknown	
2224	28	10	unmapped	0		0	TCAGAGACGGACACGCGCTACTTCGACGAGGAGTTCACAGCACAGACCATCACCATCACT	2103	0	UF_Msa_AF_109225	contig23670___1rc_nrnt	contig23670___1rc_nrnt	Unknown	
2225	28	11	unmapped	0		0	GCAGCAGATGGCCCCTAACCTCCTGCTACTTCATTGACCCCTGACCTTGTCAGACAGAAG	2105	0	UF_Msa_CF_120233	contig07213___0rc	contig07213___0rc	Unknown	
2226	28	12	unmapped	0		0	ATCTGAAGGAAGCTGAATATCACACAGAAAACAAGACGCTATTCCATGCTGCAAAGGCTA	2107	0	UF_Msa_CF_118553	contig05916___0	contig05916___0	Unknown	
2227	28	13	unmapped	0		0	AAAGTTACAGGAAAAGAAAACAAGACTCGGACTGCTCAATCCAAAAAACTGCTGGAAGCG	2109	0	UF_Msa_CF_124075	contig25399___0rc	contig25399___0rc	Unknown	
2228	28	14	unmapped	0		0	TGATCATCCAGCCGCTGTCGCACCTTCAGTGTACATAAGAGGAGAAACGGGATGCTGTGT	2111	0	UF_Msa_CF_121941	contig21993___0	contig21993___0	Unknown	
2229	28	15	unmapped	0		0	TACTGGGATGAGCCTCTTGTTGGCGGAAAGGCCTCAGAGGGCAGAGATGTAGAGGAATGG	2113	0	UF_Msa_AF_107751	contig20020___1_nrnt0	contig20020___1_nrnt0	Unknown	
2230	28	16	unmapped	0		0	TTACAGTTTTTCCCGCTCGGCGCTCTGGGTGGGTACTACCTCCTTCATGATCCTGGTGCT	2115	0	UF_Msa_AF_105426	contig14035___1rc_nrnt-1	contig14035___1rc_nrnt-1	Unknown	
2231	28	17	unmapped	0		0	CCCCGTGTATAATCAGCTTTAGGATAGGTTGCAATAATTCACTTCCATTACAGAAAATAA	2117	0	UF_Msa_AF_109752	contig01773___1rc_nr0nt	contig01773___1rc_nr0nt	Unknown	
2232	28	18	unmapped	0		0	CCTCCTGCAGGAGTACAGTTATCCTGTTCTTGCTTTGGTATCCAGGTGGCTGTCATTTCA	2119	0	UF_Msa_CF_123765	contig23652___0rc	contig23652___0rc	Unknown	
2233	28	19	unmapped	0		0	AATCCTCTCTGAAATAGAAAGAGCAGATAACTTTGGAGGGATGCAACTCTGGCCATGACC	2121	0	UF_Msa_CF_125577	contig24643___0rc	contig24643___0rc	Unknown	
2234	28	20	unmapped	0		0	TGTGGTTGCTGTCCCCACAGACACCATCTACGGCCTGGCCTGCTGGCCCAGAACTCTGAA	2123	0	UF_Msa_CF_127167	contig02490___0rc	contig02490___0rc	Unknown	
2235	28	21		1028	E1A	0		643	1	(+)E1A_r60_a22	E1A_r60_a22	E1A_r60_a22		CONTROL
2236	28	22	unmapped	0		0	AGACCAGAGAGCACGCCCTACTGGCTTACACTCTGGGCGTCAAGCAGATCATAGTCTGTG	2126	0	UF_Msa_AF_107954	contig16313___1rc_nrnt	contig16313___1rc_nrnt	Unknown	
2237	28	23	unmapped	0		0	TGGTTGATCCTGCCAGTAGCATATGCTTGTCTCAAAGATTAAGCCATGCAAGTCTAAGTA	2127	0	UF_Msa_AF_103828	contig00751___1_nr0nt1	contig00751___1_nr0nt1	Unknown	
2238	28	24	unmapped	0		0	TTTATTAATAAAATACAAAATGACAAAAAGTTTCCATAGGAAAGCATTATGAAATTGCAA	2129	0	UF_Msa_AF_103033	contig15928___1_nr0nt1	contig15928___1_nr0nt1	Unknown	
2239	28	25	unmapped	0		0	CAATATTCAGTCTGTTAATGCTTAGTGGATTCACTAATACACATAAACCACTGTCATCCA	2131	0	UF_Msa_CF_123176	contig22373___0	contig22373___0	Unknown	
2240	28	26	unmapped	0		0	ATCCTGTCACCTCTTCCAGGGCTTCATCCAGGGAGAGGGCCGGGTTGGATCACAGGATCC	2133	0	UF_Msa_AF_108885	contig09213___1rc_nrnt0	contig09213___1rc_nrnt0	Unknown	
2241	28	27	unmapped	0		0	ATCGAAGGCGGCGTGATCGACTGTCTCCTCGCCATAGGTGATGAGGCTGTCGGAGGTCAC	2135	0	UF_Msa_AF_100164	contig24073___1rc_nr0nt	contig24073___1rc_nr0nt	Unknown	
2242	28	28	unmapped	0		0	AGGAGAGGATGGTCTCACCGTGGAGCCCGGCATATATTTCATCAACCACCTGCTGGACCA	2137	0	UF_Msa_AF_110129	contig29616___1rc_nrnt	contig29616___1rc_nrnt	Unknown	
2243	28	29	unmapped	0		0	TTTGCCAACAGAGTGAAAGCAGCCATAGCTGCACAAGGAGGGTTAACGGAAATCTCATTT	2139	0	UF_Msa_AF_101307	contig26827___1rc_nr0nt	contig26827___1rc_nr0nt	Unknown	
2244	28	30	unmapped	0		0	CTGTAACGTGTCCGTGTGTGCTTCTTGTTTTAAGTGAACAAACAATAAAAGAGAATGTGA	2141	0	UF_Msa_CF_123304	contig11289___0	contig11289___0	Unknown	
2245	28	31	unmapped	0		0	CTATGTGACTGCAGGGACCTACTATGAAGATGAGATTCTTCAAAAAATGGAGTTAATTAT	2143	0	UF_Msa_CF_125933	contig20552___0rc	contig20552___0rc	Unknown	
2246	28	32	unmapped	0		0	TGGTCCAAGCTGCCGCCATGCACGACCACAAACTGGACGAAAAACTTCGTGCTCACTTCC	2145	0	UF_Msa_CF_119190	LMB_S454.576.C1___0rc	LMB_S454.576.C1___0rc	Unknown	
2247	28	33	unmapped	0		0	ACATTGTGCCAGTCTCCGGATGATTCAGGAACCACTTCCAGGTCAAGTTCAGGCGTTACC	2147	0	UF_Msa_CF_121961	contig04653___0rc	contig04653___0rc	Unknown	
2248	28	34	unmapped	0		0	ACAGCAGGATAACATTTAACCTGGTAAAAATGTATGGGTGGTCGTGTTTCTCCTTTTGGA	2149	0	UF_Msa_AF_100478	contig14910___1_nr0nt1	contig14910___1_nr0nt1	Unknown	
2249	28	35	unmapped	0		0	TCAGCTGCCTTATCAGTCAGTCAATCTTTTATACAACACGGCGCGGAAAAGGAAAGAGTG	2151	0	UF_Msa_CF_118860	contig25585___0rc	contig25585___0rc	Unknown	
2250	28	36	unmapped	0		0	TCCTGCTAGTGTTTCCAGTTGAGCTCCCCTGAAGACCTCTGTAAAAGGGATCACAAATAT	2153	0	UF_Msa_CF_125499	contig04740___0	contig04740___0	Unknown	
2251	28	37	unmapped	0		0	TAGACTGATGTTTTCTAACTGCTACAAGTACAACCCCCCTGATCATGATGTGGTGGCCAT	2155	0	UF_Msa_AF_110182	contig28228___1_nrnt	contig28228___1_nrnt	Unknown	
2252	28	38	unmapped	0		0	GAGAAATGCTCTGAATTTCGCCGTCGTCCAACACAACAGGGCCAACAACGACATGTACCC	2157	0	UF_Msa_AF_108866	LMB_S454.94.C1___1rc_nrnt0	LMB_S454.94.C1___1rc_nrnt0	Unknown	
2253	28	39	unmapped	0		0	TTTATTATCTCCAAACCCCCAATCCCTCACCGATGAGGCATTACACCGCCACGATAAGGT	2159	0	UF_Msa_CF_118609	contig18420___0rc	contig18420___0rc	Unknown	
2254	28	40	unmapped	0		0	GTGTATGTTTATTTTCTTATCAAGGCCACCATAGTTGTGACTGATATTGCTGTTTTGCTA	2161	0	UF_Msa_AF_100377	LMB_S454.sd.631.C1___1_nrnt0	LMB_S454.sd.631.C1___1_nrnt0	Unknown	
2255	28	41	unmapped	0		0	GTTGTGCAGGCTATTCAGGTGATTGTTCATACATATTTGCTTCTCGTTTGTTCTTTTAAA	2163	0	UF_Msa_AF_109725	contig29042___1_nrnt	contig29042___1_nrnt	Unknown	
2256	28	42	unmapped	0		0	GTGTCACCTGAGAAGAGCTACCTGTCTCCTCGGTAGATCTATTGGAGTGGCATATGAAGG	2165	0	UF_Msa_AF_104341	contig26105___1_nr0nt	contig26105___1_nr0nt	Unknown	
2257	28	43	unmapped	0		0	TTTAGGTTCTTTAAGCTGCATCAATCAGAAAATAGTGAGCGTCTGCCTGCTGAAGAGAAA	2167	0	UF_Msa_AF_102571	contig32299___1rc_nrnt-1	contig32299___1rc_nrnt-1	Unknown	
2258	28	44	unmapped	0		0	AGAGCAAGAAGTGCCAGAACAAGAGAAAGAACCAGAGCACAGACTCTTCTCAGCATGTGG	2169	0	UF_Msa_CF_126871	contig17842___0	contig17842___0	Unknown	
2259	28	45	unmapped	0		0	AGGTCAACATTAACCTCAGAACTGCAGCCTTTTCAGCCCCCACATTTAACGTCTTAGATG	2171	0	UF_Msa_AF_103824	contig29242___1_nr1nt0	contig29242___1_nr1nt0	Unknown	
2260	28	46	unmapped	0		0	AGAACACACTCCTGGAAAAGCAGACAAACAGAAAGTAGCAGTCCCCTCAACAAGCAGAAA	2173	0	UF_Msa_CF_119429	contig10726___0	contig10726___0	Unknown	
2261	28	47	unmapped	0		0	ACACTCATCGCAAAGGTTATGGAAACCGCCATAACATGGGCTAACAACGAGGAGAAAAAC	2175	0	UF_Msa_AF_107239	contig02558___1_nr0nt	contig02558___1_nr0nt	Unknown	
2262	28	48	unmapped	0		0	TTATTTCCCTGAATTTCAATTTGAAGTCAACTTTACTTGGCAAGAAACTGAATCTCGGTG	2177	0	UF_Msa_CF_121677	contig29224___0rc	contig29224___0rc	Unknown	
2263	28	49	unmapped	0		0	CTGGCTCTTTTGTACCATTTGTTTGAACATTTTGTAGAAATGTGGATAGGGTGTTTACAT	2179	0	UF_Msa_AF_107937	LMB_S454.sd.63.C1___1_nrnt	LMB_S454.sd.63.C1___1_nrnt	Unknown	
2264	28	50	unmapped	0		0	GCCTGTCTGAAATCCCCAATCTTTAACACAAAACCAAATCTAAACTCCAATTAAAGGTTT	2181	0	UF_Msa_CF_117971	contig10220___0	contig10220___0	Unknown	
2265	28	51	unmapped	0		0	TTCTGCTGCTCCCTCTGTGGTCGCAGCTTCACCAAGCTGAGCAACCTCAAGGCCCACCGA	2182	0	UF_Msa_AF_110178	contig30000___1_nr1nt0	contig30000___1_nr1nt0	Unknown	
2266	28	52	unmapped	0		0	AATTAACCTCGTAACATTGGTCTCGCCAGTGGAGACAAGGTGAATCTGGGAATAGATCCA	2184	0	UF_Msa_CF_121550	contig03798___0rc	contig03798___0rc	Unknown	
2267	28	53	unmapped	0		0	AGATACCAGGAAATCCTCCACTCCATCATCTGACCCGCAAGGGCAAGGTAGGCCTCAGGA	2186	0	UF_Msa_AF_106009	contig03819___1_nr0nt	contig03819___1_nr0nt	Unknown	
2268	28	54	unmapped	0		0	AATGGACGATGCAGAGAAAGGTTCCCAGCAGCATCCGGACTCAGTCCCAGAGATGGGGAA	2187	0	UF_Msa_CF_126908	LMB_S454.508.C1___0	LMB_S454.508.C1___0	Unknown	
2269	28	55	unmapped	0		0	ACATGTTCTGTGGAGTGACATATCACACTCCTCTATCTGATCAGTCTGAGTTTGGTGAAT	2189	0	UF_Msa_CF_126422	contig23203___0rc	contig23203___0rc	Unknown	
2270	28	56	unmapped	0		0	ATAAAGTAGCCTACGTTCAGCTGGCCCAGGGCCAGACGTTCACCTTCCCTGACATCTTCC	2191	0	UF_Msa_AF_103410	contig10617___1rc_nrnt0	contig10617___1rc_nrnt0	Unknown	
2271	28	57	unmapped	0		0	TGTCACAGCTTATTTGTACCTGCAACAGCTTGAAAACCAGCCCTCCTCCTGCCATTGCCA	2193	0	UF_Msa_AF_101449	contig05052___1rc_nrnt	contig05052___1rc_nrnt	Unknown	
2272	28	58	unmapped	0		0	CATTGTCAAACTCCTGAATACTTACCCACTCTGACATGTTTGTGTACCTTCTTTTCCCTT	2195	0	UF_Msa_AF_109560	LMB_S454.19.C1___1_nrnt	LMB_S454.19.C1___1_nrnt	Unknown	
2273	28	59	unmapped	0		0	GTCTTAAATGGCTCTTGTCCATGGGCACACTACCTTTTCGGCTATTTTTATATAGGGGTT	2197	0	UF_Msa_AF_104491	LMB_Sanger.16.C1___1_nr0nt1	LMB_Sanger.16.C1___1_nr0nt1	Unknown	
2274	28	60	unmapped	0		0	GTTCTAAAAATCTTGCAGAAACTCAAGGATCTGGATATCACATTAGACATTCTTGCTGAA	2199	0	UF_Msa_CF_122830	contig29018___0rc	contig29018___0rc	Unknown	
2275	28	61	unmapped	0		0	CTCAATCCTTCCAGCTGAGCCCAAGTGTCTCAGCGACGAAGGAAAAGATGTGCGTGTCCC	2201	0	UF_Msa_CF_124034	contig04286___0rc	contig04286___0rc	Unknown	
2276	28	62	unmapped	0		0	AACAGCTGGTGACGCTTGAGGTGATTTTGAAGCGACGGTTCTTTTCGGTACGATCTTTTA	2203	0	UF_Msa_CF_120132	contig23987___0rc	contig23987___0rc	Unknown	
2277	28	63	unmapped	0		0	ACCCACACCAGCTCAGCCCTATGACTGGCAGCTCCATGTCGGGACACCTGCAACACCACA	2205	0	UF_Msa_CF_125585	contig10364___0	contig10364___0	Unknown	
2278	28	64	unmapped	0		0	TAAAGTGGGATGGATGAGCGCCATATTGCGCCTGGTGTGAACAGAGGGAGGGGAAATCTG	2207	0	UF_Msa_CF_124990	contig18294___0	contig18294___0	Unknown	
2279	28	65	unmapped	0		0	AAGCCTTCAAGGAGACGTTTATGAAATGCCTGAGAGACAACAGCTTCGACAACTCCAAGT	2209	0	UF_Msa_AF_109601	LMB_S454.571.C1___1rc_nrnt-1	LMB_S454.571.C1___1rc_nrnt-1	Unknown	
2280	28	66	unmapped	0		0	CAGTATCGTGGTTGGAGAAGTGATGCAGTTCAGGTCGAAGCTCTGTCTACGGACCCCGCT	2211	0	UF_Msa_CF_118329	contig09051___0rc	contig09051___0rc	Unknown	
2281	28	67	unmapped	0		0	ATGTGAATGTGGATTTGGATGTCCTCCTCTTATTGCTAATTATTGATGCAGCCCCAAGGG	2213	0	UF_Msa_CF_121731	contig21699___0	contig21699___0	Unknown	
2282	28	68	unmapped	0		0	TTTCTGCTAGCGGATGGAGGTGCTTTAGGTCTGCGGTTCCTGTTCTCCCTGCTCAGAGTC	2215	0	UF_Msa_CF_120091	LMB_S454.451.C1___0rc	LMB_S454.451.C1___0rc	Unknown	
2283	28	69	unmapped	0		0	CTCGGTTCCGACCCCAAATCAAACTGCTTTCCAATTGGCGCTGGCGCCAACAAATGTGCC	2217	0	UF_Msa_CF_119619	contig23532___0rc	contig23532___0rc	Unknown	
2284	28	70	unmapped	0		0	CAAAAAAGCAACATGAAGGAGTTCGACATGTGGAGAAGACACCGTAACAGCCAATGTAGC	2219	0	UF_Msa_CF_120659	contig31477___0	contig31477___0	Unknown	
2285	28	71	unmapped	0		0	TATTATTTATTGAAAACCCAGCAGTTGTCATTAATACCTGTTGTGCCTTACAGAGTAAGG	2221	0	UF_Msa_AF_108305	contig27552___1_nr0nt	contig27552___1_nr0nt	Unknown	
2286	28	72	unmapped	0		0	AACAGGTGGGACAGGAAAAAGGAAACCCAGCCCACCAACTTCCCCACCAACAAACCAATC	2223	0	UF_Msa_CF_124799	contig29842___0	contig29842___0	Unknown	
2287	28	73	unmapped	0		0	TTCCTTTTGGTGTTACACCTGTAGAAAACATGGAGATGACAGAAACCCCAGGCACCTCTT	2225	0	UF_Msa_CF_125992	contig32515___0	contig32515___0	Unknown	
2288	28	74	unmapped	0		0	TGAGAGCAGCAGAGAGGGAGCCATCACCTTCACCTGGGTCGAGCACGACGTCCACGACAA	2227	0	UF_Msa_AF_100219	contig13360___1_nr0nt	contig13360___1_nr0nt	Unknown	
2289	28	75	unmapped	0		0	GAGCACAGCACAAGTCCTGGAAGAGGTTTGAGCCAAAAGCAGTCTGCTGCCCGACTTTCA	2229	0	UF_Msa_CF_125564	contig22905___0	contig22905___0	Unknown	
2290	28	76	unmapped	0		0	TAGATGACAAAGGACTCATTGTTGAAACCTTCTGCACGGGTGTAGTAGTCGACTCCACAT	2231	0	UF_Msa_AD_200290	AY742597_rc	AY742597_rc	Unknown	
2291	28	77	unmapped	0		0	TCATGAGTTCAGTGGACTTCCTGGCCCAGGAGAAGATCTGGTTTGACAAACCGCGCTATG	2233	0	UF_Msa_AF_102783	contig05163___1_nr0nt	contig05163___1_nr0nt	Unknown	
2292	28	78	unmapped	0		0	AACCTCCCAGCAGGCCTCAGCAACAGCCAGGGAAGACAATAAGATCAACCAGGAGGCTTG	2235	0	UF_Msa_CF_122429	contig19764___0	contig19764___0	Unknown	
2293	28	79	unmapped	0		0	GAGCTGCTGTAGCCAAAGGTGAGGTTCTTACCTTCCTCGATTCCCACGTTGAATGTAACG	2237	0	UF_Msa_AF_110122	contig21654___1_nrnt0	contig21654___1_nrnt0	Unknown	
2294	28	80	unmapped	0		0	GCAGCTTAACAACAATTGCTTTTTTGTTGTTCCATCTTTTGTACTGGACAATGTGACAAA	2239	0	UF_Msa_AF_106235	contig07203___1_nr0nt	contig07203___1_nr0nt	Unknown	
2295	28	81	unmapped	0		0	GCAGTGTCTGTGGTAAAAGCTTCATCCAGCGCTCCTATCTGCAGACTCACATGAACTCTC	2241	0	UF_Msa_AF_103294	contig17862___1_nrnt0	contig17862___1_nrnt0	Unknown	
2296	28	82	unmapped	0		0	TTTCCATTTGGGTTTTTCACTAGAGGCACTGCTGAGCTGGACGGACATGTTATTAACGAC	2243	0	UF_Msa_CF_118893	contig08465___0	contig08465___0	Unknown	
2297	29	1		130	HybridizationNegative	0		2244	1	(+)eQC-39	EQC	EQC		CONTROL
2298	29	2	unmapped	0		0	AACAAAGACATCTTGTTGTCTCTCCAGACACAGATGGCGCTTCGTTCAGTTCATTCACTG	2246	0	UF_Msa_CF_120687	contig10475___0rc	contig10475___0rc	Unknown	
2299	29	3	unmapped	0		0	AAGAGAAGTACGAAGATGGGGTGAAATGGAGGTTTCTTGAACACAATGGACCCTACTTCC	2248	0	UF_Msa_AF_109899	contig01036___1rc_nr1nt0	contig01036___1rc_nr1nt0	Unknown	
2300	29	4	unmapped	0		0	ACATTATTTACACTCTGCAGGTTGGCAGCTGTTCAGAGGCTCAGATGCTTCTATGACTTC	2250	0	UF_Msa_CF_119123	contig18879___0rc	contig18879___0rc	Unknown	
2301	29	5	unmapped	0		0	TCTCTGACCTCACACCTTTACCTGCTGACCCTCAGTCTGATGTCCTCCACCTTCTGCTGA	2252	0	UF_Msa_CF_127582	contig22659___0	contig22659___0	Unknown	
2302	29	6	unmapped	0		0	TTCCTGGTGTACATGTCGGCGGTGTTGCTGCTGTGTGCGGTGCTCATGGGGTATTTCTCT	2254	0	UF_Msa_CF_125648	contig09542___0rc	contig09542___0rc	Unknown	
2303	29	7	unmapped	0		0	CGTTTATTAATCCAAAAAGTGTAGTTTATGCACCAGAGCAGAAGCTGTAGAGGACTCATA	2256	0	UF_Msa_AF_101257	contig10885___1_nr0nt1	contig10885___1_nr0nt1	Unknown	
2304	29	8	unmapped	0		0	CTCGATTAATCGATAGTTGTTTGGGCTATAAAATGTCAATCAGTGTGTCCCAAAGCCCAA	2258	0	UF_Msa_AF_107494	contig08101___1_nr0nt	contig08101___1_nr0nt	Unknown	
2305	29	9		1028	E1A	0		390	1	(+)E1A_r60_3	E1A_r60_3	E1A_r60_3		CONTROL
2306	29	10	unmapped	0		0	TGGGACTGTACCACGTCAATCGCCTGCCGCTCCCGGTCCGACCACAAGGCCTCTTCTATA	2261	0	UF_Msa_AF_100348	contig09938___1rc_nrnt	contig09938___1rc_nrnt	Unknown	
2307	29	11	unmapped	0		0	ATTTTATTCCTGCTGAGTGATAAGAGTAGCATGACAAATGGAGTCACTCTGGCGGTGGAC	2263	0	UF_Msa_AF_108997	contig32484___1_nrnt	contig32484___1_nrnt	Unknown	
2308	29	12	unmapped	0		0	TATGATGAGCTAAACAACATGTTTCCTGGACACCAGGGTATCGAGATAGTCATGGTGGGA	2265	0	UF_Msa_AF_106839	contig24376___1rc_nrnt-1	contig24376___1rc_nrnt-1	Unknown	
2309	29	13	unmapped	0		0	ATGTGCAGGATGCGGGGGGAAGATCTCCGACCGCTTCCTGCTCTTCTCCATGGAGCGCTA	2267	0	UF_Msa_AF_108627	contig18149___1rc_nrnt	contig18149___1rc_nrnt	Unknown	
2310	29	14	unmapped	0		0	GCAAGATGGAGGAAGAGCATGTAATAATATGTAAAGATGATGATTTTTCTGCCACGTCAA	2269	0	UF_Msa_CF_120827	contig30761___0	contig30761___0	Unknown	
2311	29	15		1028	E1A	0		853	1	(+)E1A_r60_a97	E1A_r60_a97	E1A_r60_a97		CONTROL
2312	29	16	unmapped	0		0	CGGCCAATCAGCACAAGGCTGGGTGGGAGTCTTTGAGGAAGAGGTGCAGGTTGTTGTGAA	2272	0	UF_Msa_CF_120814	contig26232___0	contig26232___0	Unknown	
2313	29	17	unmapped	0		0	ATGAACGCCTATGTGGTGTTTAAAGACGAGGAAGGAGTGGCCAGGGCGTTAGAGAGGAAC	2274	0	UF_Msa_CF_119783	contig07757___0	contig07757___0	Unknown	
2314	29	18	unmapped	0		0	ATGTGATCTAGAACGCCTCCGCTTTCTCTCTCCAGATGAGGACCTGGAGCGACTGCGCTT	2276	0	UF_Msa_AF_100382	contig01114___1_nr0nt1	contig01114___1_nr0nt1	Unknown	
2315	29	19	unmapped	0		0	CTGCAGGGACACCATGCTGCAACCAAATGTTACGAAGAGGTTGTTAAAGCAGCACTCACT	2278	0	UF_Msa_AF_108458	contig26687___1rc_nrnt0	contig26687___1rc_nrnt0	Unknown	
2316	29	20	unmapped	0		0	TTTGGAAACACAATTTCGCACTCGTCAATTGATAGACAGAACTCCAAGCACAACAAGCTT	2280	0	UF_Msa_CF_124431	LMB82-1___0rc	LMB82-1___0rc	Unknown	
2317	29	21	unmapped	0		0	GCATCAGCATCACTCTGGTGTCGGTGCCTCTCATCGTGCGTTACTTCAGAAAGACTGGTC	2282	0	UF_Msa_AF_109583	contig03667___1_nrnt	contig03667___1_nrnt	Unknown	
2318	29	22	unmapped	0		0	TTTCTGCTTCACTCTGATGCTGCACCTACTGTCGATGGAGGTGGAAATCCCAGAGTAGAT	2284	0	UF_Msa_CF_118612	contig09573___0	contig09573___0	Unknown	
2319	29	23	unmapped	0		0	GTTGAATGAGATCAGTGCTGTTGTGACCAATCCCAGCGCTCCGTTACGACTGCACAGACA	2286	0	UF_Msa_CF_123736	contig16620___0rc	contig16620___0rc	Unknown	
2320	29	24	unmapped	0		0	TGCAAGAGTCATGCATGGAAAGCAATTGGATGTCCAGTTTGAAGAGGATGACCGTGTGAT	2288	0	UF_Msa_CF_119036	contig11410___0rc	contig11410___0rc	Unknown	
2321	29	25	unmapped	0		0	GTGTTTGGGGGATCGTTTTGACTGCACTTCTTCTTCTTTCTTTTATTTTGGTCCCTGTAT	2290	0	UF_Msa_AF_103162	LMB_S454.78.C1___1_nr0nt	LMB_S454.78.C1___1_nr0nt	Unknown	
2322	29	26	unmapped	0		0	TGTCCCTGTCTTCTCTGCTGCTGATGGTGGACCGGTGACTACGGTTACCCCCGTCTGGCT	2292	0	UF_Msa_CF_126114	contig21429___0rc	contig21429___0rc	Unknown	
2323	29	27	unmapped	0		0	GTGCTGATACTAATGAGGGTGGTCTTAAGGACCATGAAACCCCTTCCAAGATTCTGAAAC	2294	0	UF_Msa_CF_123581	contig16072___0rc	contig16072___0rc	Unknown	
2324	29	28		1028	E1A	0		390	1	(+)E1A_r60_3	E1A_r60_3	E1A_r60_3		CONTROL
2325	29	29	unmapped	0		0	TGTAAAACCTTGCTGCCGACAAGTGGAGAAACTTAAGTGCTGAAGCAAAGCTACCCGTTT	2297	0	UF_Msa_CF_119385	contig09304___0rc	contig09304___0rc	Unknown	
2326	29	30	unmapped	0		0	GGAGGGACACACTTTATCTGAAGGATGGGAAGAGTTTAAAGACAAGTTCTGGGAATTTTA	2299	0	UF_Msa_AF_105454	contig06817___1rc_nrnt0	contig06817___1rc_nrnt0	Unknown	
2327	29	31	unmapped	0		0	ATCTGACAAACCAATCAACATCCTTAAAAGTCCCCGGTCTTACTGACAAGTCCAGAAACA	2301	0	UF_Msa_CF_118817	contig18491___0rc	contig18491___0rc	Unknown	
2328	29	32	unmapped	0		0	TACATCCACTACAACACTCATGCTGAGGTAAAGAAAGATCCAGACTCACCTGAAGCTACC	2303	0	UF_Msa_AF_101618	contig29120___1_nrnt	contig29120___1_nrnt	Unknown	
2329	29	33	unmapped	0		0	TCCCTCCGCATCATGACGTGATTAAGAGCGAGTGCCTTTCATGTAGACACGGTGTGGCCG	2305	0	UF_Msa_AF_109450	contig00027___1rc_nrnt	contig00027___1rc_nrnt	Unknown	
2330	29	34	unmapped	0		0	TAGTACCTACCAAGGGACGTCCTTAGACGGCCTTCCTGGTGTCAGCCACCTGTTTGCTGA	2307	0	UF_Msa_AF_104395	contig24332___1rc_nr0nt1	contig24332___1rc_nr0nt1	Unknown	
2331	29	35	unmapped	0		0	CAGCTCTCATCTGCAGACTTGCGGCTGTTCGATAGTGGTTGGAAGCAACTCAGAGAAATT	2309	0	UF_Msa_AF_100155	contig26848___1rc_nrnt	contig26848___1rc_nrnt	Unknown	
2332	29	36	unmapped	0		0	AGAGTTGTAGCCCTATTCTGGCCACTTGTAAATGCTCACAAAGCAGTGTTTTGGTTTTTT	2311	0	UF_Msa_AF_108840	LMB_S454.sd.303.C1___1_nr0nt1	LMB_S454.sd.303.C1___1_nr0nt1	Unknown	
2333	29	37	unmapped	0		0	TTTATTACTGTAGAGAAGAGAGTGCTGATGACATCACAGCGCTATATGACAGAAGCCCCG	2313	0	UF_Msa_CF_119477	contig24988___0rc	contig24988___0rc	Unknown	
2334	29	38	unmapped	0		0	TCTAGTCAGAGACAGCCACAGGAGGGGGTCGAGACAGAGAGAGGTGGAAGAGCAACAGCA	2315	0	UF_Msa_CF_125671	contig19108___0	contig19108___0	Unknown	
2335	29	39	unmapped	0		0	AAACGTCTGTTTACTGACACTGCCGTCTTATAATAGCCTACATTCTGCTTTGAATTTTTG	2317	0	UF_Msa_AF_104208	contig20251___1_nr0nt1	contig20251___1_nr0nt1	Unknown	
2336	29	40	unmapped	0		0	GCTGGGTGGGAATATGTTCCAACATCTCACCTTTTGTGAAATCCATGTATCATTTTATTT	2319	0	UF_Msa_AF_101457	contig02355___1_nr0nt1	contig02355___1_nr0nt1	Unknown	
2337	29	41	unmapped	0		0	ATGGTGCAGTGGGTTGAAATGTTTATAGGCAACGGTGTTGAATGCAAAATGTAAAACTCA	2320	0	UF_Msa_CF_118657	contig03808___0rc	contig03808___0rc	Unknown	
2338	29	42	unmapped	0		0	AGTGCAGGACGAGTTGTGATTGGAGTTGTGTTAATACATGTATGAGCCTCACTTTCCGTG	2322	0	UF_Msa_CF_124690	contig08333___0	contig08333___0	Unknown	
2339	29	43	unmapped	0		0	GAGCGTGCTGGTGTAGGTCAGGGGCAAGAGACTCGAGATCAGTCATCTACAACGAAAAGT	2324	0	UF_Msa_CF_120508	contig09030___0	contig09030___0	Unknown	
2340	29	44	unmapped	0		0	AAAGACTTGGATGAATGTGCTCCACCCTTTGCTCCCTGTATGCATCACTGCATTAACACA	2326	0	UF_Msa_CF_119915	contig16437___0	contig16437___0	Unknown	
2341	29	45	unmapped	0		0	TTCCAAAGACATCAGTCAGATGGACTCCATGTTACCCATCACCTTTGTGGACTTTTATCA	2327	0	UF_Msa_AF_102728	contig27050___1rc_nrnt	contig27050___1rc_nrnt	Unknown	
2342	29	46	unmapped	0		0	GACCCAAAGATTGTGGTTGAGTGATGCATATTGTAGAGGTTGTTGGCAGGCCAAAACCTA	2329	0	UF_Msa_CF_124826	contig18354___0	contig18354___0	Unknown	
2343	29	47	unmapped	0		0	TGAAGTCCCCGATTCCCCCCGATCAGATGACGAATCGGATGCAGAGCCTTTCTCTGACAG	2331	0	UF_Msa_AF_104894	contig03786___1rc_nrnt	contig03786___1rc_nrnt	Unknown	
2344	29	48	unmapped	0		0	ATCTGGACGCGGAGAATACAGGTGAGCTGGGTGCTGAGGATGCGATGGAGTCTCCTGTTA	2333	0	UF_Msa_CF_121816	contig23556___0rc	contig23556___0rc	Unknown	
2345	29	49	unmapped	0		0	TTCCACATGCTTGAACCAAGGATAGGCGCACGGCTTGAACGAATCAACCCCTCGGTGCTG	2335	0	UF_Msa_AF_108187	contig04117___1rc_nrnt0	contig04117___1rc_nrnt0	Unknown	
2346	29	50	unmapped	0		0	AAGAGGAGGAAAATGCAATGCACTCCTGAATCAAACTTCTACCTTGAGAGCTGCAAAGGC	2337	0	UF_Msa_CF_119253	contig01389___0rc	contig01389___0rc	Unknown	
2347	29	51	unmapped	0		0	AGAAGGAGAGCGGTTTGCGGAGCGTGCGTTGGCCACCTACACTGAGATCAGTGCTGCGCA	2339	0	UF_Msa_AF_104818	contig03527___1_nrnt0	contig03527___1_nrnt0	Unknown	
2348	29	52	unmapped	0		0	AGCCTGGTCGACCGTCTGTTTAATGGTGTCTCCCTACAGTCTAGACAGTCTCCCTCCTGC	2341	0	UF_Msa_CF_121848	contig25291___0	contig25291___0	Unknown	
2349	29	53	unmapped	0		0	CACAGAGTTTAGACAGCTGCTTTCTCTCTCCACCATCAGATCCTGTACAGCTCTACAGCC	2343	0	UF_Msa_CF_118735	contig16900___0rc	contig16900___0rc	Unknown	
2350	29	54	unmapped	0		0	CGGTCGGAGGAGTCTTTGTGTTTGTCGGTTTTTATGTGAAATGTTTATTTTAATTTTGTG	2345	0	UF_Msa_AF_106388	contig29272___1_nrnt	contig29272___1_nrnt	Unknown	
2351	29	55	unmapped	0		0	ATCTCAGAGACCACCTGCTCTCTCACATTTGCCTCAAGAACCTCCTTCTCTTACCCGACG	2347	0	UF_Msa_CF_126187	contig16411___0rc	contig16411___0rc	Unknown	
2352	29	56	unmapped	0		0	TCAGTATGACGGTGAGCTGCAAAGGGCAAAGAAATGCATGGAAACAGAAATAAAGGAGCT	2349	0	UF_Msa_CF_122281	contig11197___0	contig11197___0	Unknown	
2353	29	57	unmapped	0		0	TAGGACTGGAGAGAGCAGCGCCGTGTTCCCCTAGTTGAGCAGCAACAACTACCATTCTCC	2351	0	UF_Msa_CF_119030	contig14573___0rc	contig14573___0rc	Unknown	
2354	29	58	unmapped	0		0	GCAGTACGACCATATCACTCTACAGCTCAACATAATTCTTCACAACAGTAACTATCACAA	2353	0	UF_Msa_CF_119509	contig28334___0	contig28334___0	Unknown	
2355	29	59	unmapped	0		0	ATTGACAGACAGGACTACACACAGTGCCAAAGAGATAGGCAGGCTTGGAGAAAAATAAGG	2355	0	UF_Msa_CF_119515	contig26435___0	contig26435___0	Unknown	
2356	29	60		1028	E1A	0		1133	1	(+)E1A_r60_a104	E1A_r60_a104	E1A_r60_a104		CONTROL
2357	29	61	unmapped	0		0	TTATAATTCTGTGGACAAAACCCGGTTTACGGATAAACTTCTTCTCGTGGGGCTGTCTCG	2358	0	UF_Msa_AF_103906	LMB_S454.sd.120.C1___1_nrnt0	LMB_S454.sd.120.C1___1_nrnt0	Unknown	
2358	29	62	unmapped	0		0	GGGCCTCCTGTCTCCCCTGGAGGAGTCCAGCGCTGAGATAAGCAGAGACAGCGGCATTGT	2360	0	UF_Msa_AF_108103	contig25964___1_nr0nt1	contig25964___1_nr0nt1	Unknown	
2359	29	63	unmapped	0		0	ACAAGGGTAACAAGTACTTCAAGGCGGAAAGTATGAGAACGCCATTCAGTGCTACACAGA	2361	0	UF_Msa_CF_118547	contig07098___0rc	contig07098___0rc	Unknown	
2360	29	64	unmapped	0		0	AGTCGGACGGAGAGAAAGACGCTTGGAGAGAGATGAACAAGACCACTACCAAGTTCCCCG	2363	0	UF_Msa_CF_119208	contig23689___0rc	contig23689___0rc	Unknown	
2361	29	65	unmapped	0		0	AAATACCAAACAACAAGGTGACTGCTATGGCTAGTCTTAAAGAATGGTGTGACGCCTTCC	2365	0	UF_Msa_AF_100920	contig04071___1rc_nrnt-1	contig04071___1rc_nrnt-1	Unknown	
2362	29	66	unmapped	0		0	CCAAACAGTAACGTAGTGGCGCTACTTACAACCACAGAACTAATGCAATAGTTCATATGA	2367	0	UF_Msa_AF_108883	contig32591___1_nrnt	contig32591___1_nrnt	Unknown	
2363	29	67	unmapped	0		0	AGGTACTATTTCCTCCTGAGGTAATGCTTAGTGGGCGGGGCCCTTCCTTTGAACAGATCT	2368	0	UF_Msa_CF_120776	contig01373___0	contig01373___0	Unknown	
2364	29	68	unmapped	0		0	GTGGATCCCTCAGGGACAAACTGGGAGCCTCTTTTCTCTCCAAAATGGACAGTACAAACC	2370	0	UF_Msa_AF_100229	contig04687___1rc_nrnt0	contig04687___1rc_nrnt0	Unknown	
2365	29	69	unmapped	0		0	CAGAGGAGGGAGAGATCATAGACAGTAGTGATGAAGAGAAAGATGAAGCAAATTCTGAAG	2372	0	UF_Msa_CF_124453	contig22018___0rc	contig22018___0rc	Unknown	
2366	29	70	unmapped	0		0	TTGGTGGGGCTGCCATGCTAGGAATTGCTACATTGGCAGTGAAACGGCTGATAGAGCGCC	2374	0	UF_Msa_AF_109286	contig27459___1rc_nr0nt	contig27459___1rc_nr0nt	Unknown	
2367	29	71	unmapped	0		0	TCTCCTCCTCTCCACCTCCCACTGCCACTTTAGATGTGTCATTATGGCTCAGTACTATGG	2376	0	UF_Msa_AF_101074	contig18992___1rc_nr0nt1	contig18992___1rc_nr0nt1	Unknown	
2368	29	72	unmapped	0		0	CTTCCAGCCTTCCTTCCTCGGTATGGAATCCTGCGGAATCCACGAGACTACCTACAACAG	2378	0	UF_Msa_AF_107855	LMB_S454.sd.497.C1___1_nrnt	LMB_S454.sd.497.C1___1_nrnt	Unknown	
2369	29	73	unmapped	0		0	GTACTGGAGAGGCTTAAGTGTTCTTGGACAAAATACTTAATCTCTAGCACACTCTAGACA	2380	0	UF_Msa_CF_127626	contig29289___0	contig29289___0	Unknown	
2370	29	74	unmapped	0		0	CCGTAGGACCGAGGCCGACCCCATCGACTTGTCTTCCGCTACCATCCTACAGTCACACAG	2382	0	UF_Msa_CF_127313	contig11357___0	contig11357___0	Unknown	
2371	29	75	unmapped	0		0	TACTACAAGGACGAGTTGTTGCCAACTGTCCTCCACTACTCAATAAAGACATTGAGGAAC	2384	0	UF_Msa_AF_102942	contig28392___1rc_nrnt-1	contig28392___1rc_nrnt-1	Unknown	
2372	29	76	unmapped	0		0	TCTCAGAGGCATCAACTCTCTCAGCTCGCTGATTGAAGAGTACCAGCATCTGGATGCCAC	2386	0	UF_Msa_CF_119976	contig26721___0	contig26721___0	Unknown	
2373	29	77	unmapped	0		0	TGTCGAAGGCCAAGTCTCAGACCTTTGATCCTTTCGCCGACCTAGGAACCTGGGCTCCAA	2388	0	UF_Msa_CF_122336	contig26752___0	contig26752___0	Unknown	
2374	29	78	unmapped	0		0	TACAGTTCTGTTTGTTAGTAAGGAACCAAAGGCGAAGGAGTTGTTGACGACTCTGAAGGC	2390	0	UF_Msa_AF_107117	contig28934___1rc_nrnt0	contig28934___1rc_nrnt0	Unknown	
2375	29	79	unmapped	0		0	TCTCCCAGTCCGTCAAGATTCCTCGGGAGCCCAAGCAGGGAGAGTTTGACAAGGTCATTC	2392	0	UF_Msa_AF_102885	contig15883___1_nr0nt	contig15883___1_nr0nt	Unknown	
2376	29	80	unmapped	0		0	AACTGTTGGACAGGATACTGCAGATATCTAATGTTGCCTTACCGCTTCGGTTTAGAGTCG	2394	0	UF_Msa_CF_126063	contig21015___0rc	contig21015___0rc	Unknown	
2377	29	81	unmapped	0		0	AAGAAAAGGATCAGTTTGAAGAGGTAGCAAGCAGACTGACGGAGATTGCTGATGAAGTCC	2396	0	UF_Msa_CF_119222	contig30840___0	contig30840___0	Unknown	
2378	29	82	unmapped	0		0	GGGAGCATGTCTAGGGAGGCTACTGATTCGGAGGAGAGTGAATTTATGGCATGCAGCCCC	2398	0	UF_Msa_AF_108975	contig30895___1rc_nrnt	contig30895___1rc_nrnt	Unknown	
2379	30	1	unmapped	0		0	TCTTTGAACCCCATCACAACTTATCACCCAAAAACCTTTGGTGTTTTCAGAGCACTGCTG	2245	0	UF_Msa_CF_118953	contig28044___0	contig28044___0	Unknown	
2380	30	2	unmapped	0		0	GAAAAAGAGATGTTTATAGACAATGTTCCCTTTGGTGAAGTTTCAATGGCCCCGCCGTCC	2247	0	UF_Msa_AF_103393	contig08845___1rc_nrnt0	contig08845___1rc_nrnt0	Unknown	
2381	30	3	unmapped	0		0	AGGAATTTGGAACTAAGAGAATGTGTCACACTCAGTCTGCCAGAGCCAGAGGTATGAAAG	2249	0	UF_Msa_CF_119058	contig19230___0rc	contig19230___0rc	Unknown	
2382	30	4	unmapped	0		0	ATTATTTTCTCATCCTGGCTGTTGCTGGCGCAGCGCTAACGCGATGTGGAGGTGTGGCCA	2251	0	UF_Msa_CF_124381	contig22184___0rc	contig22184___0rc	Unknown	
2383	30	5	unmapped	0		0	GGTACCCGCACGGTGGAGACGCGGCAGGCGCAGGAGCTTGCACGAAGCTATGGGGTGCCG	2253	0	UF_Msa_AF_104868	contig04534___1_nr0nt	contig04534___1_nr0nt	Unknown	
2384	30	6	unmapped	0		0	AAGTCCTCTCTCAGCTGAACTTGACAGTTGAAACGGCCACTAGCAATGTAAAACCTCTAG	2255	0	UF_Msa_CF_119221	contig06625___0	contig06625___0	Unknown	
2385	30	7	unmapped	0		0	CTCGCACAGCCCCCTTGAAGCTGAAGCCGAAGATGGCGTCTATCACTAGGTTGTAAGCCT	2257	0	UF_Msa_AF_108344	contig20969___1_nr0nt1	contig20969___1_nr0nt1	Unknown	
2386	30	8	unmapped	0		0	TTTACCACTGTCCCTTCTGCCAGCCAGCAGTCTATAAAACCAAAAGGAGACTATGCAAGT	2259	0	UF_Msa_CF_126647	contig19948___0	contig19948___0	Unknown	
2387	30	9	unmapped	0		0	ACGACATGCTCGCCAAGGTTTGGTCAGATTTTGAGCAGAGCTTTCGGGATAAACTACTTT	2260	0	UF_Msa_CF_123591	contig07091___0rc	contig07091___0rc	Unknown	
2388	30	10	unmapped	0		0	CCAGTGATGCGGATTCTGCATATTTGTATTTCAGATGATGTAGCTAAAAACTTGATGTAA	2262	0	UF_Msa_AF_108570	contig31892___1rc_nr0nt1	contig31892___1rc_nr0nt1	Unknown	
2389	30	11	unmapped	0		0	AAGGGTTACAGCAACGAAGGCTTTCGTTTCTTTACCAACTACGAGAGCAGAAAAGGTTCT	2264	0	UF_Msa_AF_106585	contig19122___1_nrnt	contig19122___1_nrnt	Unknown	
2390	30	12	unmapped	0		0	AGAACCAACCTTGACACTCAACCAGTCAGAATCATCCAGCTGGAGGTTTCAGGGTCCAAC	2266	0	UF_Msa_CF_118104	contig02821___0rc	contig02821___0rc	Unknown	
2391	30	13	unmapped	0		0	GAGACGGACACCCCAACCCAGGAAATTTCGTCAGCAGACTACAAACAGTCGACACCACCT	2268	0	UF_Msa_CF_119568	contig17605___0rc	contig17605___0rc	Unknown	
2392	30	14	unmapped	0		0	AGGGCATCTATGCTCGTCTCCCTAAACACTACCTCAAGTCCCTCGAGCAGAAAGAACCCA	2270	0	UF_Msa_CF_122096	contig09091___0	contig09091___0	Unknown	
2393	30	15	unmapped	0		0	CCACCAGCTGGCAAATTAGCGCTGTAGCTGCTTTATTTTTGTATATTCCACCAGCTTTTG	2271	0	UF_Msa_CF_127171	contig19264___0	contig19264___0	Unknown	
2394	30	16	unmapped	0		0	GGGTACATTGTAAACGAGAGCAACTAATATCTAACTCGGCATACTTAATGGTGCCGATTT	2273	0	UF_Msa_AF_108503	contig29655___1_nr0nt	contig29655___1_nr0nt	Unknown	
2395	30	17	unmapped	0		0	ACTGATGGAGGTGCTTCCAGACATGTTCTCCAGTCTTGTCTTCGCCTCATACTCCGCGCT	2275	0	UF_Msa_CF_121670	contig22475___0rc	contig22475___0rc	Unknown	
2396	30	18	unmapped	0		0	GAACAACAAAGCCGAGAACAGGATCAGTGCCATTCGCTTCCTGGATGACGACGAGGAGGA	2277	0	UF_Msa_CF_117992	contig00483___0	contig00483___0	Unknown	
2397	30	19	unmapped	0		0	TGCTCCATCTGAGGTGTACACCTTTGGGACTCAGTACTGGTTCCTGGGCTGCTCCTACTT	2279	0	UF_Msa_AF_108882	contig26038___1_nrnt	contig26038___1_nrnt	Unknown	
2398	30	20	unmapped	0		0	TACGGTCCATGAGAAGGATGTAATCGGCATCGCCCACCACCCCCACCAGAACTCATCAGA	2281	0	UF_Msa_AF_109443	contig23656___1rc_nrnt	contig23656___1rc_nrnt	Unknown	
2399	30	21	unmapped	0		0	GTTCCTGCAGTTGTTGATACTACTGCAGCTGCTGTGGCTCCTGCTGATCCTACACCAGCT	2283	0	UF_Msa_CF_122073	contig10768___0	contig10768___0	Unknown	
2400	30	22	unmapped	0		0	GGAGGAGCTGAGAGCTGAAGACGTCTCATTCCTGCTCAACTACAAGGCTGCAGTAGAAAG	2285	0	UF_Msa_CF_126193	contig02868___0	contig02868___0	Unknown	
2401	30	23	unmapped	0		0	ATCCAAGCATCAGACCAACCACGACGAATGCAGGCCATGACAGAACCGAAACGCCACCAG	2287	0	UF_Msa_AF_102206	contig23774___1_nr0nt	contig23774___1_nr0nt	Unknown	
2402	30	24	unmapped	0		0	TCCCTGTGCTCATTCTGGCCAACAAACAGGACTTGGATTCAGCCTTGTCGGTCAGCGAGG	2289	0	UF_Msa_AF_107944	contig08325___1_nrnt0	contig08325___1_nrnt0	Unknown	
2403	30	25	unmapped	0		0	CAGCGAGCTGCACCGCATCCTGAGCTGTGAGCAGGACCACAGATCTACAGTGGCTCACAG	2291	0	UF_Msa_CF_127240	contig13141___0	contig13141___0	Unknown	
2404	30	26	unmapped	0		0	AAGTCTTCCTCTTATTGGAACCATTTTGCAGGTGCTTCAGAACCTCAGTCAGGGCAAAGA	2293	0	UF_Msa_CF_126870	contig32446___0rc	contig32446___0rc	Unknown	
2405	30	27	unmapped	0		0	TCCTCATCTCCTCTGCAGGGCGGTGGCGATGGCCCTGTGGTTCCTCTGTCTGGCTTCATA	2295	0	UF_Msa_AF_107157	contig09192___1_nr0nt1	contig09192___1_nr0nt1	Unknown	
2406	30	28	unmapped	0		0	AAGATGCCTATCCGAGCATATTGCACGATTTGCTCCGATTTTTTCGATCACTCCAGAGAT	2296	0	UF_Msa_AF_105388	contig15506___1_nr0nt	contig15506___1_nr0nt	Unknown	
2407	30	29	unmapped	0		0	TAAAAGAGAGAGTGTAAGGAGTAGCGTGGAGAAAGCAAAGACTGTGGTTGAGGAGAACTT	2298	0	UF_Msa_CF_121055	contig07835___0rc	contig07835___0rc	Unknown	
2408	30	30	unmapped	0		0	CTGTAATGAACCAAGAGAGTTAAGGCAATGTTACCACAGACTCATTTTAATAATCCTTCA	2300	0	UF_Msa_AF_100861	contig04969___1_nrnt0	contig04969___1_nrnt0	Unknown	
2409	30	31	unmapped	0		0	TAGCTTCATTAGCATGCTAACAGGTTCTGTCAGAAAGAGCCAGCTGCAAGCTATGTTCCT	2302	0	UF_Msa_CF_122022	contig07883___0rc	contig07883___0rc	Unknown	
2410	30	32	unmapped	0		0	TATCTCAAGGGACAACTGGCATAAACGCCGCAAGACCGGCGGTAAACGCAAGCCCTACCA	2304	0	UF_Msa_AF_102038	LMB_S454.772.C1___1_nr0nt1	LMB_S454.772.C1___1_nr0nt1	Unknown	
2411	30	33	unmapped	0		0	TGGTACCTGGACCGGACTCTCCTCAGCTGAGCTTCACGAAGGTGTTACAAGGAGAGTTTG	2306	0	UF_Msa_CF_127750	contig21863___0	contig21863___0	Unknown	
2412	30	34	unmapped	0		0	TCTGTATACAGTACATACTTGCGTAGACCGTGTTGGAAGCAGCATATTTAATCAGTCGCT	2308	0	UF_Msa_CF_121833	contig23070___0	contig23070___0	Unknown	
2413	30	35	unmapped	0		0	GCTCCTGTAGGAGGTCTAAGCTGTGGTTGATAGGTATGTTCTTCGTTAACTCCGTTATGT	2310	0	UF_Msa_AD_200034	LMB_Add_75	LMB_Add_75	Unknown	
2414	30	36	unmapped	0		0	GTCTGTTAGCTAAGAGGTATTTTTGGCAAAAATAGCTTTTAGACTGTCACAAGACTTGGA	2312	0	UF_Msa_CF_120445	contig24252___0	contig24252___0	Unknown	
2415	30	37	unmapped	0		0	CTTCAGACAAACCTAAACTACAGCAAGTTGATGGCAAAACTCAAGTGAGGGCAAATACAA	2314	0	UF_Msa_CF_117749	contig02853___0rc	contig02853___0rc	Unknown	
2416	30	38	unmapped	0		0	AGTCTGACGGTCCTGGGCGGCTCCTTGCTGTGCTGTTCCTGCTCTAAAGACGACATGCGG	2316	0	UF_Msa_AF_101238	contig15690___1_nrnt	contig15690___1_nrnt	Unknown	
2417	30	39	unmapped	0		0	CTATGACCTGGCACCGTCCTCATCGTCGTCTCTCTGCATTTGTTCTATGAGTCTCTGTCG	2318	0	UF_Msa_CF_126160	contig24444___0rc	contig24444___0rc	Unknown	
2418	30	40		1028	E1A	0		571	1	(+)E1A_r60_a107	E1A_r60_a107	E1A_r60_a107		CONTROL
2419	30	41	unmapped	0		0	GCTTCTACCCAGAGGCACGCAACAAGCTTGTGCGTGAGTTTGAAGACATGGAGGTGAAAA	2321	0	UF_Msa_AF_107774	contig16571___1rc_nrnt	contig16571___1rc_nrnt	Unknown	
2420	30	42	unmapped	0		0	GGATTCAGAATTGGATGATATTTGATTCAAAGATGCTGCGTGTCCCTCGGTCCAACAAGA	2323	0	UF_Msa_CF_126776	contig24619___0rc	contig24619___0rc	Unknown	
2421	30	43	unmapped	0		0	AAAGTAGGAGCACTTTGCTTGATGCTGGAACATCGTTTCTATGGAAAGAGTCACCCGACT	2325	0	UF_Msa_AF_105738	contig14654___1rc_nrnt-1	contig14654___1rc_nrnt-1	Unknown	
2422	30	44		1028	E1A	0		42	1	(+)E1A_r60_n11	E1A_r60_n11	E1A_r60_n11		CONTROL
2423	30	45	unmapped	0		0	TATAGCTATGGATGGAGTTAAAAATGCAAAGAATGAACTGGTCAATAAAACTCCCCTCTT	2328	0	UF_Msa_AF_102059	contig23770___1_nr0nt	contig23770___1_nr0nt	Unknown	
2424	30	46	unmapped	0		0	GAATCTGGCTGAGTCTCCTGCCGTGAAGGAGGTGCTTAAGGATCAGGATGGCAGAAAAGG	2330	0	UF_Msa_AF_103478	contig30856___1_nrnt	contig30856___1_nrnt	Unknown	
2425	30	47	unmapped	0		0	CAAATGGCTAATTGAATTGCATAAACAATGCATTGACATTGCCTCACACTTCTGCTCAGT	2332	0	UF_Msa_CF_124562	contig22089___0rc	contig22089___0rc	Unknown	
2426	30	48	unmapped	0		0	GTGAGAGCGTCTTTGATCATTAAAACAGTCGTTAAGTAAACACTTGTTATAGTTGCTGAT	2334	0	UF_Msa_AF_106169	contig14957___1_nrnt	contig14957___1_nrnt	Unknown	
2427	30	49	unmapped	0		0	TTGTGTCGTGGCTGGATATTTACTCGTATTACTCTTGGCTGGCTGCAAAGCAAGGATACA	2336	0	UF_Msa_CF_126592	contig07846___0	contig07846___0	Unknown	
2428	30	50	unmapped	0		0	TCAGCAGTTCCGTAAGGCTGCCATAGAAAAGGAAGAACGAGAAAGGCACTAGAAAGAAAA	2338	0	UF_Msa_CF_121226	contig26541___0rc	contig26541___0rc	Unknown	
2429	30	51	unmapped	0		0	AGAATATGAGAAAGCCCTGAAGTACATCCGGACTCTTCTAAAGAACGAGCCGGGCAATAA	2340	0	UF_Msa_AF_105108	contig04435___1rc_nrnt	contig04435___1rc_nrnt	Unknown	
2430	30	52	unmapped	0		0	AGAAGGGCCAGTCCATCGACGACATTATGCCCGCCCAGAAGTAAACCATCCCGACATCTC	2342	0	UF_Msa_AF_101242	LMB_S454.sd.272.C1___1rc_nrnt	LMB_S454.sd.272.C1___1rc_nrnt	Unknown	
2431	30	53	unmapped	0		0	TCATCATGACAATCCTGTGTTTGAGATGGAGTTCCTGCCATCTGGGAAGCCTGAATCAAA	2344	0	UF_Msa_AF_102267	contig20079___1rc_nrnt	contig20079___1rc_nrnt	Unknown	
2432	30	54	unmapped	0		0	TTCTGCTCAACAGAGAATCTGGTCATGAAGTCATGAAGGCATTTCTTTCTCCAGAATACT	2346	0	UF_Msa_CF_125531	contig01609___0rc	contig01609___0rc	Unknown	
2433	30	55	unmapped	0		0	CAGACTTTGCCAAATCCAGTCTGGTGAACAGGAAAGAAACAAAGCAGATCTACAGCTTCA	2348	0	UF_Msa_AF_100803	contig13654___1_nrnt0	contig13654___1_nrnt0	Unknown	
2434	30	56	unmapped	0		0	AAACACACTAGCTTTCTGTGGTTCCATAGTAACAGCCATGTGTCGTTCAGTGTGTTTTGT	2350	0	UF_Msa_CF_123750	LMB_S454.sd.529.C1___0rc	LMB_S454.sd.529.C1___0rc	Unknown	
2435	30	57	unmapped	0		0	ACACAGGCAAGGAAAAACTTCCTTTTAAGAGGCAGAAACCTCGAGTAGAACCATGGCTCA	2352	0	UF_Msa_AF_107759	LMB_S454.sd.192.C2___1_nr0nt	LMB_S454.sd.192.C2___1_nr0nt	Unknown	
2436	30	58	unmapped	0		0	GGGTTCTCAACACATCAAGCAACAGTGCTGGGAGTGTGGGAAAAACATCTGCATTCTCAT	2354	0	UF_Msa_CF_117842	contig13060___0rc	contig13060___0rc	Unknown	
2437	30	59	unmapped	0		0	ACTCTCACGTGGGACGAGCTGCTGCTGCTGCTGCTTCGTCTTCTTCTTACTTACCCCCGA	2356	0	UF_Msa_CF_127426	contig12114___0rc	contig12114___0rc	Unknown	
2438	30	60	unmapped	0		0	TGTGGATTCTGTCTGGCAGCTGGACAGAAGTTTCTCTAGTCAGAAATTTGTGTTCAGCCA	2357	0	UF_Msa_CF_123271	contig19304___0	contig19304___0	Unknown	
2439	30	61	unmapped	0		0	GTGAGCGAACATGTCCTCATGTCTAGTTAGGACAACCAATATACACTCTCTCCTCCCTTT	2359	0	UF_Msa_CF_126461	contig28359___0rc	contig28359___0rc	Unknown	
2440	30	62		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
2441	30	63		0		0		2362	1	RC10	RC10	RC10		CONTROL
2442	30	64	unmapped	0		0	CAAGATGGAACAGTCTTTCTAAAAGTTATTTCTATGCTGAAAAAGGAATCAGTCTCCTGT	2364	0	UF_Msa_CF_124955	contig30402___0rc	contig30402___0rc	Unknown	
2443	30	65	unmapped	0		0	TGATGTGCGTCGTCCTCTGCGTCGTCTACCGGACAAGCAGCAAACCCACAGAGAAGAAGA	2366	0	UF_Msa_CF_125693	contig13118___0rc	contig13118___0rc	Unknown	
2444	30	66		0		0		896	1	RC3	RC3	RC3		CONTROL
2445	30	67	unmapped	0		0	GGCCAGATGGCCATTTTGTTTTGTCCACATCATGTTTCTCATTGTATAAGTTTTCTTATT	2369	0	UF_Msa_AF_104179	contig29307___1_nrnt	contig29307___1_nrnt	Unknown	
2446	30	68	unmapped	0		0	GGTACTGCTCACCTTCTTTATGTGCCGCATCGCCCTCTTCCCCTACATGTACTGGGTGTA	2371	0	UF_Msa_AF_101064	contig04209___1rc_nrnt0	contig04209___1rc_nrnt0	Unknown	
2447	30	69	unmapped	0		0	AGGGAGAGACTCTTCTAACAGCCAATGACCAGCGTTCCCTCAACATCCCGAAACAAAGGG	2373	0	UF_Msa_AF_101538	contig03683___1_nrnt0	contig03683___1_nrnt0	Unknown	
2448	30	70	unmapped	0		0	TGTCCACCAGCTTGGTGAAGGGACTGGTGGAGTTCCAGCTGCACCACTTCCTATGCAGTT	2375	0	UF_Msa_CF_126516	contig11521___0rc	contig11521___0rc	Unknown	
2449	30	71	unmapped	0		0	AAGGCCACTCCTACAGGACAATAAGGACGAGGAGGCACGTAAAACCACTGACTGACAGCG	2377	0	UF_Msa_CF_119473	contig24871___0	contig24871___0	Unknown	
2450	30	72	unmapped	0		0	GTGACCTTCACATGGTCCAACGCATCGGCCTGGTTGAGGCTCTGTGTGGTTTCCAGTTGA	2379	0	UF_Msa_CF_121728	contig07455___0	contig07455___0	Unknown	
2451	30	73	unmapped	0		0	TTTCGAATTAGTCAACCGTAGTTTACATCACGACAAATGTGGGCAACGGATGAGAAGGCG	2381	0	UF_Msa_AD_200358	DQ451323_rc	DQ451323_rc	Unknown	
2452	30	74	unmapped	0		0	TCGTTCAACAAGAGAAATAGAGTTGGGCATTGAGTATGGACCTCCCGTGATGAACATTGG	2383	0	UF_Msa_AF_109126	contig32793___1_nrnt	contig32793___1_nrnt	Unknown	
2453	30	75	unmapped	0		0	CAGAGTCACCACGCTCTGCACGGAAACGAGGTACAGACAAAGATGCAACACAACTAAAAA	2385	0	UF_Msa_CF_119684	contig14752___0	contig14752___0	Unknown	
2454	30	76	unmapped	0		0	CTGTGGGGGAGTTCACTTCTTATTAGCCCAGTCTTAGAGCAAGGGGCAGTAGAGCTGGCC	2387	0	UF_Msa_AF_103239	contig03024___1_nr1nt0	contig03024___1_nr1nt0	Unknown	
2455	30	77	unmapped	0		0	CTTCCACAGAAGCTCTCCCCGAAGCAACATGGAGCTCTTCTTCTGCTGCCACCTCCAACT	2389	0	UF_Msa_CF_119652	contig13795___0rc	contig13795___0rc	Unknown	
2456	30	78	unmapped	0		0	ATGGGTGCATGTAAAGCACAGCTGTGGTTTGATGTATTAGGAGGACCAATAAATGTATTT	2391	0	UF_Msa_AF_105474	contig31972___1_nrnt	contig31972___1_nrnt	Unknown	
2457	30	79	unmapped	0		0	GAAAAAATGAGCAGAAAAAGTGCACCGGAAGATCATCGTTACTCTGAGGATGAAGAGCAA	2393	0	UF_Msa_CF_123913	contig27875___0	contig27875___0	Unknown	
2458	30	80	unmapped	0		0	CAAGATGATGAATAGATGTTCACCATGTCCTGTTATGACCAATAAAACGTACCAACTTTT	2395	0	UF_Msa_AF_107957	contig32614___1_nr0nt	contig32614___1_nr0nt	Unknown	
2459	30	81	unmapped	0		0	GGAAGGCTGCTGCTGGATGATGAGGTCATTTATGACGACATTATCAACTTGAAAGATATG	2397	0	UF_Msa_CF_118411	LMB_S454.781.C1___0	LMB_S454.781.C1___0	Unknown	
2460	30	82	unmapped	0		0	CTACGTAGAGAGAGACCACTTTTTAACCCTGTTGCTCCTTTAAAAACAGATGACTGACAG	2399	0	UF_Msa_AF_108347	contig24620___1_nrnt	contig24620___1_nrnt	Unknown	
2461	31	1	unmapped	0		0	GACGCGAGGCATTCGAGCTGTTGGCCAGTCAGATGGACTCTGTGGACTTGTCACTACTGG	2400	0	UF_Msa_CF_122921	contig09350___0	contig09350___0	Unknown	
2462	31	2	unmapped	0		0	AGTGCAAAATTTCTCCACTTTGTCCTTTGGTATGTGCATAATCAAGGTGGAATGGAACGC	2402	0	UF_Msa_AD_200274	LMB_Add_162	LMB_Add_162	Unknown	
2463	31	3	unmapped	0		0	TTTTGCTCTCACTTATCAAATCAACACTGACTTCCCGGAGCCTTTGGGCAACAACATGGA	2404	0	UF_Msa_CF_117899	contig14157___0rc	contig14157___0rc	Unknown	
2464	31	4	unmapped	0		0	TGAAGTGTTCCTAATCAAGACCTATAAGGCAGGACGCCTGAATATCACCAAATCAGGACC	2406	0	UF_Msa_CF_123357	contig21292___0	contig21292___0	Unknown	
2465	31	5	unmapped	0		0	CAAGTCTTCAGAAAATCAGAAGAGCAAGAGTAATGGAGCTGCGAGCGGTGAATTCATCAG	2408	0	UF_Msa_CF_119593	contig05904___0rc	contig05904___0rc	Unknown	
2466	31	6	unmapped	0		0	AGACCTGTTAGTCTGCCTTCAAAATGTCCACCTCCACTCCATTTATTATCCTAAATTAGA	2410	0	UF_Msa_AF_109329	contig21166___1_nr0nt1	contig21166___1_nr0nt1	Unknown	
2467	31	7		1028	E1A	0		418	1	(+)E1A_r60_a135	E1A_r60_a135	E1A_r60_a135		CONTROL
2468	31	8	unmapped	0		0	GTATCTTTGTGACTACTACTTTGATGGCAAAGGCAAGGCCATCCGACCAATGATAGTTGT	2413	0	UF_Msa_AF_107502	contig32201___1rc_nrnt-1	contig32201___1rc_nrnt-1	Unknown	
2469	31	9	unmapped	0		0	AGGTGCAGGATGAGTGTCACGGAGCGTCACAGGCTCTGGCAGCACTGGAGTTTGTTGCCC	2415	0	UF_Msa_CF_124234	contig32682___0rc	contig32682___0rc	Unknown	
2470	31	10	unmapped	0		0	AATCGGCTGTGTAGATCATCGCCGCCTCCGTTGACTCACACTTCTCCCATTTCGCGTGGA	2417	0	UF_Msa_AF_102222	contig21109___1rc_nrnt	contig21109___1rc_nrnt	Unknown	
2471	31	11	unmapped	0		0	TCAGCGGGCAAACAGCTGGTTATTCATTGTCTTCATAATCAGTGGGTTGCTTTCAAACTT	2418	0	UF_Msa_CF_119721	contig02193___0	contig02193___0	Unknown	
2472	31	12	unmapped	0		0	AAACAGAACAAAAGCTAACAAACCAAAAAGGTGGGCACCTCTAGAAGTGAGCCCCAGAAG	2420	0	UF_Msa_CF_126379	contig22129___0rc	contig22129___0rc	Unknown	
2473	31	13	unmapped	0		0	GTCTTTCGCCGCTCCGCAAGTGTCAGTTCGCTTCTGTGCGCAGCAGACGTCACTCCCGAA	2422	0	UF_Msa_CF_120013	contig23394___0rc	contig23394___0rc	Unknown	
2474	31	14	unmapped	0		0	AGCTACAGACAGGAAGCTCATACTGGTGGAGGATTTCCCAAACCAGTTCTACAGGCTGCC	2424	0	UF_Msa_AF_110144	contig09125___1_nrnt0	contig09125___1_nrnt0	Unknown	
2475	31	15	unmapped	0		0	CAAGACCATAAGCACATCCGCCTATCCATGGCCCAGCCACTGTGGTTTTCTGTGCAGTAT	2426	0	UF_Msa_CF_117750	contig12149___0	contig12149___0	Unknown	
2476	31	16	unmapped	0		0	AATCATGGCGCCGACTACATGGAGGAGGTAGCCTGACCGTCCCATCACCCAGCACGGTTC	2428	0	UF_Msa_CF_117866	contig16093___0	contig16093___0	Unknown	
2477	31	17	unmapped	0		0	TCAAATCCCAAACCCAGACGGTTCCTTCCCTGCCGATGTTCCTCAGCCAGACTCTGCTGC	2430	0	UF_Msa_CF_123726	contig03610___0rc	contig03610___0rc	Unknown	
2478	31	18	unmapped	0		0	AAGAGGGAGGCGCAGGTCGGCTGGGTGACGGACATCATCAGGATGAAGTACGGCTCTGAC	2432	0	UF_Msa_AF_105235	contig10278___1_nr0nt1	contig10278___1_nr0nt1	Unknown	
2479	31	19	unmapped	0		0	TATATTCACAGAATATACACGTGCTTGACTGAACACTTGAAACACGGTCGCTCTGGACGC	2434	0	UF_Msa_CF_119495	contig27950___0	contig27950___0	Unknown	
2480	31	20	unmapped	0		0	GAGGAAGCACAGAAAAATCAAGGGGTGGTTGGAGATCGAGAGACAGAATTGTTGTCATTT	2436	0	UF_Msa_CF_123129	contig12278___0rc	contig12278___0rc	Unknown	
2481	31	21	unmapped	0		0	TCTTACTGGACAGATTCAGGCACTACAGAAACAGCTCCAGCAGACCAGCGTAGATTTTCG	2438	0	UF_Msa_CF_121713	contig15724___0	contig15724___0	Unknown	
2482	31	22	unmapped	0		0	GGATATAAGATATTTGGCATTCTTCATTATGGCATTGAAAGTGATGGACACTGCCAGTGG	2440	0	UF_Msa_AF_103431	contig13365___1_nr0nt1	contig13365___1_nr0nt1	Unknown	
2483	31	23	unmapped	0		0	GACTGAGGGAGGAAAGCTGAAAAGCGCCTCTCTGAATGGATCATACTCTTATCAGCTTCC	2442	0	UF_Msa_CF_122460	contig01775___0rc	contig01775___0rc	Unknown	
2484	31	24	unmapped	0		0	TGGCGTTGTGACTTGAAAAAGGGGGTTACCAGGGGACACCCGGAAGCGAGAGAAATATCG	2444	0	UF_Msa_CF_121672	contig24761___0	contig24761___0	Unknown	
2485	31	25	unmapped	0		0	AAGCTGTGGTCAAGGCATGGAGAGAGCCAACTGTAAATTCATTACATGGTCTCATTTCAA	2445	0	UF_Msa_CF_126086	contig25789___0	contig25789___0	Unknown	
2486	31	26	unmapped	0		0	TAAAAATGAAGTAAAAGCTGGCCTGGGCATTTGTGTCCCACCCAATGAGTGGATGAGACT	2447	0	UF_Msa_AF_100241	contig04138___1_nr0nt1	contig04138___1_nr0nt1	Unknown	
2487	31	27	unmapped	0		0	TCGTTCTTCCGGAAAACGCAGAGAAAGAACTGGAAGAGACAGAAACAGAAACAGGGTTCA	2449	0	UF_Msa_AF_109683	contig32675___1rc_nrnt	contig32675___1rc_nrnt	Unknown	
2488	31	28	unmapped	0		0	CCTGATTCTCATTGAGAGCAGGATCCACAGGCTGGCCCGTTACTACAAGACCAAGAGAGT	2451	0	UF_Msa_AF_101186	LMB_S454.sd.283.C1___1rc_nrnt-1	LMB_S454.sd.283.C1___1rc_nrnt-1	Unknown	
2489	31	29	unmapped	0		0	TGGATGCAGGACTTTGAGGTTTTCCACGATGCTCTGAACCAGGAAACGTCATATGTGAGC	2453	0	UF_Msa_AF_106574	contig10785___1rc_nrnt	contig10785___1rc_nrnt	Unknown	
2490	31	30	unmapped	0		0	TACTATCAATGGGAGCTGGTGAAGCAGCCAACTTCGCAGCATATGCCTTCGCTCCTGCAA	2455	0	UF_Msa_AF_108700	contig21698___1rc_nr0nt1	contig21698___1rc_nr0nt1	Unknown	
2491	31	31	unmapped	0		0	AATGCTCCTGTACATTTCAGGAAGGGGTATCCATTGGCCAGAGAACCATCTGCATTAAGA	2457	0	UF_Msa_AF_103796	contig00179___1_nr0nt	contig00179___1_nr0nt	Unknown	
2492	31	32	unmapped	0		0	AATAATGCAGCCACCGTTTCTCCTAGCTGTCAGGAGGAAAAGCTCAAAATCCACATCACT	2459	0	UF_Msa_CF_123038	contig02037___0rc	contig02037___0rc	Unknown	
2493	31	33	unmapped	0		0	TGAGGAGCCTGGGGGCCCTGCTGAGGACCCACTGAGGCCCCCGCCCGTCTCTTCCTGTCA	2461	0	UF_Msa_CF_120902	contig04407___0	contig04407___0	Unknown	
2494	31	34	unmapped	0		0	ATGTACGAGCGGGTGTCCAGAGCCTTGTCGGAGCTCGGATATGAGAGGACCCCGTCCCAG	2463	0	UF_Msa_AF_108773	contig17392___1rc_nrnt	contig17392___1rc_nrnt	Unknown	
2495	31	35	unmapped	0		0	CAGTGCCATCCCCATCAGTGACCTGCTCGACCAAGCCTGTCAGCGCTCTGACACACTGCA	2465	0	UF_Msa_AF_100435	contig22323___1rc_nrnt	contig22323___1rc_nrnt	Unknown	
2496	31	36	unmapped	0		0	CTTTCTGTCCAAAGTACGGCATCATTGTTGCTGCTGCCGCCATCTTGTCTCTGTTAGTAT	2467	0	UF_Msa_CF_120061	contig07937___0rc	contig07937___0rc	Unknown	
2497	31	37	unmapped	0		0	AGCTGAGAAAGATTAAAGGAAACAGAAAGGAAACAAGCAAAGGCAGGAGAATTCATCCGT	2469	0	UF_Msa_CF_124781	contig24139___0	contig24139___0	Unknown	
2498	31	38	unmapped	0		0	ATGTGGAGAGCCCAGATGTCATCCTGATTAAAGTATGAAGATGACGTTGGAGGATGTGAG	2471	0	UF_Msa_CF_118374	contig27082___0rc	contig27082___0rc	Unknown	
2499	31	39	unmapped	0		0	AGAACAGATTGGCTCCAACTCATCCAGTTTACAATATTTGTCCAGAGAAGGTGGCTCAGG	2473	0	UF_Msa_AF_102627	contig28068___1_nrnt	contig28068___1_nrnt	Unknown	
2500	31	40	unmapped	0		0	TCATGCCCTGGATACACTGGGGAGCCGGGCTGCTCGCAAACAGATTGCTATGATCAAGGT	2475	0	UF_Msa_AF_109937	contig14637___1rc_nrnt0	contig14637___1rc_nrnt0	Unknown	
2501	31	41	unmapped	0		0	TGACTGAGGAGAAAGGGTGGACAACCTGCTTCACCTGGAGCTATTGTTATACTAAGACAA	2476	0	UF_Msa_AF_106173	contig24375___1rc_nr0nt	contig24375___1rc_nr0nt	Unknown	
2502	31	42	unmapped	0		0	TATTTGTCCCAAGGCAGACTTTGTGAAAGCTAGAAGTTTGAGGGGCATTGGCATGTGGAA	2478	0	UF_Msa_AF_105987	contig27966___1_nr1nt0	contig27966___1_nr1nt0	Unknown	
2503	31	43	unmapped	0		0	CAAAAAAGCCCAGAACGCAAATGGAGCCGAGCAAAAAGTACTTCCAAATCCAAAGACCGA	2480	0	UF_Msa_CF_119119	contig31211___0	contig31211___0	Unknown	
2504	31	44	unmapped	0		0	ATGTGGGGATATGACTCGCCGTGCCCAGGAGAAAGTTTGTGAAGGGACTGTGAGCGAGCT	2482	0	UF_Msa_CF_126267	contig20747___0	contig20747___0	Unknown	
2505	31	45	unmapped	0		0	ACAGCGCATGGACACGCCAGCCATTTTGGATTTAAAATGGTGCCACGTGCCGGTGTCAGG	2484	0	UF_Msa_AF_106871	contig09615___1rc_nrnt0	contig09615___1rc_nrnt0	Unknown	
2506	31	46	unmapped	0		0	ATACTACAGTCTGTACAGCCGAGCAAACCACGCACGCAGCCTACCATACAGCTTCCTGTA	2486	0	UF_Msa_CF_122224	contig24071___0	contig24071___0	Unknown	
2507	31	47	unmapped	0		0	GAAGAGACACAGCAACAGCTTCACCTGTAGAGTCCAACAGAAGGACATCAACCAGACCAG	2488	0	UF_Msa_CF_126435	contig15517___0	contig15517___0	Unknown	
2508	31	48	unmapped	0		0	TTCCATTATGTTGATTCTGCGCAGGTGTCACTGCCTGAATGTGATCGTAGCTAACCAGTA	2490	0	UF_Msa_CF_118389	contig03254___0	contig03254___0	Unknown	
2509	31	49	unmapped	0		0	TGGAGACGGTCTATCTCGAAAGAAACCCTCTACAGAAGGATCCACAATACCGGCGGAAGA	2492	0	UF_Msa_AF_100118	contig03263___1_nrnt	contig03263___1_nrnt	Unknown	
2510	31	50	unmapped	0		0	TTTTGACCAATTGCTTCAGCCTACATTTCCCAATAAACATCCTGCCTGGAAACAACTCAA	2494	0	UF_Msa_CF_119028	contig30755___0rc	contig30755___0rc	Unknown	
2511	31	51	unmapped	0		0	CCATGGGAAAAGACTACACAATTCTGGACTGCATTTACAGTGAGGTGGACAGAACATACT	2496	0	UF_Msa_AF_108766	contig25461___1rc_nrnt	contig25461___1rc_nrnt	Unknown	
2512	31	52	unmapped	0		0	GAGGAGCAGACGGAGGTGCAGCAACAGACTGAACAGGAGCCGCAGTTTGAGGATTCACAG	2498	0	UF_Msa_CF_120667	contig03545___0	contig03545___0	Unknown	
2513	31	53	unmapped	0		0	ACCTTTGCTAGCAAAGTGGCTGCCATACAGGACCAGCACGCTGATGCGTCCGTTGGTAAC	2500	0	UF_Msa_AF_104182	contig16492___1_nr0nt	contig16492___1_nr0nt	Unknown	
2514	31	54	unmapped	0		0	GGAGTGCAAAGACCAATCTGTGTCCTTCTTTAAGACATTTGTGAAGGAAAAGGAGAAGCG	2502	0	UF_Msa_CF_126105	contig11258___0	contig11258___0	Unknown	
2515	31	55	unmapped	0		0	TTAACTTGGTTCCTGTCACAACGTCACAGAGCAACACCCAGCTAGAAGTTCCTATCTTGT	2504	0	UF_Msa_CF_123188	contig02697___0rc	contig02697___0rc	Unknown	
2516	31	56	unmapped	0		0	TAAAGTCAACTCCCTAGAAAGAGATGATAACTGAACTGGAGGAGAGGGTGCAAAAGAGTG	2506	0	UF_Msa_CF_121953	contig15960___0rc	contig15960___0rc	Unknown	
2517	31	57	unmapped	0		0	TTTAAAGGTCGCCTCTGGTGCCGCGGCGACACCTGGCTGTCTATCTGTCTTTTTCTGTGG	2508	0	UF_Msa_CF_118455	contig28136___0rc	contig28136___0rc	Unknown	
2518	31	58	unmapped	0		0	GCCGGGTATGACCGAGGCGGATGATGATGCTGAAACTGTCATCATACAGATCCATTCAAA	2510	0	UF_Msa_AF_108160	contig11106___1_nrnt0	contig11106___1_nrnt0	Unknown	
2519	31	59	unmapped	0		0	CAGGACTCATGCTAGAACAAGTTACAGGTGACAAACAACAAGACGGTCTCCCTTTTCACA	2512	0	UF_Msa_CF_126306	contig05942___0	contig05942___0	Unknown	
2520	31	60	unmapped	0		0	TGGCTGGAGAAGAACACTCCAGAGCTGTCTGCCGGGGAGGACCCAGAGATTCTTGATGTA	2514	0	UF_Msa_AF_108708	contig06262___1_nrnt	contig06262___1_nrnt	Unknown	
2521	31	61	unmapped	0		0	ATAGAAAGTACAACGTTCAGGAAGTAGTAAAAGAGGACACGCCAAAGCTTGATGTGGCCA	2516	0	UF_Msa_AF_100568	contig32680___1_nrnt0	contig32680___1_nrnt0	Unknown	
2522	31	62	unmapped	0		0	ACATCAACACCAAACCCAAGAAACACAATAAGCTGAGTTTCAAGGAGCTGATCGAGCCGT	2518	0	UF_Msa_AF_107443	LMB_S454.sd.458.C1___1_nrnt	LMB_S454.sd.458.C1___1_nrnt	Unknown	
2523	31	63	unmapped	0		0	ACTATGCCTACCAGAACCTGGACGTCGATCACATCAACACCCTCAAAGGCCTCGTGGACA	2520	0	UF_Msa_CF_118342	contig17026___0	contig17026___0	Unknown	
2524	31	64	unmapped	0		0	GTCACACTGAGGGAGAAAAGAGGGATATTTAGAGACTGTAGGGAGAGCAAAATCAAAATC	2522	0	UF_Msa_AF_110206	contig29848___1_nrnt	contig29848___1_nrnt	Unknown	
2525	31	65	unmapped	0		0	AATCGTCTTCTCATCTTGAGCCATGCTTGAATGGAGGTGACCTTAGTTATTATAACATTG	2524	0	UF_Msa_AF_108303	contig15059___1_nr0nt	contig15059___1_nr0nt	Unknown	
2526	31	66	unmapped	0		0	CGGAGATCAGTGTGGTTCCTCCAAATTTTCCAGTTGACACATCGAAGCTACGCATTGAAA	2526	0	UF_Msa_AF_105902	contig06506___1rc_nrnt0	contig06506___1rc_nrnt0	Unknown	
2527	31	67	unmapped	0		0	AATGGTAGCTGCTTGTTTCTTAGAGCCCAGCACAGTCAATCTTCAGCTCAAAAAGAAAAG	2528	0	UF_Msa_CF_124395	contig19492___0rc	contig19492___0rc	Unknown	
2528	31	68	unmapped	0		0	CATTGGGAGAGAGATTCGGGATGACAAGGTCAAGTTGTCCTTCTCAATGAAAGCTGTCAA	2530	0	UF_Msa_AF_101553	contig06371___1_nr1nt0	contig06371___1_nr1nt0	Unknown	
2529	31	69	unmapped	0		0	TTGAAGAACATGTGACCAAGAATCACCCGCAGGTTGATCTGATCGTAGGTTTAGATGCTC	2532	0	UF_Msa_AF_105852	contig32058___1rc_nr1nt0	contig32058___1rc_nr1nt0	Unknown	
2530	31	70	unmapped	0		0	GCTTCACGACACTAACTCCACTTTACTACAGACTGAGAGAAAGACGAATGGAAGCTATCC	2534	0	UF_Msa_AF_109550	contig05057___1_nr0nt	contig05057___1_nr0nt	Unknown	
2531	31	71	unmapped	0		0	TAATAATCACTTCTGTATTGTGACAGGCAATACCTCTCACTGCATGCTGACCAACCCCGA	2536	0	UF_Msa_AF_108192	contig16634___1rc_nr0nt	contig16634___1rc_nr0nt	Unknown	
2532	31	72	unmapped	0		0	CAGAAAGTAGATGACGACAGGAAGCATGAGATCGAAGCTGCCATTGTTCGCATCATGAAG	2538	0	UF_Msa_AF_109061	contig09616___1rc_nrnt	contig09616___1rc_nrnt	Unknown	
2533	31	73	unmapped	0		0	TTAAAGAACTGGCTCATGAAATGTGGAAACTCCATCTGAAAGAGGACTTGGAGTCGCCCA	2540	0	UF_Msa_CF_121870	contig01172___0	contig01172___0	Unknown	
2534	31	74	unmapped	0		0	GATTTCACAACGAATTGTCATATTTTCCCCAGCGACCTCCAGTGTGTTTCCATGACCCTT	2542	0	UF_Msa_CF_127399	contig21521___0rc	contig21521___0rc	Unknown	
2535	31	75	unmapped	0		0	TACAAGTGTCTTTCCTGGCTGTGCTGCCCACACAAGATGGCACCCAAGGCTCGCTACATG	2544	0	UF_Msa_CF_119297	contig21759___0rc	contig21759___0rc	Unknown	
2536	31	76		1028	E1A	0		1133	1	(+)E1A_r60_a104	E1A_r60_a104	E1A_r60_a104		CONTROL
2537	31	77	unmapped	0		0	ACAAGCCTCCTGTATGTTTAGACAGTGACACCACATTGACACAGTATGAAACCACTCTCC	2547	0	UF_Msa_CF_125691	contig10714___0	contig10714___0	Unknown	
2538	31	78	unmapped	0		0	AATACCTGATGTTCAGTTACAACATCATCTTCTGGCTGGCTGGAGCTGCCTTCATTTCAG	2549	0	UF_Msa_AF_102050	contig13046___1rc_nrnt	contig13046___1rc_nrnt	Unknown	
2539	31	79	unmapped	0		0	TTGGCTGTGCCATCAGACGCAGACAACCCTGCTGTGTGATTAAGGAGACCCCGTAAGGAG	2551	0	UF_Msa_CF_127160	contig08892___0	contig08892___0	Unknown	
2540	31	80	unmapped	0		0	TCTAGCCATCTTCATCGGATTCTTCCTAGGGAAGTTCATCTTGTAGACTGGGAGATGCAT	2553	0	UF_Msa_AF_103148	contig02456___1_nrnt	contig02456___1_nrnt	Unknown	
2541	31	81	unmapped	0		0	TCAGATCAAGAGCATGGTGAACCAGCTGGGGACCAGACAGGACACCAGTGAACTCCAGGA	2555	0	UF_Msa_AF_107187	contig20041___1_nrnt	contig20041___1_nrnt	Unknown	
2542	31	82	unmapped	0		0	AATGTCCATAATCACCACACATCTACAATACCAGCAGGAGGCCATCCAGAAGAATGTGGA	2557	0	UF_Msa_AF_103035	contig19292___1rc_nrnt-1	contig19292___1rc_nrnt-1	Unknown	
2543	32	1	unmapped	0		0	TTTATGGTCGGCTACAATGGCTCTAAGATCTTCTGTCTTCACGTCTACTCCATGTCTGCT	2401	0	UF_Msa_AF_108068	contig06405___1rc_nrnt	contig06405___1rc_nrnt	Unknown	
2544	32	2	unmapped	0		0	CACAAGACCTTTTGCCAGAGGCGAAATTTCAATCCAAATAACAACGCGTTCACTGCTGTC	2403	0	UF_Msa_CF_127701	contig04039___0rc	contig04039___0rc	Unknown	
2545	32	3	unmapped	0		0	CTGAAGCAGACTGCAGGAGAGGACAATCCCATCTTTACTCCTGCTGATTCTGAGTACGAC	2405	0	UF_Msa_CF_122883	contig06815___0rc	contig06815___0rc	Unknown	
2546	32	4	unmapped	0		0	TGTTGCGGTATGACGACATACCCGAAACCCGTAAATTCTATTTATTTATCCATTTGTGAT	2407	0	UF_Msa_CF_124986	contig17232___0rc	contig17232___0rc	Unknown	
2547	32	5	unmapped	0		0	ACTTCTGAACCAGTACAGAGACATCAGTCCCCAACCAGACATTGATGGGTTATACATCCT	2409	0	UF_Msa_CF_123677	contig29008___0rc	contig29008___0rc	Unknown	
2548	32	6	unmapped	0		0	GCGATGGCCAGAGCCAACCTGCTGATCTTAGCACCGGGTGCATTAGTTTGCCATAAAGAA	2411	0	UF_Msa_CF_126238	contig24564___0rc	contig24564___0rc	Unknown	
2549	32	7	unmapped	0		0	CATGTTAGTCATTAAGGGGAAAATGGAACTGGAGGAAACGATTCACGTCTGGAAGCAGAA	2412	0	UF_Msa_AF_108744	contig05465___1rc_nrnt-1	contig05465___1rc_nrnt-1	Unknown	
2550	32	8	unmapped	0		0	GAGAGCAGACACACAAGACTCTTCAAGCATCGTGAAAGTCCCTCGGCCCTGTGAGTCACA	2414	0	UF_Msa_CF_125819	contig21656___0rc	contig21656___0rc	Unknown	
2551	32	9	unmapped	0		0	ATTATAATAACAATAAGACCAGCGACAACAGTCGCTGTAGTAGAGGGTGTCGAGCAGGAG	2416	0	UF_Msa_CF_124571	contig09297___0rc	contig09297___0rc	Unknown	
2552	32	10		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
2553	32	11	unmapped	0		0	CCTTGTGATTGTATTCACCCTGTAACATGTTTAAATCTGCTAGAGCAGATTATTTTTCAG	2419	0	UF_Msa_AF_100446	contig32547___1rc_nrnt	contig32547___1rc_nrnt	Unknown	
2554	32	12	unmapped	0		0	GTAAACATAAACATGCAGTTTGCTTCCTCTCTGCTGAACAGATAATAAAGGTGAACCTCC	2421	0	UF_Msa_AD_200377	LMB_Add_115_rc	LMB_Add_115_rc	Unknown	
2555	32	13	unmapped	0		0	CTTCTTTTAATACAAAAAAGGATCAAAACAAAAGGTTAGAGGGTGGAGGGAGAGGACGCA	2423	0	UF_Msa_CF_121024	contig32336___0	contig32336___0	Unknown	
2556	32	14	unmapped	0		0	AGATCAATGTTAAAGCCTGTTATTCATTGAAAACATTTATTACATTTCTTATGATGCAAA	2425	0	UF_Msa_AF_109965	contig04649___1_nr0nt	contig04649___1_nr0nt	Unknown	
2557	32	15	unmapped	0		0	ATAAATGTGCTGTACGGCGTCAACAGTGCCAGGACTCATGAGTACCAGCGGATGGTGGCC	2427	0	UF_Msa_AF_107017	contig16537___1rc_nr1nt0	contig16537___1rc_nr1nt0	Unknown	
2558	32	16	unmapped	0		0	GAGGTTGATGGAGCTGCCTGCAACAAACAGAAGGTGGAGCATAAACTACAGTCCCAGCAG	2429	0	UF_Msa_CF_126493	contig02077___0rc	contig02077___0rc	Unknown	
2559	32	17	unmapped	0		0	AGTTTGACCCAACACCAGTCGGTGCTGAGCGGCCACACTCCAAACCAAAGACCTGCTTCA	2431	0	UF_Msa_AF_109525	contig17248___1rc_nrnt0	contig17248___1rc_nrnt0	Unknown	
2560	32	18	unmapped	0		0	GCTGACCATGCTCGCGTTACTGCTGCTGACTCCGCTCACACCCTACTACCTCACCCGTGT	2433	0	UF_Msa_CF_121525	contig04225___0rc	contig04225___0rc	Unknown	
2561	32	19	unmapped	0		0	TTGGCATCAGAACACTGCAAGCTGCAGCCTCATGAACATTGATTACCTTTGTGTAAGCAG	2435	0	UF_Msa_CF_117994	contig06232___0	contig06232___0	Unknown	
2562	32	20	unmapped	0		0	AGCAGCCAGCCCCTCTCATCCCCCCCGTCCACCCGGATGTGCAGATGAAGCCCCTGCCCT	2437	0	UF_Msa_AF_102517	contig25324___1rc_nrnt0	contig25324___1rc_nrnt0	Unknown	
2563	32	21	unmapped	0		0	CGTACCAGACACATCATAAATGATACCACAGGGGTAAAGAACACAGATTTGCAATATGAT	2439	0	UF_Msa_CF_127531	LMB_S454.1114.C1___0	LMB_S454.1114.C1___0	Unknown	
2564	32	22	unmapped	0		0	TAATATCCTTCCATTCACTAGTCATGGTGGCCTTCCATTTTGTTTTCTGCATTGAAGAAG	2441	0	UF_Msa_AF_100562	contig10851___1rc_nrnt0	contig10851___1rc_nrnt0	Unknown	
2565	32	23	unmapped	0		0	CTGGAACTACGCAGACACCTGTACCACACAGGAGGCTCTCGTGATTACCAATCTGTGTCA	2443	0	UF_Msa_CF_118658	contig13679___0rc	contig13679___0rc	Unknown	
2566	32	24		0		0		2230	1	ETG10_195139	ETG10_195139	ETG10_195139		CONTROL
2567	32	25	unmapped	0		0	CTGATCCTTGAAGAGGACTACGATGAGACATATATACCCTCTGAACAAGAGATCCAAGAG	2446	0	UF_Msa_CF_125009	contig20637___0	contig20637___0	Unknown	
2568	32	26	unmapped	0		0	ATCCAGCTGGTATATGGAGCTCGAGTGTAAGCCAGACAGGAGTGAACCAGCAGCACCAGG	2448	0	UF_Msa_CF_120341	contig06649___0rc	contig06649___0rc	Unknown	
2569	32	27	unmapped	0		0	GTGGAGAGAGAGCGAGAAAGGAATGAATCAGCGTTGTGTCCAGCGCTTCCAAATGTGGTG	2450	0	UF_Msa_CF_125220	contig20607___0rc	contig20607___0rc	Unknown	
2570	32	28	unmapped	0		0	CCGTGGAAGAAGAGGCTTCAAATTGTTCTACCTACCTTATTTTGAAAAATGACATTTCAT	2452	0	UF_Msa_AF_109930	contig28445___1_nrnt	contig28445___1_nrnt	Unknown	
2571	32	29	unmapped	0		0	GTGACAGCATTGACGAACTTGTTTTTTCTTGATTTCTGAAAATGACTTTCACCTCCATTA	2454	0	UF_Msa_AF_109824	contig31955___1rc_nrnt	contig31955___1rc_nrnt	Unknown	
2572	32	30	unmapped	0		0	GGCCAAGGAACTGGCAACCAAGCTTGGTTAAATTGTTTGGAATAAAATAAATTTATGTCC	2456	0	UF_Msa_AF_106182	LMB_S454.sd.408.C1___1_nrnt	LMB_S454.sd.408.C1___1_nrnt	Unknown	
2573	32	31	unmapped	0		0	TTGGTATCCAAAAAACAAACACCGATATGAAAAAGTGGCTGGCTCCGAGGTGAGCCCTTT	2458	0	UF_Msa_CF_123195	contig28298___0rc	contig28298___0rc	Unknown	
2574	32	32	unmapped	0		0	AGGAGCAGTGAAAATATGGAGTTGAAGACCAAGGGAGGAAGGCAAGCTAGAACGCCGCGG	2460	0	UF_Msa_CF_119718	contig00262___0	contig00262___0	Unknown	
2575	32	33	unmapped	0		0	CCTGGAAACGCATGAAGGAACTGTCAGCACAGGAAGGACTGGTTGCCATTGGTTATGAGA	2462	0	UF_Msa_AF_105342	contig19356___1_nrnt0	contig19356___1_nrnt0	Unknown	
2576	32	34	unmapped	0		0	TTCTAAGAGATGCTGTAGAGACCAGACTGAGGATGTACATCCCGTACATTGAATCATGGC	2464	0	UF_Msa_AF_103680	contig27174___1rc_nrnt	contig27174___1rc_nrnt	Unknown	
2577	32	35	unmapped	0		0	ATTATCAACGGCATCATCTTTATACCGCTCAGCCAAAAGGATCTGGAGAACCTGAAGGCA	2466	0	UF_Msa_AF_102581	contig24248___1_nrnt	contig24248___1_nrnt	Unknown	
2578	32	36	unmapped	0		0	ACATGCAGATCCTTGGACTCATGTATTCATGGATTCTTTCACTCAGCGCCATTTGTAGGA	2468	0	UF_Msa_CF_123608	contig26151___0rc	contig26151___0rc	Unknown	
2579	32	37	unmapped	0		0	AGCCAACTACGGAGAGGACTACGCCGTGTTTGAGACGGGCACCAGGAACACCGGGAAGAG	2470	0	UF_Msa_AF_106311	contig16132___1_nr0nt	contig16132___1_nr0nt	Unknown	
2580	32	38	unmapped	0		0	GTCGTCTTCGTCCCCTACACAAATCATGGTTGGTGATAAAATGGGTTCACAGTCTCGAGA	2472	0	UF_Msa_CF_121194	contig20514___0	contig20514___0	Unknown	
2581	32	39	unmapped	0		0	AGAAAGGATGACGCTGATGCTAGCTGTGGTATGGTGAAAGGTTTAAGATGTGATTATCTC	2474	0	UF_Msa_CF_117895	contig05006___0	contig05006___0	Unknown	
2582	32	40		0		0		783	1	RC8	RC8	RC8		CONTROL
2583	32	41	unmapped	0		0	CTGATCTGTACTTCTACAGGGACCCTGAAGAGATTGAGAAGGAGGAGCAGGCTGCAGCTG	2477	0	UF_Msa_AF_101467	LMB_S454.sd.420.C1___1rc_nrnt	LMB_S454.sd.420.C1___1rc_nrnt	Unknown	
2584	32	42	unmapped	0		0	TGCTGAATGAAACCAACATCACACTCCAGTGTGTTACCTGTCCTTTTGATTCTGCCTCCA	2479	0	UF_Msa_CF_123963	contig07227___0	contig07227___0	Unknown	
2585	32	43	unmapped	0		0	TGCTGAATGAAAAGGAAGAGTCACTGAGGAAACTGAAGGAGACCTTGAGGAAATCACAGC	2481	0	UF_Msa_CF_121742	contig12336___0	contig12336___0	Unknown	
2586	32	44	unmapped	0		0	GCTGTGTGACCCAAACCACAAGAAGCTTGCCCAGTGCCTCCAGCAGATTGGAGATGAGCT	2483	0	UF_Msa_AF_107228	contig06697___1rc_nrnt	contig06697___1rc_nrnt	Unknown	
2587	32	45	unmapped	0		0	TCGTCTGGAGGAGCTGCAGAAAAAGCTGGCTTCAACCACGCAAACGTCCAAGTCACGCCA	2485	0	UF_Msa_AF_109023	contig23311___1_nrnt0	contig23311___1_nrnt0	Unknown	
2588	32	46	unmapped	0		0	TATGAGAAACGTCTGTTTTGAGAAGAAGCCAGCCATTCAGCCTACAGATGGAGAGTCCTT	2487	0	UF_Msa_AF_100489	contig08454___1_nr0nt	contig08454___1_nr0nt	Unknown	
2589	32	47	unmapped	0		0	AGTTCATAGACTGGCTTCTCAGTATCACAGAATGTCCTGAACAGAGTCTGTCAGCCATGA	2489	0	UF_Msa_AF_101956	contig29127___1_nrnt0	contig29127___1_nrnt0	Unknown	
2590	32	48	unmapped	0		0	CGGTCCATGGTGGAAATCTTAACAAGAAAGCACATGCAATGGCTGAGTACCTGAGGAGGT	2491	0	UF_Msa_AF_103610	contig08493___1_nr0nt	contig08493___1_nr0nt	Unknown	
2591	32	49	unmapped	0		0	GTCTGCTGTGCAGCCGCAGCCCGCTGGATGACCTGAAACTCTTGCTGCATTGCGAACACT	2493	0	UF_Msa_CF_124784	contig16861___0rc	contig16861___0rc	Unknown	
2592	32	50	unmapped	0		0	GAACATTTGACTTGCCACCAGGAGACCTTGCTTCCAAACAATGTTTATTCTGCTGTGTGT	2495	0	UF_Msa_AF_105949	contig15459___1rc_nr0nt	contig15459___1rc_nr0nt	Unknown	
2593	32	51	unmapped	0		0	ATGAGCCACAGAAAGAACAGGAGGAGGATGCACAGTCAAATGCAGATGATGATAACCTGT	2497	0	UF_Msa_CF_123369	contig07973___0rc	contig07973___0rc	Unknown	
2594	32	52	unmapped	0		0	GATTTGAAGCCTTCTGACTCCGGGGTCTATGTTTGCAAGGCAGGCAACAAGCTGGGGGAA	2499	0	UF_Msa_AF_101993	contig16036___1rc_nr1nt0	contig16036___1rc_nr1nt0	Unknown	
2595	32	53	unmapped	0		0	GGCTGTCTGGAGGAAGAGCGGTTTGAGCGTTGCACATGCTACAGGGACTGTGGATACGAT	2501	0	UF_Msa_AF_106749	contig22203___1rc_nr1nt0	contig22203___1rc_nr1nt0	Unknown	
2596	32	54	unmapped	0		0	CTAGAAGTGCAGTTTTTGGGCCTGATATTTAAGTGTATGACTTTTGTTCTCTTAAACCAT	2503	0	UF_Msa_AD_200231	Z22756	Z22756	Unknown	
2597	32	55	unmapped	0		0	AGTGCCTGATCCGGTCCATCCTCCGCCGGGAACCCACAGAGCGCCTCACCTCTCGGGAGA	2505	0	UF_Msa_AF_109568	contig25362___1rc_nrnt0	contig25362___1rc_nrnt0	Unknown	
2598	32	56	unmapped	0		0	AAGAGACTAAACGCATCAAAGCAGAGCAGGAACGCAACTACCAAAAATTTACTGGATCAG	2507	0	UF_Msa_CF_117700	contig15842___0rc	contig15842___0rc	Unknown	
2599	32	57	unmapped	0		0	ACACAAAACCTGCAGGCTCCACTGATGACCACAGTGAGGTAAAAATGCTCCTACTTCATA	2509	0	UF_Msa_CF_127794	contig28790___0rc	contig28790___0rc	Unknown	
2600	32	58	unmapped	0		0	AGTGCAAGGCGATCTGCTGAAGAACTGCACTCCTCTCTGGGGAACACCAGCACCATCACA	2511	0	UF_Msa_AF_100497	contig01779___1rc_nrnt0	contig01779___1rc_nrnt0	Unknown	
2601	32	59	unmapped	0		0	TGGCCTCGCCGTTATCAGAGCACGAACCACCCGTGTGTCATGGCCTCTACCTCTGCCTAC	2513	0	UF_Msa_CF_121928	contig07754___0rc	contig07754___0rc	Unknown	
2602	32	60		0		0		2515	1	ETG10_234183	ETG10_234183	ETG10_234183		CONTROL
2603	32	61	unmapped	0		0	GTGGATGAAAACACGGTTCAGACTGCGGGAGAAGGAGCAGAAAATGACGAAGAGGCCAAA	2517	0	UF_Msa_CF_127006	contig07173___0	contig07173___0	Unknown	
2604	32	62	unmapped	0		0	AAGTCTGAAGGCCAAGGTGGAGCCACTTGTGGAGCAGCTGAAGGCCAAGGTAGCTGTCAA	2519	0	UF_Msa_AF_108415	LMB_S454.sd.125.C1___1_nrnt	LMB_S454.sd.125.C1___1_nrnt	Unknown	
2605	32	63	unmapped	0		0	TGATACTGTGAAGGTGCATACCACATAACCACAACATCCGTGGTTTAACCATGGAAACAG	2521	0	UF_Msa_CF_127235	contig15751___0rc	contig15751___0rc	Unknown	
2606	32	64	unmapped	0		0	ACGGTGGCTAGGACACGGCCACAGACACCGATCGGTGGTCTCTACCTAACAGGTCAGGAC	2523	0	UF_Msa_AF_102246	contig03932___1_nrnt0	contig03932___1_nrnt0	Unknown	
2607	32	65	unmapped	0		0	CCCTCAGAGACTGCTGGAGCTCACCCACCGGTCTGTCAAATCTGCGTTGATACACTGCTT	2525	0	UF_Msa_CF_118092	contig32052___0rc	contig32052___0rc	Unknown	
2608	32	66	unmapped	0		0	TTCATATCAGAGGTATGCAGCCATCGCATGGCCAAGTAAAAAACTGTCTGACATGCAGCT	2527	0	UF_Msa_CF_125448	contig23350___0rc	contig23350___0rc	Unknown	
2609	32	67	unmapped	0		0	AGCAGAAAAAGCTTCTACGGCGCTGCAAGAAAACTCGAAGAATATCATGGAAATATTACA	2529	0	UF_Msa_CF_118700	contig17367___0rc	contig17367___0rc	Unknown	
2610	32	68	unmapped	0		0	ACAGATACATCGAGGTGTTTCCCAGCAGAAGTGACGAGATTCATTCTAGTTGGAGGAAGA	2531	0	UF_Msa_AF_107411	contig02965___1rc_nrnt0	contig02965___1rc_nrnt0	Unknown	
2611	32	69	unmapped	0		0	AGGCCATGATGCCTAGGATTCACCTGCTAGTACCCCCTGACTCTGGTCAGAGGACTTTGG	2533	0	UF_Msa_AF_105102	contig15514___1rc_nrnt	contig15514___1rc_nrnt	Unknown	
2612	32	70	unmapped	0		0	GGAAGCTAAACCGATGAAGAACGGCTAGTTGCCTTTACTTGATTAAAATTTCATTTTATC	2535	0	UF_Msa_CF_125011	LMB_S454.779.C1___0	LMB_S454.779.C1___0	Unknown	
2613	32	71	unmapped	0		0	TGAGTTCTTACCAAAAGGCAAGAGATAGGGACATTACAGATCTGAAGGAAGAAGATGGAA	2537	0	UF_Msa_CF_126294	contig25387___0	contig25387___0	Unknown	
2614	32	72	unmapped	0		0	TGTAGAAAGTAGTGGCAAGCTGCTGGTTTCCAATCTGGACTTCGGCGTCTCCGACTCGGA	2539	0	UF_Msa_AF_110029	contig31216___1rc_nrnt0	contig31216___1rc_nrnt0	Unknown	
2615	32	73	unmapped	0		0	GAGTATCCAGAAACTGCGAGAGAGACAGAGTGTGCTCAAGTCTTTAGAAAAGGATATTTT	2541	0	UF_Msa_AF_107832	contig14967___1_nrnt	contig14967___1_nrnt	Unknown	
2616	32	74	unmapped	0		0	GTACCTGTGAGGGCCTGGTTGACTCACTGCTCTACGTCATCAAAGCCTGTGTAAACACCT	2543	0	UF_Msa_AF_103482	contig24854___1_nrnt0	contig24854___1_nrnt0	Unknown	
2617	32	75	unmapped	0		0	TACTGCTTTGTCATCAAGAGGAAAAATGAGGAACTTAACAGAAAAATCTTTACTCCCCTC	2545	0	UF_Msa_AF_103368	contig13291___1_nr0nt1	contig13291___1_nr0nt1	Unknown	
2618	32	76	unmapped	0		0	CGGGGGTACCAAGGCATTATGTTAATTGACTTCATTAGCTCAATGAAATAAACATGTTAT	2546	0	UF_Msa_AF_108775	LMB_S454.655.C1___1_nrnt	LMB_S454.655.C1___1_nrnt	Unknown	
2619	32	77	unmapped	0		0	ATCATATGCACACACACACACGCCTGGTGGTGTGTTTTAGGCTTTGTAACATATCAGCAC	2548	0	UF_Msa_CF_124544	LMB_S454.sd.475.C1___0rc	LMB_S454.sd.475.C1___0rc	Unknown	
2620	32	78	unmapped	0		0	CATTAGAACAGAATTTGATGAGAGAGATGAGAAAGAGAATCACCTTGATCCCAAATCTGG	2550	0	UF_Msa_CF_120443	contig10478___0rc	contig10478___0rc	Unknown	
2621	32	79	unmapped	0		0	TGGAGAAAGGAGACACCGAACTGCTGCAAAAAGCCATGGACTTTGTGAGTCAGGAGAGGG	2552	0	UF_Msa_CF_124372	contig26884___0	contig26884___0	Unknown	
2622	32	80	unmapped	0		0	TTAAAGTTAATCAGGCTGATGGAAACGACCTAAACACGCCGACACCAACAGGAACTACTC	2554	0	UF_Msa_CF_126573	contig11195___0rc	contig11195___0rc	Unknown	
2623	32	81	unmapped	0		0	CTGCAGGAGCCTCGGCTTCTGCACCTGGAGTACTCCGAGGTGGTCGGGCTGCCGCTGGGA	2556	0	UF_Msa_CF_123438	contig07202___0	contig07202___0	Unknown	
2624	32	82	unmapped	0		0	AGATCCCTCTCCCAGACGAACCTTGCAGCGCACCTTTTCAGATGAGTCACTTTGCAGCGG	2558	0	UF_Msa_AF_108526	contig32053___1rc_nrnt0	contig32053___1rc_nrnt0	Unknown	
2625	33	1	unmapped	0		0	CCCCCAAGTTGGTAAATACAATTCAATCTTTCTGTGTGCTCTAGGAAATCTATATAATTC	2559	0	UF_Msa_AF_101478	contig28200___1_nr0nt1	contig28200___1_nr0nt1	Unknown	
2626	33	2	unmapped	0		0	GACCAACTACCCCGCTTCTTCTTGATTGTTAAGTTAACAATCTAGGATTTGTTGATTAGC	2561	0	UF_Msa_CF_118354	contig25675___0	contig25675___0	Unknown	
2627	33	3	unmapped	0		0	AAATCAAGCCACAACAATGTCTGCATTTCATCTGTATTTGTCAGTGAAGATGGTCATTGG	2563	0	UF_Msa_AF_103254	contig22912___1rc_nrnt	contig22912___1rc_nrnt	Unknown	
2628	33	4	unmapped	0		0	TGAGAAAGCCTGACTTCACCATTCACTTGAATGAGCAAATCATCCCTGCACTGCAAACAG	2565	0	UF_Msa_AF_100924	contig29284___1_nrnt	contig29284___1_nrnt	Unknown	
2629	33	5	unmapped	0		0	CTAAAGCTCCTACAGAAGGAAAGCTGGACATCGAAGCCATTAAAGAGAAAGTGAAAAAAG	2567	0	UF_Msa_AF_102546	contig16040___1_nrnt0	contig16040___1_nrnt0	Unknown	
2630	33	6	unmapped	0		0	TACGCCAAAACACAGAACGCCTGGGTGGACTCTTTCCTCCAGCAGAACGGATATTTAGAG	2569	0	UF_Msa_AF_108994	contig18712___1rc_nrnt	contig18712___1rc_nrnt	Unknown	
2631	33	7	unmapped	0		0	TCTTTTTGATGAGAAGGCTCATGAGTGGAAGGCGCTGGCACCCATGGATGCACCCCGCTA	2571	0	UF_Msa_AF_108800	contig08122___1_nrnt	contig08122___1_nrnt	Unknown	
2632	33	8	unmapped	0		0	ATCTCCAGATGAGGTCCGTAAAGATGGGACCAGGAAGGAAGAAAAACCAGAGGAAAGTTT	2573	0	UF_Msa_CF_126110	contig32060___0rc	contig32060___0rc	Unknown	
2633	33	9	unmapped	0		0	AACGTGTGCAAGCTGCAGCGCGTGTCACTGGTGATCATGTTGGCAGGCTTGGCAGCATTT	2575	0	UF_Msa_AF_104970	contig09043___1rc_nrnt0	contig09043___1rc_nrnt0	Unknown	
2634	33	10	unmapped	0		0	GTTGCGAAGATGGAGTTTCGCAGTTGATTTTGCCTTGCACTATGCATTGCCGTTGCATTA	2577	0	UF_Msa_AF_106866	contig08035___1_nr0nt1	contig08035___1_nr0nt1	Unknown	
2635	33	11	unmapped	0		0	TTTTCAGGCTGGCACCTGCACAGCTCTGTAGTGTACCTGGGACCTACCACATCTCACTCC	2579	0	UF_Msa_CF_125160	contig19073___0rc	contig19073___0rc	Unknown	
2636	33	12		0		0		428	1	RC6	RC6	RC6		CONTROL
2637	33	13	unmapped	0		0	TACAGACATCTCAGGGTTCGCAGGCTTGGAGGGTGCAGACAGTGCTGGAACAAGGCTTTG	2582	0	UF_Msa_CF_124985	contig12771___0	contig12771___0	Unknown	
2638	33	14	unmapped	0		0	GGACTGTGTCGTAGCAGTGAAGTTTTCACACATCACAAAACCAGATCCTGTTGAGGATCA	2584	0	UF_Msa_CF_126955	contig19290___0	contig19290___0	Unknown	
2639	33	15	unmapped	0		0	ATGGAGGGGTTTGAAAGAGAAGTCATGAAAAAGTTTTCAGTGCCAGGAGCTGGAGAGAAA	2586	0	UF_Msa_AF_109569	contig28766___1_nr1nt0	contig28766___1_nr1nt0	Unknown	
2640	33	16	unmapped	0		0	TCTGCATGAAGGAGAAACCTCTTCCTTCTGAGACGAAGTCGAGGAGAGCATGTCCCTGTT	2588	0	UF_Msa_AF_103287	contig00853___1rc_nrnt0	contig00853___1rc_nrnt0	Unknown	
2641	33	17	unmapped	0		0	CCCCTGCGGACACTGCGAGAAGACGTTCCTCACCCTCAGCGAGGCTCAGCTGCACCAGCG	2590	0	UF_Msa_CF_127723	contig26767___0	contig26767___0	Unknown	
2642	33	18	unmapped	0		0	TTGAGGCAATGACTCTAACTGAACCAAAAACACAATCCTCCTCCTGTCTCAAAACAAAAC	2592	0	UF_Msa_CF_118010	contig12677___0	contig12677___0	Unknown	
2643	33	19	unmapped	0		0	TAAGAGCTGAAATGGTCAGCAGTTACAGATGAGTTGTTTTCACAGATTCTTGATTGGTGT	2594	0	UF_Msa_AD_200307	LMB_Add_108	LMB_Add_108	Unknown	
2644	33	20	unmapped	0		0	CAGAGAATAAGCACTAACGATGGCCAACTTTGGAGGACATGCCATTCCTGGCTCTTTTTT	2596	0	UF_Msa_CF_123771	contig24687___0	contig24687___0	Unknown	
2645	33	21	unmapped	0		0	GAGGAGGGGAAGCGTCTAGCGACGAAGCCCACACTTTTTTACCTGATGCATTGTGGGAAA	2598	0	UF_Msa_AF_107070	contig09598___1_nr1nt0	contig09598___1_nr1nt0	Unknown	
2646	33	22	unmapped	0		0	CTACTTAAAAACACACGTTAACGGTGTATGCTATCCTATCTATCAGTACTTAGTGCTTAT	2600	0	UF_Msa_AF_108481	contig01840___1_nr0nt	contig01840___1_nr0nt	Unknown	
2647	33	23	unmapped	0		0	ATCTTTTGCATTTCCACACAAACGTCACAGACAACATGATTCCTTTCTAAGGGCTCCCTT	2602	0	UF_Msa_CF_119048	contig28211___0rc	contig28211___0rc	Unknown	
2648	33	24	unmapped	0		0	CCTGGCTGCCCGGAACATCCTGATCAACAGCAACCTGGTGTGCAAGGTGTCCGACTTTGG	2604	0	UF_Msa_AF_104599	contig04264___1rc_nrnt	contig04264___1rc_nrnt	Unknown	
2649	33	25	unmapped	0		0	CTTCTGTTACATGACAACGTCTGCCGTCATTCAGCCAAGCTGGAGACATTGCACTGAAGG	2606	0	UF_Msa_CF_122222	contig10491___0	contig10491___0	Unknown	
2650	33	26	unmapped	0		0	GCTGTGATTAACTGCTGGGTTTTCCCCCTCATTGATGCTGCCACCAATCAGAGAACTAAG	2608	0	UF_Msa_CF_122428	contig08212___0	contig08212___0	Unknown	
2651	33	27	unmapped	0		0	GAGATGACCTCTTTAGGTACAACCCCAGCAGACTAACCAAGAGAAGATGAAATGCCTCCA	2610	0	UF_Msa_CF_118758	LMB_S454.520.C1___0	LMB_S454.520.C1___0	Unknown	
2652	33	28	unmapped	0		0	TAAAGACAGGAAGCTCAATGTCACTGAAAATCGTAGGAGCCGATGAAGGAGAACAAGAGC	2612	0	UF_Msa_CF_120269	contig11201___0rc	contig11201___0rc	Unknown	
2653	33	29	unmapped	0		0	ACAGAGCTTCTGAAGAGGCCTAAAGAGTACACCGTCAAGTTCACCTTCCCCAACCCACCT	2614	0	UF_Msa_AF_108461	contig18478___1rc_nrnt0	contig18478___1rc_nrnt0	Unknown	
2654	33	30	unmapped	0		0	GTTATATTTACTTTTCTACAGTACTTGGGTTTGCCGCCTTTGTTCTGCAGTAATAAAGAT	2616	0	UF_Msa_AF_100681	LMB_S454.868.C1___1_nrnt	LMB_S454.868.C1___1_nrnt	Unknown	
2655	33	31	unmapped	0		0	TTCGCACGCTCTGACGAGCTGTCTCGCCACCGACGTACCCACACCGGCGAGAAAAGGTTT	2618	0	UF_Msa_AF_106289	contig15901___1rc_nrnt	contig15901___1rc_nrnt	Unknown	
2656	33	32	unmapped	0		0	AGAATTTATGCCCTTTGTGGTCATCTATTGTTGCGCCACACCTCCTACACCTGTATCTGT	2620	0	UF_Msa_CF_118453	contig24343___0rc	contig24343___0rc	Unknown	
2657	33	33	unmapped	0		0	ATCCTGTCAGTAGATGAGACGATCAAGAACCCACGCAGCAGTTCGGATGGACCTCCCGGT	2622	0	UF_Msa_AF_109207	contig31169___1_nr0nt1	contig31169___1_nr0nt1	Unknown	
2658	33	34	unmapped	0		0	CGTATATAAACTATGTGCAATGCTCAGCATTCAAGTGTCAAATCTGTGTTTGCTGATCAC	2624	0	UF_Msa_CF_119452	contig29931___0	contig29931___0	Unknown	
2659	33	35		130	HybridizationNegative	0		2244	1	(+)eQC-39	EQC	EQC		CONTROL
2660	33	36	unmapped	0		0	CCAAAAAACGCTGCACGCTCTGTGGTGAGAACGGAGGGATGATGGAAGCTGTGGATGGTT	2627	0	UF_Msa_CF_122447	contig24660___0	contig24660___0	Unknown	
2661	33	37	unmapped	0		0	GAGATCCCTCACCCACTGGAGGCCGGCGACTTTCTGGAGGTCAAGCAGCTGGCGCCAAAG	2629	0	UF_Msa_CF_126949	contig19275___0	contig19275___0	Unknown	
2662	33	38	unmapped	0		0	AGGAACGCAAATCGAACGGAGCTGTCATTTCACGTTAGCTACAATGACTTTGACGTATTA	2631	0	UF_Msa_AF_107243	contig09663___1_nr0nt	contig09663___1_nr0nt	Unknown	
2663	33	39	unmapped	0		0	TGTGGTGTCAGGGCTGCAGCCACGGTGGACATCTGGAGCACATAATGAACTGGCTGAAGA	2632	0	UF_Msa_AF_101920	contig23798___1_nrnt	contig23798___1_nrnt	Unknown	
2664	33	40	unmapped	0		0	CTTATGATCATTGCCGCCTTCTAAGAGAGAACATAATGACAAGGTATCTGTTTTAAATTG	2634	0	UF_Msa_AF_104773	contig30336___1_nr0nt1	contig30336___1_nr0nt1	Unknown	
2665	33	41	unmapped	0		0	GAGCTCCACGTTTACTTCCGCTCTCCTGCGCCTAAGCTCATTGGCATCTTTGACCTTTAC	2636	0	UF_Msa_CF_126123	contig15779___0rc	contig15779___0rc	Unknown	
2666	33	42	unmapped	0		0	TGAGTCGCTCGTTCTTCGTTTGTTTCGATGTGGTCTTTACCGACGAATGATGATATACGC	2638	0	UF_Msa_CF_127480	LMB_S454.sd.107.C1___0rc	LMB_S454.sd.107.C1___0rc	Unknown	
2667	33	43	unmapped	0		0	TATATGGCATCTTCCAGGATTCCACTGACATGTCTTCGTGTGCAGCAGCTAGATTGTCAT	2640	0	UF_Msa_AD_200209	LMB_Add_65_rc	LMB_Add_65_rc	Unknown	
2668	33	44	unmapped	0		0	AGCAGGAGAAAGATGAACAATTCTTGACAAAACCTCCACGTAACAGTTGTGTATTTTTGT	2642	0	UF_Msa_AD_200217	LMB_Add_153_rc	LMB_Add_153_rc	Unknown	
2669	33	45	unmapped	0		0	TACCTAAGCAGCTGATCCAAGAAGGAGACTATCGCAGGGACAACTACCCAAACATCAAAA	2644	0	UF_Msa_CF_119887	contig17730___0	contig17730___0	Unknown	
2670	33	46	unmapped	0		0	CATCCGGCAGGGCATCTTCTACTCCATGCTACTCTCCTTCTGGATCATCTTCTGTGGGGA	2646	0	UF_Msa_AF_100997	contig14639___1_nrnt	contig14639___1_nrnt	Unknown	
2671	33	47	unmapped	0		0	ACAAGCTAAAAGATATTGTGGACCCTCTTAGGGCTATTCAGATGGTGGCAGAAACTCTCT	2648	0	UF_Msa_AF_110145	contig19487___1_nrnt0	contig19487___1_nrnt0	Unknown	
2672	33	48	unmapped	0		0	TGGACATCTACATCTGTAACCTGGTGCAGTCAGGGAGGCAGCCTCCTCAGGTCGACTCTA	2650	0	UF_Msa_AF_100915	contig00935___1rc_nrnt0	contig00935___1rc_nrnt0	Unknown	
2673	33	49	unmapped	0		0	CGGGCTATCGTCCCAACCCAGGAGGAGCCATTTCTCTGTAGTAGCATCTCTGTTTGTTTG	2652	0	UF_Msa_CF_126690	contig11665___0	contig11665___0	Unknown	
2674	33	50	unmapped	0		0	GAGGGACTCGCTAAGGAGGAGTGTTTGAAAAAGATCTGGATGGTTGATTCCAAGGGTCTC	2654	0	UF_Msa_AF_101035	contig22853___1rc_nrnt-1	contig22853___1rc_nrnt-1	Unknown	
2675	33	51	unmapped	0		0	TCCCCTTAGCACTCGGTCTCGGCGGATCCAGACTGGACCCGCTGGACCTTAACAGGTACT	2656	0	UF_Msa_CF_123590	contig13160___0rc	contig13160___0rc	Unknown	
2676	33	52	unmapped	0		0	TAACTGGAGGAATGCTACAGAATCGGTCAAATACCACTTCGATGTTTTTCATGGTGAACA	2658	0	UF_Msa_AF_109932	contig24701___1rc_nrnt-1	contig24701___1rc_nrnt-1	Unknown	
2677	33	53	unmapped	0		0	CCACGGCCAGACATCTTTGGTCAGTATTCTGCACTTGCTTCAAGTTGACACAGCAGCTTC	2660	0	UF_Msa_CF_121673	contig15752___0rc	contig15752___0rc	Unknown	
2678	33	54	unmapped	0		0	TACGACATCATCAGGACCAGGGATGGGAAGGAAAGGGGCAAAGGAACTGAACCCTGAATA	2662	0	UF_Msa_CF_121339	contig09403___0	contig09403___0	Unknown	
2679	33	55	unmapped	0		0	CCTTAAGGAGGAGCATGAAATGAAAATGAAGATCCTCAAAGTAGAACTGGAAATGCAGAT	2664	0	UF_Msa_AF_103923	contig19395___1_nr0nt1	contig19395___1_nr0nt1	Unknown	
2680	33	56	unmapped	0		0	TTCATGTCGGGGAAGCTGCGGATCAAAGGCGACATGACGCTCGCCATCAAGCTGGAGAAA	2666	0	UF_Msa_AF_107776	contig01338___1_nrnt	contig01338___1_nrnt	Unknown	
2681	33	57	unmapped	0		0	TCTGCCTAGAACCAATGTGAGGTTCAGCATATTTATGTGAGACTGATGCAATACAGTTGT	2668	0	UF_Msa_AD_200068	LMB_Add_139	LMB_Add_139	Unknown	
2682	33	58	unmapped	0		0	AAGGTGGTATTCAAAATGACATCGCCGTCGACTGAGTTAACAGACCTAGATGCCAAGTCT	2670	0	UF_Msa_AF_104852	contig32235___1_nr1nt0	contig32235___1_nr1nt0	Unknown	
2683	33	59	unmapped	0		0	GTGTATGGAAGGGTCTGGTAGCCCGTATTATCATGATTGGTACTCTGACGGCTCTGCAGT	2672	0	UF_Msa_AF_107395	contig29369___1_nrnt	contig29369___1_nrnt	Unknown	
2684	33	60	unmapped	0		0	ATGGTGATTTGTTGTATATAACTGACACTGACTAAACAATCCCGATAAAGTGCACATGTG	2674	0	UF_Msa_AF_110258	contig22123___1_nr0nt	contig22123___1_nr0nt	Unknown	
2685	33	61	unmapped	0		0	GGGAGTCACTATTGGCTCTGGAGCTGCAAGCCTCCGTGCAGAATGTGGACTTGGAAAAAA	2676	0	UF_Msa_CF_124832	contig20180___0rc	contig20180___0rc	Unknown	
2686	33	62	unmapped	0		0	AGAAAAACATGGGTATTTTAACAGCTAATTGCCATTGGAGCAGCAGGAGCAACAGGTGCG	2678	0	UF_Msa_CF_121589	contig05610___0	contig05610___0	Unknown	
2687	33	63	unmapped	0		0	ATTATGTACGGTTGTGGAACATGATGGGGTTTAACTGTCATGCTGAGTGCACACAGGAGT	2680	0	UF_Msa_CF_120681	contig09201___0rc	contig09201___0rc	Unknown	
2688	33	64	unmapped	0		0	ACGAAGGCGGCTCTGCTCAGTCTGTTCGGAGTTCCCCTCTGGTATTTCTCTCAGTCTCCT	2682	0	UF_Msa_AF_105161	contig12167___1_nrnt0	contig12167___1_nrnt0	Unknown	
2689	33	65	unmapped	0		0	AACATGTTTGACAGTAAATGTCTCAGCTCTTCCACCAGCAAGACATCACGCGTCCTGTTT	2684	0	UF_Msa_CF_123156	contig11986___0	contig11986___0	Unknown	
2690	33	66	unmapped	0		0	TATTGAAAGGGTCCTGGATGCAGTGGAAAAGCAACCATTGTCCTCTAGCATGATAGAGCT	2686	0	UF_Msa_AF_104286	contig01688___1rc_nrnt0	contig01688___1rc_nrnt0	Unknown	
2691	33	67	unmapped	0		0	ACAGCTATGTTAAACCACTGTCATTGGAAAAATGGCTTATTGTACAGTGACATAAAAAGC	2688	0	UF_Msa_AF_103838	contig30330___1_nr0nt	contig30330___1_nr0nt	Unknown	
2692	33	68	unmapped	0		0	CACTGAATTGGCAGTGACTTGAATACAAAAAAGTAGTAGCTGAAAATGTTTCTCAAGATC	2690	0	UF_Msa_AF_106700	contig28801___1_nrnt	contig28801___1_nrnt	Unknown	
2693	33	69	unmapped	0		0	TGTTTTCAGACTTGTTTACATTCAGACAACAGGGTGAGACCACATGCTGAGGACAGGAGA	2692	0	UF_Msa_CF_126581	contig16216___0	contig16216___0	Unknown	
2694	33	70		1028	E1A	0		42	1	(+)E1A_r60_n11	E1A_r60_n11	E1A_r60_n11		CONTROL
2695	33	71	unmapped	0		0	AAGTAAAGCAGAAGCTAAGTTCGGTCCGCAGGTGTTCTGATCCAGGATGTCGATTTCAAA	2695	0	UF_Msa_AF_106583	contig02828___1_nrnt	contig02828___1_nrnt	Unknown	
2696	33	72	unmapped	0		0	CATAAGGAGACGACGAAGGCGCTTCAGCCGGGAAAGAAGTGCCGTGAGAAAGAAGCCGTT	2697	0	UF_Msa_AF_103214	contig17008___1_nr0nt1	contig17008___1_nr0nt1	Unknown	
2697	33	73	unmapped	0		0	GCCTGAGAGATTTTAACTTAAGGGAAGTAGAAAAGATATTTATCAGTGAACTTCACCAAG	2699	0	UF_Msa_AF_103272	contig31495___1_nrnt	contig31495___1_nrnt	Unknown	
2698	33	74	unmapped	0		0	ACAAAATGAGCTGGACAACAGAGGGGAATCATCCATCTTGCAGTCTCCTAGCTCACATTT	2701	0	UF_Msa_AF_106313	contig30051___1_nrnt	contig30051___1_nrnt	Unknown	
2699	33	75	unmapped	0		0	TCAGTGTCTGAAGGAGTGGTGCGACGCCTTCCTCTGAGACTCCGCCTCCTCACCTGAGAC	2703	0	UF_Msa_AF_105669	contig06575___1_nr0nt1	contig06575___1_nr0nt1	Unknown	
2700	33	76	unmapped	0		0	TGTTCTGTACACAGCCCTAATGCCACTCAAATGAGAAATTACAAAGAACAGATATTTCAG	2705	0	UF_Msa_CF_121826	contig31004___0rc	contig31004___0rc	Unknown	
2701	33	77	unmapped	0		0	CTGCTACTCCTTCCTGCGTCTGTACGCCAGTCTGCTGAGGCGGGAGGAGAAGCCCAAACA	2707	0	UF_Msa_CF_126907	contig08200___0	contig08200___0	Unknown	
2702	33	78	unmapped	0		0	CCTGACCACAGGATAGACTCGGCTCGTGTATTTAGAAAATGTATTTAGTGTTTTAAATTA	2709	0	UF_Msa_CF_121503	contig22464___0	contig22464___0	Unknown	
2703	33	79	unmapped	0		0	GACTATGGTGCTCCAAGGTTTTAATATTTCTACAAAAGAACTAGACCTGTAAATAGACTG	2711	0	UF_Msa_AF_107074	contig31680___1_nrnt	contig31680___1_nrnt	Unknown	
2704	33	80	unmapped	0		0	TTGAGCGTATGACATCAGAAGATCTATATTAATATATTGTAGTTAGCTTGAATTGTGTGA	2713	0	UF_Msa_AF_108924	contig26587___1_nr0nt1	contig26587___1_nr0nt1	Unknown	
2705	33	81	unmapped	0		0	TTGTTTCCAAACATTTGGTGACCGTGTCAAACTTTGGCTCACTATCAACGAGCCCCATGT	2715	0	UF_Msa_AF_102295	contig22628___1rc_nrnt0	contig22628___1rc_nrnt0	Unknown	
2706	33	82	unmapped	0		0	TCACCGCTGATTAAACGAAACAGAGAAAGCACAAACGGAGGAGCTAAGAGAAAGGCTTCA	2717	0	UF_Msa_CF_122630	contig20729___0rc	contig20729___0rc	Unknown	
2707	34	1	unmapped	0		0	GGAACCCCCTGAGAGACTTTATGCTCAAATCTGATGATGACAACCCACAAGGACTCCAAG	2560	0	UF_Msa_AF_107155	contig24285___1_nr0nt	contig24285___1_nr0nt	Unknown	
2708	34	2	unmapped	0		0	ATGCTGGTTATGCTGATCTGAAGAGGACTATCGCTGTTTTACTGGACGACATTCTGACAC	2562	0	UF_Msa_CF_125127	contig28808___0rc	contig28808___0rc	Unknown	
2709	34	3	unmapped	0		0	AAACACCACTTCCCTTTAAGAAGCCAATGCTTAAGTGATGCCCTTCTTGCCACCAAATTG	2564	0	UF_Msa_AD_200045	LMB_Add_98_rc	LMB_Add_98_rc	Unknown	
2710	34	4	unmapped	0		0	GCTGAAACCATCCACCAGTCCTGCCTACAAGAAAGCAAAAGAAATTATTTTCCTCTTTGC	2566	0	UF_Msa_CF_119678	contig28059___0	contig28059___0	Unknown	
2711	34	5	unmapped	0		0	TGTCAATACTGTACCTCCAGCTCAGTGCTACATGCTAGACAGCATTTTCCAATGCCAATG	2568	0	UF_Msa_CF_119600	contig10537___0rc	contig10537___0rc	Unknown	
2712	34	6	unmapped	0		0	ACCCATGCCTTCCTTTATAAATCCAGGGGTCACTCGCTTCTAGCTGTTATTCCTCTGTTA	2570	0	UF_Msa_CF_121443	contig14798___0	contig14798___0	Unknown	
2713	34	7	unmapped	0		0	AGCATGAGAAGGACAAACGCATCTACGCCAACATGTTCCAGAAATTTGCAGAGAGGGATT	2572	0	UF_Msa_AF_109750	LMB_S454.sd.44.C1___1_nrnt	LMB_S454.sd.44.C1___1_nrnt	Unknown	
2714	34	8	unmapped	0		0	ATTATAACAATGAATGGTACCGACGTAACTTCACCATCACCTTGCTCATGGCCCGAGTCT	2574	0	UF_Msa_AF_101121	contig32612___1_nr1nt0	contig32612___1_nr1nt0	Unknown	
2715	34	9	unmapped	0		0	GCGCGCAGTTTCCGCCCACTACAATCTCGACAGGAAGTGAGCAGGAGTCCGCTGAAAGTG	2576	0	UF_Msa_CF_118381	contig18093___0	contig18093___0	Unknown	
2716	34	10		0		0		2578	1	RC4	RC4	RC4		CONTROL
2717	34	11	unmapped	0		0	GGAGCAAAATGGCGGGTGTGTGAGCTGGGAACCTAACGTACCGGATCCTGACAGAGCCTA	2580	0	UF_Msa_CF_126408	contig11253___0	contig11253___0	Unknown	
2718	34	12	unmapped	0		0	AGTCATTCGTCGGACCACCTCCTGATGGAGACAAAGAGCTTTGCGACACCCACTGCTTCT	2581	0	UF_Msa_CF_121377	contig03959___0	contig03959___0	Unknown	
2719	34	13	unmapped	0		0	TTCAGCATCGCCAAGGGAGAGGTGGTGTCTCTGCAGACATACGGAGCCTTTGTCAGACTG	2583	0	UF_Msa_AF_102603	contig22928___1_nrnt0	contig22928___1_nrnt0	Unknown	
2720	34	14	unmapped	0		0	TATTTTAGGATTCAACAGGAACTGGAGAATCTGTCCCATGGAATGGGGCATGAAGCACAA	2585	0	UF_Msa_AF_106528	LMB_S454.1119.C1___1rc_nrnt	LMB_S454.1119.C1___1rc_nrnt	Unknown	
2721	34	15	unmapped	0		0	AGTGATGTCATCCCCACGGCTCAGTTTACGATGGATGTGACTAAACTGTCAAACACAACT	2587	0	UF_Msa_AF_105640	contig25089___1_nrnt	contig25089___1_nrnt	Unknown	
2722	34	16	unmapped	0		0	TATGTTTGGCTATGACAAAGTCTTACCCATGAATACAGGTGTCGAAGGTGGTGAGACTGC	2589	0	UF_Msa_AF_108039	contig23190___1_nrnt	contig23190___1_nrnt	Unknown	
2723	34	17	unmapped	0		0	TTTTCCAGGGACCAAGATCGTATGATTACAACCCCATGTCAGCTGACTGGTCCAGAGAGA	2591	0	UF_Msa_CF_121451	contig03278___0	contig03278___0	Unknown	
2724	34	18	unmapped	0		0	CCTGCCCTCCAGGGTCTCCGCACTCTGGACGGAGGTTGACTATCTTAGAATGTTTTATAG	2593	0	UF_Msa_CF_122288	contig09405___0	contig09405___0	Unknown	
2725	34	19	unmapped	0		0	AAACCCACCTGGTGGCAAGTCCAGCCTCATCCTGGGTTGAGACCACTTGTTTTGTTTTTT	2595	0	UF_Msa_AF_109855	contig32423___1rc_nrnt	contig32423___1rc_nrnt	Unknown	
2726	34	20	unmapped	0		0	AATCTTATTTCCCACAGAAGTCTGCTGCATGAAGGGAAACTTGTGCTCATAGAGAACACA	2597	0	UF_Msa_AF_103430	contig23998___1rc_nrnt0	contig23998___1rc_nrnt0	Unknown	
2727	34	21	unmapped	0		0	TGAGGATGTGATGTCAGAATGGTGATTTAAGTTTACCCTGAAAGAAATCCTTTTTATACG	2599	0	UF_Msa_AF_106259	contig15633___1_nrnt	contig15633___1_nrnt	Unknown	
2728	34	22	unmapped	0		0	GTTTTCTCCCTCTGTTTTAATTTATGATCTGGTTTGAGAAATCAGATTTGTTGCAGGTGT	2601	0	UF_Msa_AF_105217	contig31057___1_nr0nt1	contig31057___1_nr0nt1	Unknown	
2729	34	23	unmapped	0		0	ACTCAGAAAACACCTGAACAGGTTTCAGCTGAGCTGGCGGCGGGAGGGGAGGAGAGAGAG	2603	0	UF_Msa_CF_117741	contig12547___0rc	contig12547___0rc	Unknown	
2730	34	24	unmapped	0		0	AAGATGTACAGTACATCATATGATGAGTTCTCGCCTTTCTACATAGCAGCAGCGTTTTTT	2605	0	UF_Msa_CF_118027	contig03014___0	contig03014___0	Unknown	
2731	34	25	unmapped	0		0	TTTAGATACACAGTATTTTGCCACTACTTCCTAAAATGGGCTGAAGGAAACCCCGGGGGT	2607	0	UF_Msa_CF_124083	contig12374___0rc	contig12374___0rc	Unknown	
2732	34	26	unmapped	0		0	TGTTGTGTTCTGCTATAATGACGATAAACGTTGAATCTAATCTCCTCCCACCCCCAGCAT	2609	0	UF_Msa_CF_123219	contig19251___0rc	contig19251___0rc	Unknown	
2733	34	27	unmapped	0		0	TGTGAACTCTTTGCCGGGCGTGAGAGAGTTGGTGAGACTACGACCCAGACAGGGAAATCA	2611	0	UF_Msa_AF_109417	contig19912___1_nrnt0	contig19912___1_nrnt0	Unknown	
2734	34	28	unmapped	0		0	AACCAGATGATGCAGGTGGACCCCAAGCGACGTCTAACTGTTCGACAGCTGCTGGACCAT	2613	0	UF_Msa_AF_109145	contig01985___1rc_nrnt0	contig01985___1rc_nrnt0	Unknown	
2735	34	29	unmapped	0		0	CATCCATCAGTACATTAAATTTGGGATCTCAGAGGAGGATTTTCTAGACAGCTTTACATC	2615	0	UF_Msa_AF_105382	contig31267___1rc_nrnt	contig31267___1rc_nrnt	Unknown	
2736	34	30	unmapped	0		0	AAGCGCAGGGAGCCCAAGAAGAAGAGTGTGAAGAAGGAGTATACACCGTTCCCTCCATCA	2617	0	UF_Msa_AF_103445	contig26085___1rc_nr0nt	contig26085___1rc_nr0nt	Unknown	
2737	34	31	unmapped	0		0	TAAAATGGCACATCTCTGTCACCAATGATGGAGAAAGATGTGCAATGAGCACAATGAACT	2619	0	UF_Msa_CF_117928	contig24704___0rc	contig24704___0rc	Unknown	
2738	34	32	unmapped	0		0	TTCGTTAAAAGCCAAACATGTGTGGGCGCTTTGCTGGACTCCTGCGGGTTCGACGGGCTT	2621	0	UF_Msa_CF_127162	contig09502___0	contig09502___0	Unknown	
2739	34	33	unmapped	0		0	CCAGGATCAAGGACTACCTGGACCAGCTGCCGGATTTCCCGTATAAAGACAACCTCCCTC	2623	0	UF_Msa_AF_105933	contig32805___1rc_nrnt	contig32805___1rc_nrnt	Unknown	
2740	34	34	unmapped	0		0	TTAACATCCAGCAGGATTTTCTTCATTTATAGACACAAGCGCCTTGCGAGCACTAGCGGT	2625	0	UF_Msa_CF_122116	contig14505___0	contig14505___0	Unknown	
2741	34	35	unmapped	0		0	GGATCAGTCCATGGGTCTCCGCTGGGTTTGCATCTCTGTACAGTTCAGGGTTTTGTGATA	2626	0	UF_Msa_CF_123237	contig15605___0	contig15605___0	Unknown	
2742	34	36	unmapped	0		0	TCACTGTCGACTGGTGAAATTTTCTGACTTCGAAGTAGTGATACTTTTCCTTTAAAGATG	2628	0	UF_Msa_AF_102248	contig06291___1_nr0nt	contig06291___1_nr0nt	Unknown	
2743	34	37	unmapped	0		0	AATGAAGGATCATCGGAAGATATCAACTTCACCTGCACCATGGAGCAGCTACAGGATTTG	2630	0	UF_Msa_AF_104591	contig09559___1_nrnt	contig09559___1_nrnt	Unknown	
2744	34	38		1028	E1A	0		643	1	(+)E1A_r60_a22	E1A_r60_a22	E1A_r60_a22		CONTROL
2745	34	39	unmapped	0		0	GTCTTCATGTGGACGTGACAGCAACAAAGTAATGTCATATTAAAACACAAATGAAATTGG	2633	0	UF_Msa_CF_123457	contig17003___0rc	contig17003___0rc	Unknown	
2746	34	40	unmapped	0		0	AAACTGCAGGAGGAGGAGCGAGAGAGGAGGGACAACTACGTGCCAGAGGTGTCCGCTCTG	2635	0	UF_Msa_AF_105574	contig21872___1rc_nrnt-1	contig21872___1rc_nrnt-1	Unknown	
2747	34	41	unmapped	0		0	CCGCTAAGGGGAGGCTGGTGGTGTGTGGTCATGGTACACTGGAAGGAGACGGAGTTTTCC	2637	0	UF_Msa_AF_105747	contig15194___1rc_nr1nt0	contig15194___1rc_nr1nt0	Unknown	
2748	34	42	unmapped	0		0	AACCTCTTTTATATATAAAAAATGGAGAAGGTTTATATCACCTTCATGCTTTAAAGCAAT	2639	0	UF_Msa_AF_100542	contig20839___1_nr0nt1	contig20839___1_nr0nt1	Unknown	
2749	34	43	unmapped	0		0	TTTGTCAACAGTGCAGTCATCAATGATTATCAACCAGGGGGCTGCATTGTGTCACATGTG	2641	0	UF_Msa_AF_100878	contig24579___1_nrnt	contig24579___1_nrnt	Unknown	
2750	34	44	unmapped	0		0	TACTTCATGCAAAGCAGGTCTGTAATCACTCGGAGTGGTAATCAAAATGCTGGCTGCACA	2643	0	UF_Msa_CF_118184	contig28898___0	contig28898___0	Unknown	
2751	34	45	unmapped	0		0	GACGACGATGAAGAGCCAAAGCAGCAAACCTCTACAGTTGCACCACAGCAGGACTCAGAC	2645	0	UF_Msa_CF_127091	contig17976___0	contig17976___0	Unknown	
2752	34	46	unmapped	0		0	TCGCTTGTCGAGCTTCATGGATCCGGACAGCAAAAGCTTCCAGCCATGGACAGACTACAT	2647	0	UF_Msa_CF_126623	LMB_S454.947.C1___0	LMB_S454.947.C1___0	Unknown	
2753	34	47	unmapped	0		0	ATCTGAAACCTAGTCAGTATCTGGGGGCACGGTGCCCTGGACGATGATGATCTACCCAGG	2649	0	UF_Msa_CF_126228	contig00243___0	contig00243___0	Unknown	
2754	34	48	unmapped	0		0	TATAAGAAATTTGTTCCGGACTCCCTGGTCCTCTGTCGAAAGGCTGGATGACAAAACTGT	2651	0	UF_Msa_AF_109490	LMB_S454.465.C1___1_nrnt	LMB_S454.465.C1___1_nrnt	Unknown	
2755	34	49	unmapped	0		0	GGCGCTGGACTAGGATATCAGAACTGTGTAAGAACTACGACCTCCCGGGAGATTTCTTAT	2653	0	UF_Msa_CF_119202	contig00566___0rc	contig00566___0rc	Unknown	
2756	34	50	unmapped	0		0	AGGAGATGCTCAAGAGGATTCCTCAGAGCACCCTGGCTGAGTTTTACCCAGGGAGTCTGC	2655	0	UF_Msa_AF_106171	contig15691___1rc_nrnt	contig15691___1rc_nrnt	Unknown	
2757	34	51	unmapped	0		0	AGACTTATAGCTCTGGAGAAGCTGATGATGAACTGCCAGGACAAAGATAGACTCGACATG	2657	0	UF_Msa_CF_120555	contig30233___0	contig30233___0	Unknown	
2758	34	52	unmapped	0		0	TTTTCATAGCAAAGATGGCAGAGGGAGACAAGGCGTCTGCCAAGAAGAAGCATGGGAGCC	2659	0	UF_Msa_AF_103578	LMB_S454.1100.C1___1rc_nr0nt1	LMB_S454.1100.C1___1rc_nr0nt1	Unknown	
2759	34	53	unmapped	0		0	TACACAGAAAGTTACATTAGCACTATTGGTGCGGACTTCAAAATACGAACCATAGACTAG	2661	0	UF_Msa_AF_102466	contig19466___1rc_nrnt	contig19466___1rc_nrnt	Unknown	
2760	34	54	unmapped	0		0	CTGCCCAAGCCCCTGCATGCCCTGGTAACGGTCCAACCACTGAGCCCTGATCAGTCTGTA	2663	0	UF_Msa_AF_101942	contig23800___1rc_nrnt	contig23800___1rc_nrnt	Unknown	
2761	34	55	unmapped	0		0	TCGACCAGTTTCCTGCTGACGGGGAGGACATGGAAAATATGGAGGCCAGGGAAAAGGAAC	2665	0	UF_Msa_CF_118948	contig12533___0	contig12533___0	Unknown	
2762	34	56	unmapped	0		0	AATTTTCTCCATCTGTGGTGGGGGCGTCTGCAGAGTTGTTGGTGGTCGAGTTCCCCCTCT	2667	0	UF_Msa_AF_105650	contig09707___1_nr0nt	contig09707___1_nr0nt	Unknown	
2763	34	57	unmapped	0		0	AGTTATGGTCTCAATTTCTACTCCCATTTTTCGCTCTTCAGGATCGTTCCTCTCAACTAC	2669	0	UF_Msa_CF_126406	contig31772___0rc	contig31772___0rc	Unknown	
2764	34	58	unmapped	0		0	CAGATATTAAGTAACGGAGGGCTCGCAGCTTTGTCTTCGAGGCGCCTGGAAGGAGACAGG	2671	0	UF_Msa_CF_120317	contig28832___0rc	contig28832___0rc	Unknown	
2765	34	59	unmapped	0		0	ATATATATAGAGAGAGAGAGAGAGGAAACAGTGCAGGGCTGCTCATAGGTTACAGAGCTG	2673	0	UF_Msa_AD_200135	LMB_Add_151_rc	LMB_Add_151_rc	Unknown	
2766	34	60	unmapped	0		0	AGTCAGGTGTCCCTGCCCCAACTGTGTTGCTAGATACAGCAAAAGATAAAACAAAGTAAT	2675	0	UF_Msa_CF_125335	contig18907___0	contig18907___0	Unknown	
2767	34	61	unmapped	0		0	TCTTCAGACTCAGGCAAGCAAAATAAGAAGCACAAAGACGTTAATAAAAAGGGGGACAAG	2677	0	UF_Msa_CF_125927	contig14247___0rc	contig14247___0rc	Unknown	
2768	34	62	unmapped	0		0	AGCGTCTGACCATCATCAAGGGAATCGCAAAGGCCTTGCATCACCTCCATACAGCCCAGC	2679	0	UF_Msa_AF_105955	contig25836___1rc_nrnt0	contig25836___1rc_nrnt0	Unknown	
2769	34	63	unmapped	0		0	AGCACCCATGTAGATGCGAGCCAGGCTGTATGCCAGGTCTCTGGCTGCTAATTCCAGAGA	2681	0	UF_Msa_AF_101036	contig07544___1_nr0nt1	contig07544___1_nr0nt1	Unknown	
2770	34	64	unmapped	0		0	AATAAAGATGACAAACATACAATCAAAGTGCAACGAAAGAGGGCCAGCGACAGCACCAGC	2683	0	UF_Msa_CF_127439	contig06706___0rc	contig06706___0rc	Unknown	
2771	34	65	unmapped	0		0	GTTGCTGATTGCATTACTGTGTTTTCTACCATTATGATGCAACCCATGTAGTAAACTTTA	2685	0	UF_Msa_AF_108896	LMB_S454.257.C1___1_nrnt	LMB_S454.257.C1___1_nrnt	Unknown	
2772	34	66	unmapped	0		0	AGATTGTAACAAATGCTGCTGTGGATGCTGTCACTGCTGCGGTTTGTCTGTCTGTGTTTA	2687	0	UF_Msa_AF_100149	contig31089___1_nrnt0	contig31089___1_nrnt0	Unknown	
2773	34	67	unmapped	0		0	AAGGATGAAACCTTAAGCCCCGATGGTAGGATACATTCCTCGGATTCTTTTCCTTGATCC	2689	0	UF_Msa_AF_104483	contig14547___1rc_nrnt	contig14547___1rc_nrnt	Unknown	
2774	34	68	unmapped	0		0	AACCAAGTAGAAGTCTGACGTACTACAGTGTGAAGAAGGGGAAGAGGAAGACTGTAAAAT	2691	0	UF_Msa_AF_110236	contig14308___1_nrnt0	contig14308___1_nrnt0	Unknown	
2775	34	69	unmapped	0		0	CGCTTCTGTGCTCACAGTCCCCAGCGGCTTAGACCTCAGTACTCTGAGTGACACTTTACT	2693	0	UF_Msa_CF_126261	contig05893___0	contig05893___0	Unknown	
2776	34	70	unmapped	0		0	ACATAGTCATTCATCCTTCAAGGAAGTGCATCAGAAAAATTCCAGTCGAGGCAACACGGG	2694	0	UF_Msa_AF_103377	LMB_S454.sd.354.C1___1rc_nrnt	LMB_S454.sd.354.C1___1rc_nrnt	Unknown	
2777	34	71	unmapped	0		0	GACTATTCCTCCTCCTACTCATGTGAATAAAGGCCACTGCTCGCCAAAGTGAAGGAGGAG	2696	0	UF_Msa_AF_103663	contig04571___1_nr0nt	contig04571___1_nr0nt	Unknown	
2778	34	72	unmapped	0		0	TCCTTTGTAGCCATTGTCATTTTGGGAGTGGTGCATTGGCCGGGAAACGAACCCGGGCCT	2698	0	UF_Msa_AF_103363	contig10110___1rc_nr0nt1	contig10110___1rc_nr0nt1	Unknown	
2779	34	73	unmapped	0		0	CCCATTCACTACGGACACAGGCTTTTATAGAGCCGAGAGCGGGAAAAGGCTTGTCACCCC	2700	0	UF_Msa_AF_103106	contig06750___1_nr0nt1	contig06750___1_nr0nt1	Unknown	
2780	34	74	unmapped	0		0	GGTCACACCGTGCAGCAGAGGCTCCAAAAAGCCCAGCAGAAGATGGAGACGCAGAGAGTG	2702	0	UF_Msa_AF_102287	contig30646___1_nrnt0	contig30646___1_nrnt0	Unknown	
2781	34	75	unmapped	0		0	AGAGGAGAAGACTGGAGGAGGAGTTGAGAGAGTAGTCGTGGGCTGATCGATGCTCTCACT	2704	0	UF_Msa_CF_118855	contig26047___0rc	contig26047___0rc	Unknown	
2782	34	76	unmapped	0		0	GCAGCGGAGGTTTGTTGGTGGTACTGAGCTGAGAGGCAACGTGCAGCAACAGGAAGTGCG	2706	0	UF_Msa_CF_123104	contig05112___0rc	contig05112___0rc	Unknown	
2783	34	77	unmapped	0		0	TTTTTTGCAGTTCTCCGTGAACTCTGTCAGCTCCCCGTCGGGGAATCGAACCCCGGTCTT	2708	0	UF_Msa_AF_104165	contig03190___1rc_nr0nt1	contig03190___1rc_nr0nt1	Unknown	
2784	34	78	unmapped	0		0	CATCGCTAAAGTCTTTGTTAACACAGACGAGGAAGATGTCGCCTCCTCTCCTGTCATGTA	2710	0	UF_Msa_CF_121719	contig23570___0	contig23570___0	Unknown	
2785	34	79	unmapped	0		0	ACATTGAGCCAAGGATGGGTATACGGAGTCTGACCACCAATCAGCCTCAAAGTCAGCTCA	2712	0	UF_Msa_CF_123908	contig16065___0	contig16065___0	Unknown	
2786	34	80	unmapped	0		0	ACAGAGAATCAGGAAACGACCAGCCGCTGCTGCAAATCACAAGAAAGCTCCCCATCATGG	2714	0	UF_Msa_CF_123274	contig05756___0	contig05756___0	Unknown	
2787	34	81	unmapped	0		0	AAGAAGACGACTCTGGACAAAGTGTTGCAGCAGCCAGGAGTGACTGCAGAAGGTGTTGGA	2716	0	UF_Msa_AF_101599	contig05597___1rc_nrnt	contig05597___1rc_nrnt	Unknown	
2788	34	82	unmapped	0		0	ATAAAAGATGGCTTGTTGGATGAGATGAGCGAGGAGGAGGGGGGCAGGAGTTGGAGCCAG	2718	0	UF_Msa_CF_127450	contig20445___0	contig20445___0	Unknown	
2789	35	1	unmapped	0		0	AACTAAGTACCTTTTGAGTCGTGGCCAAAACAAGGACATGTCATCTCAGGCTTTGGGGAA	2719	0	UF_Msa_CF_121401	contig22676___0	contig22676___0	Unknown	
2790	35	2	unmapped	0		0	TATTTTAGCATTTTATAAATTTACAAAAACCCACTGCCATGCAGTCCTGGGACTTGTACA	2721	0	UF_Msa_CF_127459	LMB_S454.935.C1___0	LMB_S454.935.C1___0	Unknown	
2791	35	3	unmapped	0		0	CGAAATATCAGCGGTACAACAGCACAAACGTTTCTGTTGTGGCTCATTACAATACCACTC	2723	0	UF_Msa_CF_118776	contig26277___0rc	contig26277___0rc	Unknown	
2792	35	4	unmapped	0		0	TTCTCCAACGAAAAGATCATCAACCTGCCTGTGGAAGAATTCAACGAGCTTCTAGCCAAG	2725	0	UF_Msa_AF_100413	contig15087___1_nrnt	contig15087___1_nrnt	Unknown	
2793	35	5	unmapped	0		0	AACGTAATTACAAGGTGACAACATGTGGAATCAGGGAGGTTACAGTGAGTCGAGTACGGT	2727	0	UF_Msa_AF_106843	LMB_S454.972.C1___1_nrnt0	LMB_S454.972.C1___1_nrnt0	Unknown	
2794	35	6	unmapped	0		0	AATAGGCGGACACTGGAAGGTACAGACAAAGTCCAAAAAGGCGGGTAATCCAGACTCCAA	2729	0	UF_Msa_CF_123598	contig17103___0	contig17103___0	Unknown	
2795	35	7	unmapped	0		0	GGACCCGAGAGAAAGCAGCCATGCTGGTTTCGTCTGTGCTGTTGAAAATCAACTGCACTG	2731	0	UF_Msa_CF_126762	contig20463___0	contig20463___0	Unknown	
2796	35	8	unmapped	0		0	TGAGAAACAAAAAAGAAACATGGACCTGGGTCAACAACACTGTGCTGGGAGAGAGTTATT	2733	0	UF_Msa_AF_102863	contig31877___1_nr1nt0	contig31877___1_nr1nt0	Unknown	
2797	35	9	unmapped	0		0	AAGGTTCCACTGAGTGAGTTTGAATTTTCCTGGAGTAAAATCTCAGATATCCAGTCACAG	2735	0	UF_Msa_AF_106010	contig13474___1_nrnt	contig13474___1_nrnt	Unknown	
2798	35	10	unmapped	0		0	TCAATTCGAAACCGTCAACATACGGGACAAAAAACCAATCCGTTTTGAGGTTTGGGACCG	2737	0	UF_Msa_AF_104234	contig18087___1_nrnt0	contig18087___1_nrnt0	Unknown	
2799	35	11	unmapped	0		0	TGCACTGCAGACAAAACATGGAAACAAGTCCTTATAGTGACTGAGTGGGACTTGCTCAAG	2739	0	UF_Msa_CF_123932	contig11469___0rc	contig11469___0rc	Unknown	
2800	35	12	unmapped	0		0	ATTTCAGCAGCAGCAGAAATGCCCTGAATGTGTATTTTGTCAAAGTTTCGTGGGGGTGGA	2741	0	UF_Msa_AF_102848	contig12925___1rc_nrnt0	contig12925___1rc_nrnt0	Unknown	
2801	35	13	unmapped	0		0	TGTGCAATATTGTAAAGAACTACACCCTGTGGAAAGTGGGAGATTATGGAGAGGTCAGCG	2743	0	UF_Msa_AF_109161	contig06570___1rc_nrnt	contig06570___1rc_nrnt	Unknown	
2802	35	14	unmapped	0		0	CAGTTCACGCCATCACCGCCACACAGAAGACCGTTGATGGTCCCTCTGGTAAGTTGTGGA	2745	0	UF_Msa_AF_107799	contig28194___1_nrnt	contig28194___1_nrnt	Unknown	
2803	35	15	unmapped	0		0	CCTTCCTCCTGATGTCTGTGGTATTGATGATGGTGCTGCTGATGGGCATCATCATCTTCC	2747	0	UF_Msa_CF_125403	contig25150___0rc	contig25150___0rc	Unknown	
2804	35	16	unmapped	0		0	GCACATCGCACTCTTGAAGACATCACATAAATGCCACTGAAAGGAAAGAGCGCTAGACAT	2749	0	UF_Msa_AD_200155	DQ666526_rc	DQ666526_rc	Unknown	
2805	35	17	unmapped	0		0	TGATGCCAATGCCTACATCTACAGAAAAAACCCTGCACTTCTGGAAGATTTGCCAGACCA	2751	0	UF_Msa_AF_108565	contig32367___1_nrnt	contig32367___1_nrnt	Unknown	
2806	35	18	unmapped	0		0	AACCCACAGAGAAAGCAGAAGATGTGGGGTAAAGTCAAAAGTAAGATGTTCAAGATTACA	2753	0	UF_Msa_CF_124634	contig03864___0	contig03864___0	Unknown	
2807	35	19	unmapped	0		0	AAGGGTTTTTATTCTATTACCATGTGCATAATCGGCCCCCTCTGGATGCTCACATCCACA	2755	0	UF_Msa_AF_106493	contig03911___1rc_nrnt-1	contig03911___1rc_nrnt-1	Unknown	
2808	35	20	unmapped	0		0	TGCTGAGACAGCTCAGCCAACAGCAAAACCTACAGAGCAAGGAGATCCAGCAGAGCCCAA	2757	0	UF_Msa_CF_125507	contig19294___0	contig19294___0	Unknown	
2809	35	21	unmapped	0		0	ATAGATGAATTTGCATTTCTTGAAGGCACGCTTGATTAAATGCTGCTTCACGAGATGAGA	2759	0	UF_Msa_AF_107934	LMB_S454.205.C1___1_nrnt	LMB_S454.205.C1___1_nrnt	Unknown	
2810	35	22	unmapped	0		0	TCCGATGGCGGTGAGATTTCAATTGATTGCTACAGTGAGTTACAGAACATCTTCCTGGTG	2761	0	UF_Msa_CF_121585	contig21738___0	contig21738___0	Unknown	
2811	35	23	unmapped	0		0	AGCCGCCACTGCTCTCCACTACCCTCTGGCCTGCACACATTGCCTTCAGGGTCTGGAAGA	2763	0	UF_Msa_CF_125197	contig11617___0rc	contig11617___0rc	Unknown	
2812	35	24	unmapped	0		0	GAACTTTCTGCAGAGAGCTGTCAAACCTGCGTCTGTGGACAAGTGGATCAAACAAAACAA	2765	0	UF_Msa_AF_107484	contig08501___1rc_nrnt0	contig08501___1rc_nrnt0	Unknown	
2813	35	25	unmapped	0		0	TGTATGTCAGACATCACTAGGGCGACACGTGAGCTGCTACATCAAGGATAAACAAGTTTT	2767	0	UF_Msa_AF_104314	contig08682___1rc_nrnt0	contig08682___1rc_nrnt0	Unknown	
2814	35	26	unmapped	0		0	CTCAACTCAGTTTATTTACAGAGTATTTGAAGAGCCATGTATGCAAATGTACTGAAGTTA	2769	0	UF_Msa_AF_104312	contig09247___1_nr0nt	contig09247___1_nr0nt	Unknown	
2815	35	27	unmapped	0		0	AGACAGAAGAAACTCCAGCGTACACAGAGCTGAAACGTGAGAGCGAAGAAGAGAAAATTG	2771	0	UF_Msa_AF_106830	contig26609___1_nrnt0	contig26609___1_nrnt0	Unknown	
2816	35	28	unmapped	0		0	CAGCGCTAGATTCAAACAGCAGAGCAACACAGCAGCTGAACCAAGAAAAGGAAAAGTAGA	2773	0	UF_Msa_AF_101764	contig21866___1rc_nr0nt	contig21866___1rc_nr0nt	Unknown	
2817	35	29	unmapped	0		0	CACCAAAATCGAGTGTTCAGTCAACAGCTGTGACCACGCTGAAGCTCACCGTCAGTCCAA	2775	0	UF_Msa_CF_122648	contig17544___0rc	contig17544___0rc	Unknown	
2818	35	30	unmapped	0		0	TTTGAAAGGCTGGCATCTTCTCTCTGCCCTGCTGATGTCTTTGATGTGTAATCTTGATCT	2777	0	UF_Msa_AF_108931	contig27537___1_nr1nt0	contig27537___1_nr1nt0	Unknown	
2819	35	31	unmapped	0		0	AAGGGTCTGGAGTTATTTCTTTTGTTGCGCATCAAAATGAGTACTTCTCAACTTTTTCAC	2779	0	UF_Msa_AF_100722	contig32708___1_nr0nt1	contig32708___1_nr0nt1	Unknown	
2820	35	32	unmapped	0		0	ACTTCTCTCAAAGCAGCCACAACACTCGAAAACCAGGACATAAAGTTCACGAAGATGATC	2781	0	UF_Msa_CF_125178	contig09020___0	contig09020___0	Unknown	
2821	35	33	unmapped	0		0	ACAAATGCAGTCACTATTTTTCAAGGAAAATGTGGTCGTGTTCACAGAAAAGTAACAGCT	2783	0	UF_Msa_CF_122363	contig32281___0rc	contig32281___0rc	Unknown	
2822	35	34	unmapped	0		0	ATTTTGGCCGTGCAGTTTCCCTGAAGAACTTCATCCTACGAAAGGGCAAGTCCACTAGTG	2785	0	UF_Msa_AF_104464	contig02916___1rc_nrnt0	contig02916___1rc_nrnt0	Unknown	
2823	35	35	unmapped	0		0	GTGTCATTACCCCTAAAGCTGGCTTTGACCCAGAGTATGACCAGGCTCTGATCGGAGTCC	2787	0	UF_Msa_AF_104194	contig13437___1rc_nrnt	contig13437___1rc_nrnt	Unknown	
2824	35	36	unmapped	0		0	GTGTTCGAAAGATGTTGATGATTTCCTGTGCAAATGCCTCAACTTGCTGTACTTAATAAA	2789	0	UF_Msa_AF_106697	contig05736___1_nr0nt1	contig05736___1_nr0nt1	Unknown	
2825	35	37	unmapped	0		0	AACACTTGCCTGGTTTCTGGTGGTACTTCCCATCCTAATACAAACCACTCATGGACAGTT	2791	0	UF_Msa_CF_125259	contig21569___0	contig21569___0	Unknown	
2826	35	38	unmapped	0		0	AACAGTTGATATGGCCTTGGCAGCACCGGATCGCTTTGTCCTAGAAGCCACAGCGAGAGG	2793	0	UF_Msa_CF_118175	contig00623___0	contig00623___0	Unknown	
2827	35	39	unmapped	0		0	GCCGATTCTCCTCACTCAAACCACCATATCTGGAATAAAACCTTTGCTACTGTCAATAAA	2795	0	UF_Msa_CF_121423	contig18523___0rc	contig18523___0rc	Unknown	
2828	35	40	unmapped	0		0	AAACGACATGCAGCTGTAGTTTGGCCGTCCAGCTTGCTGCTGTCAGGGAGAGTGTCCTCA	2797	0	UF_Msa_AF_101409	contig01500___1rc_nr0nt	contig01500___1rc_nr0nt	Unknown	
2829	35	41	unmapped	0		0	TGTGTTCAATGAACATCGGATGCACATTTCCTCCATGTATGAACACTGCATCCGGATGAG	2799	0	UF_Msa_AF_100685	LMB_S454.sd.351.C1___1rc_nrnt	LMB_S454.sd.351.C1___1rc_nrnt	Unknown	
2830	35	42	unmapped	0		0	GTAGGGTTAGGTATCATTTAAAATTTTACGATACAAGTGCCAAAACCAGTACCCTTAAAG	2801	0	UF_Msa_CF_119975	contig00468___0rc	contig00468___0rc	Unknown	
2831	35	43	unmapped	0		0	TTGACTCGAGTTAAAATCATTGCAGTGTTACGGTTTTGATTATAAATTAAAATTATAACG	2803	0	UF_Msa_AF_108239	contig03411___1_nr0nt	contig03411___1_nr0nt	Unknown	
2832	35	44	unmapped	0		0	CCAAATATCTTTCAAAAACTCAAGTGCCACACATACATGTGTATCAAAAGGAGGGAAGCA	2805	0	UF_Msa_CF_121911	contig25992___0	contig25992___0	Unknown	
2833	35	45	unmapped	0		0	AGCCTCTCCGGGCCTCAGTCCCCATCTCTGCCCCAGAAGACCCTGCAGAACAACACCGAG	2807	0	UF_Msa_CF_127684	contig08909___0rc	contig08909___0rc	Unknown	
2834	35	46	unmapped	0		0	GCAGCCGCAACTACAGCACCTCCTCAGACCCCGACCGCGACCGGGGTCGAACCATCCCGA	2809	0	UF_Msa_AF_101320	contig21247___1rc_nrnt0	contig21247___1rc_nrnt0	Unknown	
2835	35	47	unmapped	0		0	TCCCCCATCATTCCCTGCCTGAGATGAACATCAGCTCTCCTGCTTGTCTTTGACCAAAAG	2811	0	UF_Msa_CF_124399	contig04634___0rc	contig04634___0rc	Unknown	
2836	35	48	unmapped	0		0	TTAAACCAGAGTATGGTCCCACTTCCTAGCTGCGTGATGGCACCCCGAGTCAGCTGACAG	2813	0	UF_Msa_CF_127374	contig04715___0rc	contig04715___0rc	Unknown	
2837	35	49	unmapped	0		0	CATATGTGAAGGTGTGGTTGATGCACAAGGACAAGCGTGTAGAGAAGAAAAAGACAGTGA	2814	0	UF_Msa_AF_107489	contig11861___1_nrnt	contig11861___1_nrnt	Unknown	
2838	35	50	unmapped	0		0	CACTTGAAAACATGGCTCCAAATTATTTTTCATGGTGGTTAATGTCAGTCTTAAGGCATA	2816	0	UF_Msa_AF_107454	contig16629___1_nrnt	contig16629___1_nrnt	Unknown	
2839	35	51		1028	E1A	0		643	1	(+)E1A_r60_a22	E1A_r60_a22	E1A_r60_a22		CONTROL
2840	35	52	unmapped	0		0	TTATGAAAGCTTTTTAGTAACTCCTTCCTTGTTGAGGGTGGAGGAGGGGCTGGATCCTAT	2819	0	UF_Msa_CF_120574	contig27573___0	contig27573___0	Unknown	
2841	35	53	unmapped	0		0	AACCATGAATCCATGGTTCCTTTTAAATCGAGACTGCTGTCACTGAAGAACCTCGGCTCA	2821	0	UF_Msa_AF_105234	contig06032___1rc_nrnt0	contig06032___1rc_nrnt0	Unknown	
2842	35	54	unmapped	0		0	TCACCATAAAGGAGGGGTCTCAGCTCAAACCGCAGATTCAGTCTGTTCAACTGGCTATTG	2823	0	UF_Msa_AF_100231	contig26685___1rc_nrnt	contig26685___1rc_nrnt	Unknown	
2843	35	55	unmapped	0		0	ACAGGAAACACACAGGCCACCGGCCATTCCAGTAGTACAGAAATGTGACAGGGCCTTCTC	2825	0	UF_Msa_AF_109495	contig21283___1rc_nrnt	contig21283___1rc_nrnt	Unknown	
2844	35	56	unmapped	0		0	AGTGTCCTCCACACCACCTGCGTATCCTCAGGATCAAAGACCCCCTATGGAGAAACATGG	2827	0	UF_Msa_CF_126077	contig14205___0	contig14205___0	Unknown	
2845	35	57	unmapped	0		0	TCTGTCGAGTCAGTTGTTGGTGTGTAGAGTAGCTCAAGGTGAAGTGTCATCATGACTTGA	2829	0	UF_Msa_CF_122841	contig17773___0	contig17773___0	Unknown	
2846	35	58	unmapped	0		0	TCACCTGCACCATACTGGGACGGTGGTCTTCTGAACCTCCTCACTGTATACGCAGTGACG	2831	0	UF_Msa_AF_110169	contig02224___1_nrnt	contig02224___1_nrnt	Unknown	
2847	35	59	unmapped	0		0	AGCTACACTGCGGACATCTCAGAAAATGTGTACCAGCTGCTGCAATCGTAAAATCCTCTA	2833	0	UF_Msa_CF_118327	contig12908___0rc	contig12908___0rc	Unknown	
2848	35	60	unmapped	0		0	ACATATGGTCCAAAGGAAGGACAGTGGTTTCTAGCTCAGTTGACTGTAGCTGGAAATGAC	2835	0	UF_Msa_CF_120466	contig23152___0	contig23152___0	Unknown	
2849	35	61	unmapped	0		0	TCACGCAGTGCATTCCTCCACCGGCGGGTTATACTGCTTCATTTGTGGCTATTTTGATTT	2837	0	UF_Msa_CF_118430	contig18552___0rc	contig18552___0rc	Unknown	
2850	35	62	unmapped	0		0	AGCCAGATGCTCCAGCTGTACTGAAGACTCTGACCGTGTCTCCAGATCCGATCTCCATCC	2839	0	UF_Msa_AF_107900	contig32383___1rc_nr1nt0	contig32383___1rc_nr1nt0	Unknown	
2851	35	63	unmapped	0		0	CATTGAATGCCAGAATGCCCCCACAGTTGATGAGTGCCTGAAAAAGATTATGCGTAAAGA	2841	0	UF_Msa_AF_107763	contig00720___1_nrnt	contig00720___1_nrnt	Unknown	
2852	35	64	unmapped	0		0	AAACTGGCTAAGTTCCAGGGGGGTGAAGAGATGAGGCTGGTCAAAATGGCCCACAGACAT	2843	0	UF_Msa_CF_118765	contig05653___0	contig05653___0	Unknown	
2853	35	65	unmapped	0		0	GTCATCCTCTTTGATAGACACCCAGACGGTGTGGCATCGATCGCATTTAAGGAGCCTGAG	2845	0	UF_Msa_AF_108267	contig00808___1rc_nrnt-1	contig00808___1rc_nrnt-1	Unknown	
2854	35	66	unmapped	0		0	AAAGAAAACCTATGCCTCCCATCGGCCACAAGATGGCGTGCCAGCAGAGGTGAAGCAGCA	2847	0	UF_Msa_AF_106570	contig24498___1_nrnt0	contig24498___1_nrnt0	Unknown	
2855	35	67	unmapped	0		0	AATCTTCATCTCTATCCCTGTGGTCACCTTTGTTTACGTGTTTGCCAATGTGGCCTACAT	2849	0	UF_Msa_CF_125732	contig10499___0	contig10499___0	Unknown	
2856	35	68	unmapped	0		0	ATATGAATATGGAGACAATGTGGACAAGTACAAGAAATGTGAGCCGCTGGCGTCTTCCAG	2851	0	UF_Msa_AF_108202	contig05805___1_nrnt	contig05805___1_nrnt	Unknown	
2857	35	69	unmapped	0		0	AAAGCTCCAGGAGCACCAGGTCCGAAAGCTCCAGGAGCACCAGGTCCGAAAGCTCCAGGA	2853	0	UF_Msa_AF_102457	contig02880___1_nr0nt1	contig02880___1_nr0nt1	Unknown	
2858	35	70	unmapped	0		0	CTCGCCAGCTAACTGATTATTGGTTTCTACTTTCTTTAATCTGATATAAACCGATTGACT	2855	0	UF_Msa_AF_105710	contig27472___1_nr0nt1	contig27472___1_nr0nt1	Unknown	
2859	35	71	unmapped	0		0	GTGCATTTATTAGGAGTAGGGACATGGGGACAAAGACCTTTGTTGATAGTTCGTCAGTGC	2857	0	UF_Msa_AF_109209	contig29021___1_nr0nt1	contig29021___1_nr0nt1	Unknown	
2860	35	72	unmapped	0		0	TACGTTTCTACAAAGAGGTGGCGGAGTCGGGTGAAACTGAAGAGAAAGCGCAGCGACCCG	2859	0	UF_Msa_CF_124809	contig22561___0	contig22561___0	Unknown	
2861	35	73	unmapped	0		0	CATGTTCAGAGAGGTTTATATGAACTGCCATCTCATTTTCTACACTTGTAATTAAGCAGA	2861	0	UF_Msa_CF_121481	contig32487___0	contig32487___0	Unknown	
2862	35	74	unmapped	0		0	TAGTTACTACTGTCTTCCAGCTGATGGCGCAGTGTGACTTTTTAGTAAATGTCTCTCATG	2863	0	UF_Msa_CF_123383	contig31251___0rc	contig31251___0rc	Unknown	
2863	35	75		1028	E1A	0		479	1	(+)E1A_r60_1	E1A_r60_1	E1A_r60_1		CONTROL
2864	35	76	unmapped	0		0	AAGCTTGCTGCAATGAAAGAAAAACGCCTCCAGAACCAGAAACTGGGTAAAGTCAAGACC	2866	0	UF_Msa_AF_108625	contig28056___1_nrnt	contig28056___1_nrnt	Unknown	
2865	35	77	unmapped	0		0	TCTTCTCAGATGAGGATCACAAAATGGATGTTGATGTACAGAAAGCAAGTGCTATCACGG	2868	0	UF_Msa_CF_127250	contig17023___0	contig17023___0	Unknown	
2866	35	78	unmapped	0		0	CGAAGAAAATCTGTCCAAGCCTGTATCTGTTAGAAGTATGTGAATGTCATGCAGACAGTA	2870	0	UF_Msa_CF_117965	contig27947___0rc	contig27947___0rc	Unknown	
2867	35	79	unmapped	0		0	CCCTGATACTTGGACATTCAAACCTAATAAAAGTCACCTGGAGTCCTTAACTATCATACC	2872	0	UF_Msa_AF_102208	contig23651___1rc_nrnt0	contig23651___1rc_nrnt0	Unknown	
2868	35	80	unmapped	0		0	GAGAAAGGTATATATTTATGTACTGCAGTGTTTGAAGGCTGACTCACCAACCTCTCTCCA	2874	0	UF_Msa_CF_120795	contig30134___0	contig30134___0	Unknown	
2869	35	81	unmapped	0		0	TCTTTCAAAGCCTCGGAGAACACAGACTCGAGGTAATCTCCCCTTAAAACAAGACAGGAA	2876	0	UF_Msa_CF_124496	contig12990___0rc	contig12990___0rc	Unknown	
2870	35	82	unmapped	0		0	CTGTGAGAAAACCTTCCGAGATAAAACCACTCTGAAGGATCACATGAGGAAGAAAGCTCA	2878	0	UF_Msa_AF_103700	contig27365___1rc_nrnt	contig27365___1rc_nrnt	Unknown	
2871	36	1	unmapped	0		0	GCTGATGAGGGAGAGAGCCAAGGAGCACTGTGCTGAGAAAGTTGAAGCCTTCAACCACTG	2720	0	UF_Msa_AF_110233	LMB_S454.1109.C1___1_nrnt	LMB_S454.1109.C1___1_nrnt	Unknown	
2872	36	2	unmapped	0		0	ACGGATCCGGCGGAGTAGATGTCGGCCACGGTGGGAAGAGAAAGAGGCTCTTTTCCAAGG	2722	0	UF_Msa_CF_122218	contig29915___0rc	contig29915___0rc	Unknown	
2873	36	3	unmapped	0		0	CCATGAAGCAGGTTCTTGGAGTGATTAGACAAGAAGGTCCGCAACATGGAAAAGAAAAAG	2724	0	UF_Msa_CF_118845	contig05433___0rc	contig05433___0rc	Unknown	
2874	36	4	unmapped	0		0	AAGGAATGCAGCAGAATGCTCATTATTATGGCTGTCAAACCGGGTGGCGATTAGATAAAA	2726	0	UF_Msa_CF_124319	LMB_S454.903.C1___0	LMB_S454.903.C1___0	Unknown	
2875	36	5	unmapped	0		0	GTCAGCAACACTCATTTTTAAAGTATTCAACTTTTCTCCAATGTGCATAGGCAGACATTT	2728	0	UF_Msa_CF_122434	contig01841___0rc	contig01841___0rc	Unknown	
2876	36	6	unmapped	0		0	AGAAGGCTCTCGGCAAAGATGACTTCACCAAGATCCCTTATGGAGTGAACGGAGTGGAGG	2730	0	UF_Msa_AF_108395	contig19669___1rc_nrnt0	contig19669___1rc_nrnt0	Unknown	
2877	36	7	unmapped	0		0	AAACACATGGAGCTGGTCAGTGCGTATGTGAGCGTGTTGCGGCGCTTCATGGTGTGTCTC	2732	0	UF_Msa_CF_126301	contig16024___0	contig16024___0	Unknown	
2878	36	8	unmapped	0		0	TTTGTCATAGGGACTTGTTGGGTAGCAAGGTGATTTGGGAGTTGCTCTGCTTTTATCATT	2734	0	UF_Msa_AF_106105	contig05065___1_nr0nt	contig05065___1_nr0nt	Unknown	
2879	36	9	unmapped	0		0	GCAGCAAGAACGCATCACACACCTACTTCATTGACCTGAACAAGAAGGAAAACAAAAATT	2736	0	UF_Msa_AF_103355	contig10345___1_nrnt	contig10345___1_nrnt	Unknown	
2880	36	10	unmapped	0		0	TGGTCTCTAATGGCAACGCCTCCAACAGACTTCACAGGCTGTCGGCGTGACCAAGATTGC	2738	0	UF_Msa_AF_109519	contig29968___1rc_nrnt0	contig29968___1rc_nrnt0	Unknown	
2881	36	11	unmapped	0		0	AAAGCCAAATGCCAGCAGAAAGGATTCAGCTGAGAGATATTTCTTCGCTAGAATGTATAG	2740	0	UF_Msa_AF_108674	contig22556___1_nrnt0	contig22556___1_nrnt0	Unknown	
2882	36	12	unmapped	0		0	ATGGCTTCAGTTATTTTTGGCGCTTGACTCAGGATTTTAAAAAACTGGACGATGAGGGAG	2742	0	UF_Msa_AF_105830	contig15602___1_nr0nt1	contig15602___1_nr0nt1	Unknown	
2883	36	13	unmapped	0		0	ACATGGGATGGGTCTGGTGTGGGTGCGTCTGTCACTGCTGTCCAAGGGTAAACCAGAACT	2744	0	UF_Msa_AF_108446	contig03427___1rc_nrnt0	contig03427___1rc_nrnt0	Unknown	
2884	36	14	unmapped	0		0	CTTGTGACGAAGCAGAGGACAGAAATGAAGGAGTTGAAATTCAACAACAAGCGCCTTCGT	2746	0	UF_Msa_CF_122439	contig03559___0rc	contig03559___0rc	Unknown	
2885	36	15	unmapped	0		0	ACTTGGTCTCAAAAAGAGACGAGAACGTCTGTAATTTCCTAGAAGGTGGAATGTTGATTG	2748	0	UF_Msa_AF_108535	contig30659___1rc_nrnt	contig30659___1rc_nrnt	Unknown	
2886	36	16	unmapped	0		0	ACATTGAAGAGGAACAAAAAGGAGACCTAGCAGCGGTTTTTACACTCCCTCCACTTTCTC	2750	0	UF_Msa_AF_102935	contig20231___1_nr0nt1	contig20231___1_nr0nt1	Unknown	
2887	36	17	unmapped	0		0	TAAATCTTCAGTACAGCCCGGCCATCAAGGAGCTGGAGAGTTCAATCTCTGTCATAAAGA	2752	0	UF_Msa_AF_102259	LMB_S454.sd.653.C1___1rc_nr1nt0	LMB_S454.sd.653.C1___1rc_nr1nt0	Unknown	
2888	36	18	unmapped	0		0	GTCATTGGTCTGGAGGTGTTTTGGCTATAATATGCATATGTTAAATATAAAGAGAAGGAG	2754	0	UF_Msa_CF_125057	contig18021___0	contig18021___0	Unknown	
2889	36	19	unmapped	0		0	TGAGATGGGTATGAAGGCTTTTGAGCTAGTCCCCGCTGTGGAGCGAGATCTCCTCATGGG	2756	0	UF_Msa_CF_118423	contig11611___0rc	contig11611___0rc	Unknown	
2890	36	20	unmapped	0		0	ATTAGTGACATTTAGATGACTGGACCCCACACCGTGTGCAAGACTACCATGTTCCAAATG	2758	0	UF_Msa_CF_122536	contig15699___0	contig15699___0	Unknown	
2891	36	21	unmapped	0		0	TATCCAAAGAAGACTCTTGCTCCCTCGTTTTAACCGCCGAGCTAACTTTACGGAACTAAC	2760	0	UF_Msa_CF_125462	contig15191___0rc	contig15191___0rc	Unknown	
2892	36	22	unmapped	0		0	ACACGCGCAGCAGCCGGTGTCTGAACAGGTTTACAGACGAAGGCTGCGTGAAGGGAACGT	2762	0	UF_Msa_AF_105674	contig27788___1_nrnt0	contig27788___1_nrnt0	Unknown	
2893	36	23	unmapped	0		0	GCTCGCGCTCACACCGCGTCTGCCCAGCTTCGGGCTGAGCTGGCCATCGTAGCCAATCAG	2764	0	UF_Msa_AF_105558	contig25668___1_nrnt	contig25668___1_nrnt	Unknown	
2894	36	24	unmapped	0		0	AGTAAACAAATATCTGACGTCGGCCAATGACAACAGATGTCAAGCTAGCTAACTAGCCCG	2766	0	UF_Msa_CF_123794	contig23703___0	contig23703___0	Unknown	
2895	36	25	unmapped	0		0	AGAGCTGGAGGGGCTGCTGGACGTGGTAAAGACCAGAGTCCAGGACCTTGAGGACCGCTA	2768	0	UF_Msa_AF_101280	contig30744___1rc_nr1nt0	contig30744___1rc_nr1nt0	Unknown	
2896	36	26	unmapped	0		0	AGTTTCGGAACTTTCTAACTGAACGCTTTACTAACGTGGCTGTGGAGATATTTGCAGAAG	2770	0	UF_Msa_CF_123597	contig01624___0	contig01624___0	Unknown	
2897	36	27	unmapped	0		0	TAACGCTGCTACTGTTGACGGTGAAACAGTTGAATCCTCGTTGGTGTTTCTGGTTAAGGA	2772	0	UF_Msa_AF_103628	contig27019___1_nr1nt0	contig27019___1_nr1nt0	Unknown	
2898	36	28	unmapped	0		0	ATCTTTGCTGTAATCCTTGCTCTGACTGTCCTGTCAGGTTGCCATGCAAGAAGTGTGTTT	2774	0	UF_Msa_AF_101299	LMB_S454.sd.387.C1___1rc_nrnt	LMB_S454.sd.387.C1___1rc_nrnt	Unknown	
2899	36	29	unmapped	0		0	AGACTGGACAAATATTGCTAACCTAAACAGTCCCACTAAATTGATTAACATTTACCCCCC	2776	0	UF_Msa_CF_118983	contig27544___0rc	contig27544___0rc	Unknown	
2900	36	30	unmapped	0		0	AAGGACGTGAGAGCAGCTACCGACATTTTGGAGTCTCTCTGACCTCCACCGTCTGCTGTC	2778	0	UF_Msa_CF_117718	contig12473___0rc	contig12473___0rc	Unknown	
2901	36	31	unmapped	0		0	AACCATAAAAGAACGTGAAATGAACAAACCACCACAGCCTATAACGGGACCCACGTCTGT	2780	0	UF_Msa_AF_110151	contig06897___1rc_nrnt	contig06897___1rc_nrnt	Unknown	
2902	36	32	unmapped	0		0	AAATACAGACAACAGGGCAGGAACTACATCGTGGAAGACGGGGACATTATCTTTTTCAAA	2782	0	UF_Msa_AF_104805	contig18121___1rc_nrnt	contig18121___1rc_nrnt	Unknown	
2903	36	33	unmapped	0		0	TGCTGTGCATAAGATAGGAACAGCGAAGGCAAAGAAGAGACAGAGCTACACTAAAGCAAA	2784	0	UF_Msa_CF_125395	contig32549___0rc	contig32549___0rc	Unknown	
2904	36	34	unmapped	0		0	GACTCTGTGTCGCTGGTGTCAGTGCCGCTGCTGGTAGATCCGTCGATCATTTGGACTGGC	2786	0	UF_Msa_AF_105986	contig06323___1_nr0nt1	contig06323___1_nr0nt1	Unknown	
2905	36	35	unmapped	0		0	GAATAACACTGACACTTCACCTACAACTGTAGTGTTTACATCCTGGATAGACAGTCCCCA	2788	0	UF_Msa_CF_124379	contig21760___0	contig21760___0	Unknown	
2906	36	36	unmapped	0		0	GACCACTTAACAAGCTTAATTAACAAGTCATCAATCGCTAAGTAATGTGCATAATGTCCA	2790	0	UF_Msa_AF_108859	contig30565___1_nr0nt1	contig30565___1_nr0nt1	Unknown	
2907	36	37	unmapped	0		0	TTTGGCAGAGAGAGAAACTCCGGCACAAAGCTCTTCAACATCTCTGGCCATGTTAATCAT	2792	0	UF_Msa_AF_102374	contig24261___1rc_nrnt	contig24261___1rc_nrnt	Unknown	
2908	36	38	unmapped	0		0	CTGTCCATCATCTGAGGTTTAAAAGCAGCAAGAAGAAAGGTGCTGCCAGGACAGTACAGG	2794	0	UF_Msa_AF_108663	contig10926___1_nr0nt	contig10926___1_nr0nt	Unknown	
2909	36	39	unmapped	0		0	TGTGGCTGCAAAAATCTCTGAGATTAAAAAGAAGAGCATGGACAAGGCGAAGCAAGAGGA	2796	0	UF_Msa_AF_107069	contig18176___1_nrnt	contig18176___1_nrnt	Unknown	
2910	36	40	unmapped	0		0	AGAACACCAACGACAGCAACGAAAGAGAGAGAATAACGAAGCAAGAATCAGCTACGCAAT	2798	0	UF_Msa_CF_123826	LMB_S454.sd.15.C1___0	LMB_S454.sd.15.C1___0	Unknown	
2911	36	41	unmapped	0		0	CGCCGATTTACCTCCAACAGTGCCCTGGAGGAGCATGTGCTGGCCCATTTCCAAGGAACC	2800	0	UF_Msa_CF_118813	contig19333___0	contig19333___0	Unknown	
2912	36	42	unmapped	0		0	TCACCGGCTCTGACGTGGTGACGCTGGCCAGTAACCTGAATGACCCCCAGGACATCATAG	2802	0	UF_Msa_AF_106517	contig22698___1_nrnt	contig22698___1_nrnt	Unknown	
2913	36	43	unmapped	0		0	AATATATCTACACGAGTAGCTAAGAACTCTTTTTCCACGCTCGGGGAGAGTCTTGACGCT	2804	0	UF_Msa_AD_200279	AF375975	AF375975	Unknown	
2914	36	44	unmapped	0		0	CTCCATTGTCAGAACAAGAAGAAAGGTCAGAAGATGAGGACATTAAAGTGGTGGAAAGGA	2806	0	UF_Msa_CF_118534	contig17474___0rc	contig17474___0rc	Unknown	
2915	36	45	unmapped	0		0	CGCACACTGAATTTACTTCTAGTTAACTTGACGTTTCAAAAATCCAAATGAAACGAAGTG	2808	0	UF_Msa_CF_126152	contig32027___0	contig32027___0	Unknown	
2916	36	46	unmapped	0		0	TACCAGCTACAGGCCCAGATGAACAGAGCAGTCTATGATGAGAGGCCTCCGGGCAGTTTG	2810	0	UF_Msa_AF_109979	contig01548___1rc_nrnt	contig01548___1rc_nrnt	Unknown	
2917	36	47	unmapped	0		0	GTCCATCTCTCTTTGCCAGTCGCTGGTCGCCGCACCGTGTCCTCCACCAGATAAAGGACA	2812	0	UF_Msa_CF_117973	contig21686___0	contig21686___0	Unknown	
2918	36	48		1028	E1A	0		799	1	(+)E1A_r60_n9	E1A_r60_n9	E1A_r60_n9		CONTROL
2919	36	49	unmapped	0		0	TATCTTGGGTGGCAACAAGCCCAAGAGGAGGGTGCAGCCTATCAGATGCTCAGCAGATCC	2815	0	UF_Msa_CF_124966	contig24695___0	contig24695___0	Unknown	
2920	36	50	unmapped	0		0	GGACAGGCGGCTGACAACAACAAAAGGGAGGAGCAGAATTTAAAGGAGGCCTCTACTACA	2817	0	UF_Msa_CF_121253	contig10868___0rc	contig10868___0rc	Unknown	
2921	36	51	unmapped	0		0	TGACAGAACTGTCTGCCACTGTTTCCTCCACTTTGGCCTCCTACACCTTCCTGGAGCAGG	2818	0	UF_Msa_AF_108569	contig24087___1_nrnt0	contig24087___1_nrnt0	Unknown	
2922	36	52	unmapped	0		0	GATCGCTGCCTGCACATCAGGCAGCAGGCTGAAGGCCTTTCTGGAACATTTCTCCACAGT	2820	0	UF_Msa_AF_100795	contig08838___1_nr0nt	contig08838___1_nr0nt	Unknown	
2923	36	53	unmapped	0		0	CTCAGTGACCGCTTCATCGGCCTGGACGAGTGATGACATCATGAAGGGATGTATTGTCAC	2822	0	UF_Msa_CF_123706	contig10134___0	contig10134___0	Unknown	
2924	36	54		0		0		2824	1	RC2	RC2	RC2		CONTROL
2925	36	55	unmapped	0		0	CCCTACAGAAAGAACTAGAAACACTGAGATCTACTGTGACTGATTTAAAACTCTCCTCAG	2826	0	UF_Msa_AF_110078	contig27215___1rc_nr1nt0	contig27215___1rc_nr1nt0	Unknown	
2926	36	56	unmapped	0		0	TGCCGTCAGAAACAGGAACTGAGAGAGTGGGTACAGACAGAGAAATGGTGGAAGCTTCAG	2828	0	UF_Msa_CF_124757	contig03730___0	contig03730___0	Unknown	
2927	36	57	unmapped	0		0	GCTAAAATGGGATTGTTTGTGTGGCAGTGTAAAATGTACAGCAATACTTTTTAAAATGGG	2830	0	UF_Msa_AF_103248	LMB_S454.632.C1___1_nrnt	LMB_S454.632.C1___1_nrnt	Unknown	
2928	36	58	unmapped	0		0	CACTTTGAATTCGTCACTGCCCGGGAGCCCATGGAACCGCCCACAGTTCCGCAGAACCAG	2832	0	UF_Msa_AF_105825	contig18744___1_nrnt0	contig18744___1_nrnt0	Unknown	
2929	36	59	unmapped	0		0	CAGAGCTGACAAGGCCTTCCTCTACCTGCCCTGGACTATGCATGCCCTTGTTATTCTAAA	2834	0	UF_Msa_AF_109258	contig08929___1rc_nrnt0	contig08929___1rc_nrnt0	Unknown	
2930	36	60	unmapped	0		0	GATAGATTTAAGGAACTTCTTCAGGGCCACATGTTGGAGGAGACTGTCCATCACTCATTG	2836	0	UF_Msa_CF_123584	contig01648___0rc	contig01648___0rc	Unknown	
2931	36	61	unmapped	0		0	TCGATCATACTTTCCCAAATCTCGTGTTCATGACGTATCTTTTAACTATGTGACTTGCCC	2838	0	UF_Msa_CF_118166	contig30314___0	contig30314___0	Unknown	
2932	36	62	unmapped	0		0	AAGTCTATTTTGTACGATGAGCAGAGCGTCCACAAAGTGGGGCCCATCACTAAACACATA	2840	0	UF_Msa_AF_109687	contig28985___1rc_nrnt	contig28985___1rc_nrnt	Unknown	
2933	36	63	unmapped	0		0	TTTAAGTTAATGGTGGCAGAGAAGAAGGGAACAATTCGCTTCTATGACCTGGTGACCCAG	2842	0	UF_Msa_AF_106145	contig29238___1rc_nrnt	contig29238___1rc_nrnt	Unknown	
2934	36	64	unmapped	0		0	TTTGAGTAATCAAAGCTGAAATGGGAAGGGAGGAAGGGACATGAGATGGTGTATAGCACC	2844	0	UF_Msa_AF_102968	contig28342___1_nr0nt1	contig28342___1_nr0nt1	Unknown	
2935	36	65	unmapped	0		0	ATGGAGCCCCATTATCAAAGTGGTCCCAAATAATGCAGATAACTCTGACCCACAACAGCA	2846	0	UF_Msa_AF_104324	LMB_S454.128.C1___1rc_nr1nt0	LMB_S454.128.C1___1rc_nr1nt0	Unknown	
2936	36	66	unmapped	0		0	GGAGGCAACAATGGGACGACAGTCACAGCAGCCGTACTAGCCAACAAGCTGGGTCTCACC	2848	0	UF_Msa_AF_104509	contig04748___1rc_nr0nt1	contig04748___1rc_nr0nt1	Unknown	
2937	36	67	unmapped	0		0	TAAATAGACGATACTTTCGTGACGCATGTCATGTAATGCGTCGTCCCGTGAGAATGGTGA	2850	0	UF_Msa_CF_122797	contig26207___0	contig26207___0	Unknown	
2938	36	68	unmapped	0		0	TGATGTTGACTGCAGCTTTAGCAAACCGGTACATGTTGTCTAACCTGGTGCCTTCAGATA	2852	0	UF_Msa_AF_107471	LMB_S454.336.C1___1_nr0nt	LMB_S454.336.C1___1_nr0nt	Unknown	
2939	36	69	unmapped	0		0	TGACAGGCCGTGCAGTAGCTCCATCTGTCTCCTTTTGTCCTTGGCACGGCTGATAGTCAT	2854	0	UF_Msa_AF_110074	contig09342___1_nr0nt1	contig09342___1_nr0nt1	Unknown	
2940	36	70	unmapped	0		0	AATGCACATGTGCTGAAGAGAACTGCAGTATGCAGAAGAAGGGCAAAATCGACAATGATG	2856	0	UF_Msa_AF_109157	contig09889___1rc_nrnt	contig09889___1rc_nrnt	Unknown	
2941	36	71	unmapped	0		0	TATTGGGAGATTGAAGTTTACAGCAGCACGGTCTGGACTGTGGGGGTGGCCCGAGAGTCA	2858	0	UF_Msa_AF_107804	contig28338___1rc_nr1nt0	contig28338___1rc_nr1nt0	Unknown	
2942	36	72	unmapped	0		0	ATGGCATTATATTTGGCAACATTGTCTATGACGTGTCGGGAGCTGCTAGCGACAGAAACT	2860	0	UF_Msa_AF_108472	contig08072___1rc_nrnt	contig08072___1rc_nrnt	Unknown	
2943	36	73	unmapped	0		0	ACACACTACTAACAGCTGCCTGGATACATTACACTTTGTCTCATCGGGACCTCAAACGTA	2862	0	UF_Msa_CF_125130	contig31147___0	contig31147___0	Unknown	
2944	36	74	unmapped	0		0	CTGTCCCCGTTGGGAGGTTTCTGTGAATGGATTTGGATCGGTGGTCCACACAGGGATGTG	2864	0	UF_Msa_CF_123081	contig14524___0rc	contig14524___0rc	Unknown	
2945	36	75	unmapped	0		0	CAACTCAGACAAAATGACAAATGGTGATATCAGCCCTGAAGAGAAGAAGCAGGAGACGGA	2865	0	UF_Msa_CF_119790	contig07789___0	contig07789___0	Unknown	
2946	36	76	unmapped	0		0	TTCCTCCTTCACGAAGCTCCTCAAGGAAAAATGCTAGTCCAGGTGAAGTACAAACAACAG	2867	0	UF_Msa_CF_126605	contig06314___0	contig06314___0	Unknown	
2947	36	77	unmapped	0		0	TCCCCGGCAAGTAAAGGACCTACCTTTTGATCTTGTTTGTATACAAAGTAAATAAAATAG	2869	0	UF_Msa_AF_101448	contig12081___1rc_nr0nt	contig12081___1rc_nr0nt	Unknown	
2948	36	78	unmapped	0		0	AATGGAACAGATAACACCAGAGGAGGATGAGAAGAAAAGAATCCGCAGAGAGAGAAATAA	2871	0	UF_Msa_AF_100123	contig00601___1_nr0nt1	contig00601___1_nr0nt1	Unknown	
2949	36	79	unmapped	0		0	CCTCTGTGATCGCACCAGCGGCTACAAGCCCTTTTACATTCAAATCAGAAGGCTTGATCC	2873	0	UF_Msa_CF_123593	contig10865___0rc	contig10865___0rc	Unknown	
2950	36	80	unmapped	0		0	AAGGAGGTCTCAGAGTTCTCCACCATTAAGAATAATAGCTTTATGCGGGTGAAGGGCACA	2875	0	UF_Msa_AF_103936	LMB_S454.sd.499.C1___1_nrnt	LMB_S454.sd.499.C1___1_nrnt	Unknown	
2951	36	81	unmapped	0		0	TATTCACGTCTTCGGCAACACCATGAGTACGTTATGGATGGGGAACCTAGAAACCTACAT	2877	0	UF_Msa_CF_123370	contig21840___0	contig21840___0	Unknown	
2952	36	82	unmapped	0		0	AATATGTCCATCCTTAAGATCTGTGACTCCTCAAATCGTCACCAGAGGCGGTTTGTGGTT	2879	0	UF_Msa_AF_107601	contig13257___1_nrnt	contig13257___1_nrnt	Unknown	
2953	37	1	unmapped	0		0	GTGATGAAAATGTCACAGATAATCACACTCGACCCCTACATGAGGCTCGCCATTTTGACT	2880	0	UF_Msa_CF_119045	contig22162___0rc	contig22162___0rc	Unknown	
2954	37	2	unmapped	0		0	TTCTCTCCTGCTTGTTTCACCCTGATTGTGTGCACTGCAGGGATATTCAAGTCCATTGTT	2882	0	UF_Msa_AF_108508	contig26715___1_nrnt	contig26715___1_nrnt	Unknown	
2955	37	3	unmapped	0		0	ATTTCAGATGGTTGGATGCTTTCTCAACACATGTATAACACATGGAGCAAACGCCTCACT	2884	0	UF_Msa_CF_126819	contig29326___0	contig29326___0	Unknown	
2956	37	4	unmapped	0		0	TAGTCTGGCCTTCATGCCTCCCGGTTACCAAGACAACAGCACCACAATCAGTGCCAACGG	2886	0	UF_Msa_AF_106812	contig13265___1rc_nr1nt0	contig13265___1rc_nr1nt0	Unknown	
2957	37	5	unmapped	0		0	AGCTGTGAGTTAGTCCAAGTCCGCCCTGCCTACGCCTCGGCGGTGGTACAAACTGCTGCT	2888	0	UF_Msa_CF_121426	contig10146___0rc	contig10146___0rc	Unknown	
2958	37	6	unmapped	0		0	CCTACTTACTGAGATTCTACTTGTTGCGTGAAACTACCAAATTTAATACCTGACAAATTC	2890	0	UF_Msa_AF_108183	contig23576___1_nr0nt1	contig23576___1_nr0nt1	Unknown	
2959	37	7	unmapped	0		0	TGATGAAATTGTCATTAAGATGCCGGCTGTAGAGAAAGAGGAAGAGTGCTCCTCCTCAGA	2892	0	UF_Msa_CF_120074	contig30015___0	contig30015___0	Unknown	
2960	37	8	unmapped	0		0	GGGGAGGGGATGCAGCAGCTAAGCAGCAGGGATTGTGATAAATGGTTTAGCATGACTTTG	2894	0	UF_Msa_CF_124873	contig02244___0	contig02244___0	Unknown	
2961	37	9	unmapped	0		0	TCTCAAGGGGTCATCTTCTCTGCTATTGGTGGACCAGTCAGACAGGAGAGCTCTAGGCCT	2896	0	UF_Msa_CF_123423	contig04195___0rc	contig04195___0rc	Unknown	
2962	37	10	unmapped	0		0	TGGGTGATGAAAGGAGAAAAGTTCCCCGGCTCCCAGGATCACCCTCTACCTCTGTACGAG	2898	0	UF_Msa_AF_109662	contig10618___1_nrnt	contig10618___1_nrnt	Unknown	
2963	37	11	unmapped	0		0	CAATCACACTGTCCTTTAACCAGCATTTTGTTTTACCATGTGAAAGTCAGTCACTAATAA	2900	0	UF_Msa_AF_103706	contig12461___1_nr1nt0	contig12461___1_nr1nt0	Unknown	
2964	37	12	unmapped	0		0	AGGCAATCTCAGTCCTACTGCACAGACACAGACTGCCCTCAGGAATTGCCAGGTCCCAGT	2902	0	UF_Msa_AF_106253	LMB_S454.934.C1___1rc_nrnt	LMB_S454.934.C1___1rc_nrnt	Unknown	
2965	37	13	unmapped	0		0	TGCACCAAAACTCCACCCTCTCTCCTGCACCCCTCCATAGGTGGTGGATGTGCGCAGACC	2904	0	UF_Msa_AF_109591	contig05668___1_nrnt	contig05668___1_nrnt	Unknown	
2966	37	14	unmapped	0		0	ACAAACCGCTTCACTTTAGTCATGTACACACAGTGGGCCTACACGTGAGTTAAAATGGGT	2906	0	UF_Msa_CF_117747	contig12966___0rc	contig12966___0rc	Unknown	
2967	37	15	unmapped	0		0	CGTGAAGACCAGGATCCAGAACATGAGGATGATCGACGGGAAGCCCGAGTATAAAAACGG	2908	0	UF_Msa_AF_108110	contig25740___1_nrnt	contig25740___1_nrnt	Unknown	
2968	37	16	unmapped	0		0	CAACATCTTCATGGCCGCTCGCACACAGCTGGGAGACGCACTGACCATAGAAACTTTATT	2910	0	UF_Msa_CF_122114	contig04517___0	contig04517___0	Unknown	
2969	37	17	unmapped	0		0	AGGAGTTTCTCAGTGAGGAGAGAGACCAGGGAGGAGGGAGTCTGTGGAAGAGCCAACATC	2912	0	UF_Msa_CF_119118	contig05618___0rc	contig05618___0rc	Unknown	
2970	37	18	unmapped	0		0	ACGAGCTACAACTTCGAAGTGGAGAGAGCAACCTTTTGAGTCTTTTTCCATATAAAAAAG	2914	0	UF_Msa_CF_124208	contig13722___0	contig13722___0	Unknown	
2971	37	19	unmapped	0		0	CTGCCATCTGGAACAATCTATACCAAAAGGATAAACATCTTTGCACATACAGGAGGTCAA	2916	0	UF_Msa_AF_102740	contig08138___1_nr0nt1	contig08138___1_nr0nt1	Unknown	
2972	37	20	unmapped	0		0	ACAATGCTGGCTTTGAGTTAGTCACTGACTTGGTCTTGGCAAATTTCCTGGTTTCCTCTG	2918	0	UF_Msa_AF_105476	contig27029___1rc_nrnt-1	contig27029___1rc_nrnt-1	Unknown	
2973	37	21		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
2974	37	22		0		0		896	1	RC3	RC3	RC3		CONTROL
2975	37	23	unmapped	0		0	AAGATTGCACTTCAGGAGCTGCTGATATTTAATTTGAACTGTGGAGACCAGAAGCTGTTG	2922	0	UF_Msa_CF_126761	contig24725___0rc	contig24725___0rc	Unknown	
2976	37	24	unmapped	0		0	TCTAACATTACTGAAGACATTAACATTGGCTCTGTTCTACGCAACTGTCCCAGTAAGCCA	2924	0	UF_Msa_CF_125319	contig29210___0rc	contig29210___0rc	Unknown	
2977	37	25	unmapped	0		0	ACTGTGGAGGTGAAGACCAACGAGGGTTTATCCAGCGAGGCCGTCATCGGGAAGCTAGAA	2926	0	UF_Msa_CF_122042	contig16505___0rc	contig16505___0rc	Unknown	
2978	37	26	unmapped	0		0	ACTTCACCTACATGCACATGCAGGCCTAGGAAACTGGACTATGGATGACTCAATCAATGA	2928	0	UF_Msa_AF_100950	contig29643___1_nrnt	contig29643___1_nrnt	Unknown	
2979	37	27	unmapped	0		0	CAAAAGAAGCGTGGAGATCACCAATTCAATAGCAGCACATATGAGAAAGTACAAGAAGGC	2930	0	UF_Msa_AF_109170	contig13156___1rc_nrnt0	contig13156___1rc_nrnt0	Unknown	
2980	37	28	unmapped	0		0	GTGGGTGTCATGGAAATGTACATTTTCAAGTCTTTCAGACACTGTCAAAATAAGAAAAAC	2932	0	UF_Msa_AF_109039	contig32631___1rc_nrnt-1	contig32631___1rc_nrnt-1	Unknown	
2981	37	29	unmapped	0		0	GTGTCCTGAACGGCTGCAGCGGCGGCCGTGACGCGTCCACACGTGTCACTTCCTCCCGCG	2934	0	UF_Msa_CF_118552	contig02400___0rc	contig02400___0rc	Unknown	
2982	37	30	unmapped	0		0	GTGTGTGCTGCTCCCTCCATCTACCTGGACTTTGCTCGGTCTAACCTGGATCCCAGAATA	2936	0	UF_Msa_AF_107292	LMB_S454.884.C1___1rc_nrnt	LMB_S454.884.C1___1rc_nrnt	Unknown	
2983	37	31	unmapped	0		0	ACTTTATTGGACAGCCTCAACCAATAACATCAGCGTACAAAGAGGTGATGGTGCAAGAGG	2938	0	UF_Msa_CF_119815	contig13428___0	contig13428___0	Unknown	
2984	37	32	unmapped	0		0	AAGTTTCATGCACTAGACTTTGACACTTTACTGAAGCAGGCCCAGCAGAATCTGAAGAGG	2940	0	UF_Msa_AF_101316	contig03006___1rc_nrnt-1	contig03006___1rc_nrnt-1	Unknown	
2985	37	33	unmapped	0		0	AGATTAACCAGGACATGAGACAGGCTGAGAAAAACCTGACTGACCTCTCAAAGTGTTGTG	2942	0	UF_Msa_AF_107679	contig29535___1_nrnt	contig29535___1_nrnt	Unknown	
2986	37	34	unmapped	0		0	CCCTCGTAGTCTCCGTGGGAAGTACTGAGCACCTCTTTGGAGCTTTAGTGGGAGAGTGCA	2944	0	UF_Msa_AF_106662	contig29039___1_nr1nt0	contig29039___1_nr1nt0	Unknown	
2987	37	35	unmapped	0		0	TTTGAGGTGACAGGCTCTCAAGTCGAGGAGTCCCTGAAGTACCTCAATGTGCGCGAGACG	2946	0	UF_Msa_CF_122389	contig10016___0rc	contig10016___0rc	Unknown	
2988	37	36	unmapped	0		0	TTGTAGGTATTGATGGCTTCCCGCTCAACTCGCATAGAGAACCGCTTACCTGGAGCAGTA	2948	0	UF_Msa_CF_123653	contig26416___0	contig26416___0	Unknown	
2989	37	37	unmapped	0		0	ATAGCTGAACAAAGGCTCTCTGAACAAAACAAGCTTTGCTTCTCTTGGGTAACACCAATG	2950	0	UF_Msa_CF_127186	contig04795___0rc	contig04795___0rc	Unknown	
2990	37	38	unmapped	0		0	GAGCCCTTTGCAATGCAACAGTGCCATCTGCAGGAGTCCCAAACTTCCCCTGCAAGCCTT	2952	0	UF_Msa_CF_122518	contig22696___0	contig22696___0	Unknown	
2991	37	39	unmapped	0		0	TTGAGGAAATCCCAGAGGTCCCACTAGTGGTTGAAGACAAAGTTGAGGGCTATAAGAAGA	2954	0	UF_Msa_AF_101757	LMB_S454.sd.54.C1___1_nrnt	LMB_S454.sd.54.C1___1_nrnt	Unknown	
2992	37	40	unmapped	0		0	AGTACTATGGGAGCTACTTTAAAAACACAGACCTGTGGATTGTCATGGAGTACTGTGGAG	2956	0	UF_Msa_AF_108993	contig21674___1_nrnt	contig21674___1_nrnt	Unknown	
2993	37	41	unmapped	0		0	CCCCGGGCCTCAATAACATCAGCAACCTGAACGGGATCGGCACGTCCAGCATCAACTCGG	2958	0	UF_Msa_AF_103442	contig05131___1_nr0nt1	contig05131___1_nr0nt1	Unknown	
2994	37	42	unmapped	0		0	CATGCAAGCTGTGCTGTGACTACCAACCACTGAAGAGTTCATTAAAAATAAACTTGTACA	2960	0	UF_Msa_AF_106834	LMB_S454.1102.C1___1_nr0nt1	LMB_S454.1102.C1___1_nr0nt1	Unknown	
2995	37	43	unmapped	0		0	AACAGCCAGTAAGTGACTCTGCATGTTACTGTACCCCTGGAAGAGATACAAAGCAGTAAG	2962	0	UF_Msa_CF_118120	contig04663___0	contig04663___0	Unknown	
2996	37	44	unmapped	0		0	ATGAAAGGGCTGGGGACCAACGAGGCTGCCATCTTGCAGCTGGTGACTGCTCGCAGCAAC	2964	0	UF_Msa_AF_105106	contig26318___1_nrnt	contig26318___1_nrnt	Unknown	
2997	37	45	unmapped	0		0	CAAAAATACAACAAATGTGGACCCCTACTGCGATAAGACCGTCTACCTGTTTGCCTTCTG	2966	0	UF_Msa_AF_108540	contig29243___1rc_nrnt	contig29243___1rc_nrnt	Unknown	
2998	37	46	unmapped	0		0	AAACCACCTTGATTCTTTCCTGCAGCTGACCGGGATGCAGCAGCCTGTGTCTCAGCGTCT	2968	0	UF_Msa_CF_124865	contig09282___0	contig09282___0	Unknown	
2999	37	47	unmapped	0		0	CTTTGCCTTGTTTGATTCTTGTGAGCAGACATTTCCAAAGACTTGCAGAAATAAAAACAA	2970	0	UF_Msa_CF_122836	LMB_Sanger.2.C1___0	LMB_Sanger.2.C1___0	Unknown	
3000	37	48		1028	E1A	0		418	1	(+)E1A_r60_a135	E1A_r60_a135	E1A_r60_a135		CONTROL
3001	37	49	unmapped	0		0	GTTTTGCGTGGATGAGTTCAACAAAACATTCAGCACCGGTAGCAAAATCATTGAGAGGCC	2973	0	UF_Msa_CF_121912	contig06947___0rc	contig06947___0rc	Unknown	
3002	37	50	unmapped	0		0	TGTTCCTGAGGTGTTTCACTATCTGAGTTTGGCTGTTCTCACATTCTTCATGGTGGAGCT	2975	0	UF_Msa_AF_101380	contig25374___1rc_nr1nt0	contig25374___1rc_nr1nt0	Unknown	
3003	37	51	unmapped	0		0	TGACATAGCTGACTACTTCCAGCAGTTTGGGCCAGTCTCAGATATTATCATGGATAAAGA	2977	0	UF_Msa_CF_117905	contig03139___0	contig03139___0	Unknown	
3004	37	52	unmapped	0		0	GGTTGGTTTGGGATTGATGCTCAGGATGTTTCCAGGCCAATGTTAAATTATTGTGGAGCC	2979	0	UF_Msa_AF_106676	contig31054___1_nr1nt0	contig31054___1_nr1nt0	Unknown	
3005	37	53	unmapped	0		0	AAACCCTCCTCAGGACACCACTCAGGATTCTGTCACCTCCAATTAAAACCAAACTTTGGC	2981	0	UF_Msa_CF_118670	contig00220___0rc	contig00220___0rc	Unknown	
3006	37	54	unmapped	0		0	TTGTGGCATAAAAATACACAACCCATGTGTGGCCAGATACTTCAAAGGAAGAGCAGAGCC	2983	0	UF_Msa_AF_110188	contig23712___1_nrnt	contig23712___1_nrnt	Unknown	
3007	37	55	unmapped	0		0	GATTAGGAGTGCAACACTTACAGATACAGTGAAAGCTGGCATTAAGAGAGGACACTTCGT	2985	0	UF_Msa_AF_108342	LMB_S454.sd.239.C1___1_nr0nt1	LMB_S454.sd.239.C1___1_nr0nt1	Unknown	
3008	37	56	unmapped	0		0	GGCTATTATTCTGATATCTAGAACTCCATCACCACCAGCATACATAACCAACTACAACAT	2987	0	UF_Msa_CF_124452	contig12156___0rc	contig12156___0rc	Unknown	
3009	37	57	unmapped	0		0	ACTGCTCGAGTCCTGAAAGTCTCTAAAGATCCTTCCTCAAAGACCAACAGGAAACAAGCT	2989	0	UF_Msa_CF_127751	contig20453___0rc	contig20453___0rc	Unknown	
3010	37	58	unmapped	0		0	AAGCAACTCCTGATAGATTCAGAACCACACTGACGGTGACCAGACATGGGCACCGCCGAC	2991	0	UF_Msa_AF_104178	contig08091___1_nr0nt	contig08091___1_nr0nt	Unknown	
3011	37	59	unmapped	0		0	AACCATGAGAATGAAACCCACGACCACCCAAAAGGCATGGTGAGGATGCTGCCCGCCATG	2993	0	UF_Msa_AF_107208	contig04506___1_nrnt	contig04506___1_nrnt	Unknown	
3012	37	60	unmapped	0		0	CGGTTGTTGCTGTAACTCCACCCTCCAACCTGTCTCTCTTAATAAAATATTGTTTTGGCC	2995	0	UF_Msa_AD_200235	LMB_Add_118_rc	LMB_Add_118_rc	Unknown	
3013	37	61	unmapped	0		0	CTTATGTAAATCCTATTGTCAATATTTGTCCTGAAATCTCTGGGGGTGGATATAACCAAA	2997	0	UF_Msa_CF_118331	contig24771___0rc	contig24771___0rc	Unknown	
3014	37	62	unmapped	0		0	TTTTCAAAAAGCAGTAAACTAGAGCAGGAGGTCGCCTTAAGTGTCTCTTCAAGGCTGGGT	2999	0	UF_Msa_CF_122727	contig32516___0	contig32516___0	Unknown	
3015	37	63	unmapped	0		0	CAGAATGACAAACAGCGTTACCTGGACGAGGCCGAACGGGAGAAGATGCAGTATGCCCAG	3001	0	UF_Msa_CF_121149	contig13832___0	contig13832___0	Unknown	
3016	37	64	unmapped	0		0	ACTTTTGGAGCAACCTCACAGAGGGACAGAGAACTGTCACCGGTATCATTGCAGTAAATG	3003	0	UF_Msa_AF_100142	contig23147___1_nrnt	contig23147___1_nrnt	Unknown	
3017	37	65	unmapped	0		0	AAAGAAAAGGTGGTAAAATCCGTGTCAGTGAAGGGCCAAGACAGCAAGTTAGACGCAAAT	3005	0	UF_Msa_CF_119059	contig15411___0	contig15411___0	Unknown	
3018	37	66	unmapped	0		0	ATATGCTATTAGTCCGATATCCAATAGCTCGTGCCGAACAGTCACCAGCACACATCTATC	3007	0	UF_Msa_CF_123239	contig10932___0rc	contig10932___0rc	Unknown	
3019	37	67	unmapped	0		0	AACAGTGTTTCATTAACACACAGAGCCAGATTTGGTCCAAACATACTGCCTGCAGGTGAG	3009	0	UF_Msa_AF_102651	contig31559___1rc_nr1nt0	contig31559___1rc_nr1nt0	Unknown	
3020	37	68	unmapped	0		0	AGTCATCTTCACCATTGACACTGTCACCATCGTCATCGCCTTCCACGTGCTCTCCTTCCT	3011	0	UF_Msa_AF_106329	LMB_S454.514.C1___1_nr0nt	LMB_S454.514.C1___1_nr0nt	Unknown	
3021	37	69	unmapped	0		0	TTAGCCATCTCTAGCCAGCTCTCTCTCAGTGAGGGGTAGGTTCTGGTCAACCCAGTCCTC	3013	0	UF_Msa_AF_107570	contig18875___1_nr0nt	contig18875___1_nr0nt	Unknown	
3022	37	70	unmapped	0		0	ATAGAGAAGGCTGAAAACTTCCAAAACACCTGAAACCCCCAATGTCAGGTGACAGGTGAT	3015	0	UF_Msa_CF_123972	contig14325___0rc	contig14325___0rc	Unknown	
3023	37	71	unmapped	0		0	AAGGTCCCGGTCCAGGCCCCAACCAGCCCCCAAACATGCCCAGTGGCTCTATGAATATGC	3017	0	UF_Msa_CF_120651	contig13064___0rc	contig13064___0rc	Unknown	
3024	37	72	unmapped	0		0	TTAGATGCCATGAAGATTGCTTGGCGCTATCAGAATCTTCCAAAAGTTCAGAGTGCCCTG	3019	0	UF_Msa_AF_100500	contig07981___1rc_nrnt-1	contig07981___1rc_nrnt-1	Unknown	
3025	37	73	unmapped	0		0	ACCCACTCTGAAAATGGAAAAGAAAGCCCAGAAGTCCTCTGTCACGAAGAGATCAAAGTC	3021	0	UF_Msa_CF_122247	contig28209___0rc	contig28209___0rc	Unknown	
3026	37	74	unmapped	0		0	ATGAAGAAAGTCAAAGACAGGAATAGGGACATGACAGAAGAAGAGACTGACCTCAACCTG	3023	0	UF_Msa_AF_102646	LMB_S454.1037.C1___1_nrnt	LMB_S454.1037.C1___1_nrnt	Unknown	
3027	37	75	unmapped	0		0	GAGTGGGACTGGCGTGGCACTTTAAGTTCTTTGAAGATTTGTCAATTTGTCTCACTGCTG	3025	0	UF_Msa_AF_102071	contig11376___1_nr0nt1	contig11376___1_nr0nt1	Unknown	
3028	37	76	unmapped	0		0	ATCTACTCTCCCAATGCTTATCGAGGGTATGCAAGGACCTTTTTAAAGGACCTGGAGAGT	3026	0	UF_Msa_AF_101309	contig01188___1_nrnt	contig01188___1_nrnt	Unknown	
3029	37	77	unmapped	0		0	AAATTCAGTGACATACGTCCTGAGTGCTCCTCCCCATGTGCAGATTGGAGACATTCAAAT	3028	0	UF_Msa_AF_103301	contig32341___1rc_nrnt	contig32341___1rc_nrnt	Unknown	
3030	37	78	unmapped	0		0	TGCAACACCACAGAATCAGTGATGTTCTTTAGAAATATACTGGAGGAGGCGGGGCTTACT	3030	0	UF_Msa_CF_118049	contig22128___0rc	contig22128___0rc	Unknown	
3031	37	79	unmapped	0		0	TAACAACAAGGAGAATCGTCTGCGAGACCGCTCCTTCTCTGAGACGGGTGAGAGGCTCCT	3032	0	UF_Msa_AF_107245	contig20950___1rc_nrnt0	contig20950___1rc_nrnt0	Unknown	
3032	37	80	unmapped	0		0	TTGTCAAGAATTAACAGCACTTCAAACAATCTGTACGCTGCTTCAAAGAAGAAACAGCCG	3034	0	UF_Msa_AF_105631	contig11292___1rc_nrnt0	contig11292___1rc_nrnt0	Unknown	
3033	37	81	unmapped	0		0	TTCCCCAGAAAGCCGGCGAAGAAGCCGCCTCGAGTTGAGCGAACTCTGACCTGTGTGGTG	3035	0	UF_Msa_AF_107844	contig23012___1_nrnt	contig23012___1_nrnt	Unknown	
3034	37	82	unmapped	0		0	TCTCTAGTCGTTTGTCTCGGCTGGTCTGCTTCATGGTCAGGGCTCCTAACAGAGCTGGCA	3037	0	UF_Msa_AF_110250	contig04350___1_nr0nt	contig04350___1_nr0nt	Unknown	
3035	38	1	unmapped	0		0	TGAAGGTGGATGATGATGTGCCATCCCATGCTGTCATCACCGGCGGTGATCTTTACATCG	2881	0	UF_Msa_AF_105017	contig07263___1_nrnt	contig07263___1_nrnt	Unknown	
3036	38	2	unmapped	0		0	TTTTGAGCTGGAGGCGTAAAACAGATTCAGCGGGAGGACAGACCAGAAGACAGGAAAGCA	2883	0	UF_Msa_AF_105496	contig11183___1rc_nr0nt	contig11183___1rc_nr0nt	Unknown	
3037	38	3	unmapped	0		0	TAGTTAAGAAAGGATCTCCTGTGGTATCAAATCAGAAACTTGTGCATTCCTTCTTGGACC	2885	0	UF_Msa_AF_105371	contig16811___1_nr0nt	contig16811___1_nr0nt	Unknown	
3038	38	4	unmapped	0		0	GTGTGGAAGTGAAGCTTTGAAACATACCATGTATGATAATGATTTCCCATCAATCTGTAT	2887	0	UF_Msa_CF_120411	contig30571___0	contig30571___0	Unknown	
3039	38	5	unmapped	0		0	AAAGTGCCCGCCGGTTGCTGGTGATGTGGACGCAGATACCTACCAAGTTCTCCTAGACCT	2889	0	UF_Msa_CF_126463	contig18246___0rc	contig18246___0rc	Unknown	
3040	38	6	unmapped	0		0	AAAGATGATGGAGATCATGACCCGTGAGGTTCAGACCAATGACCTGAAGGAAGTTGTCAA	2891	0	UF_Msa_AF_107681	LMB_S454.sd.331.C2___1_nrnt	LMB_S454.sd.331.C2___1_nrnt	Unknown	
3041	38	7	unmapped	0		0	TGAGTCTGTTGACTTTCCCCTAGACCTGATGGATAAATCAAAGAGCCGGGTGTTCTTGAT	2893	0	UF_Msa_AF_104779	contig18145___1rc_nrnt0	contig18145___1rc_nrnt0	Unknown	
3042	38	8	unmapped	0		0	ACTTTCATACCGGACCGGACTAGCTCCTTAGCTATGGCCGCCCCAATCCCGACCGAGGCT	2895	0	UF_Msa_CF_120452	contig05592___0rc	contig05592___0rc	Unknown	
3043	38	9	unmapped	0		0	CAACCACCATAGGGCAAAAGTCTGGGCTTGGTATACAAACTGACATATTTGTATAAAAAA	2897	0	UF_Msa_CF_123174	contig02655___0	contig02655___0	Unknown	
3044	38	10	unmapped	0		0	GCAATATGTGATCCATGCAATTGATACTGTATCTTAATCTGAACCTTGCTGATTTAACAC	2899	0	UF_Msa_CF_120738	contig28846___0	contig28846___0	Unknown	
3045	38	11	unmapped	0		0	TTAGCCTGTTCTTCCAGCTCAACTAGTGCAGCCATCGACTCTACTACCTGATTCCTGCCT	2901	0	UF_Msa_CF_123293	contig25678___0rc	contig25678___0rc	Unknown	
3046	38	12	unmapped	0		0	GGAGAGAATGAAGAAGGCGGGAAAGATTGAGGAGCGGCCTGAGACCTTTGAGTCATTGGT	2903	0	UF_Msa_AF_109592	contig09425___1rc_nrnt	contig09425___1rc_nrnt	Unknown	
3047	38	13		0		0		2905	1	ETG09_205211	ETG09_205211	ETG09_205211		CONTROL
3048	38	14	unmapped	0		0	AACCTGCTGTGCACTACCTGCTCATCAGCAAGTATTTAGCATCTATGGGCCAGATATTTC	2907	0	UF_Msa_CF_126653	contig08411___0	contig08411___0	Unknown	
3049	38	15	unmapped	0		0	GCAGCTTCTCAGCCCAACCCAGCCAAGAAGAGCAAGACACAGTCTGTAAGCAAGCTAGCC	2909	0	UF_Msa_CF_126121	contig13752___0	contig13752___0	Unknown	
3050	38	16	unmapped	0		0	TCCTTACTCATGACACCATCCAATAAACCACTTTGCTTGCTAATTGAAAGAAAAGGAGCC	2911	0	UF_Msa_CF_118793	contig20394___0rc	contig20394___0rc	Unknown	
3051	38	17	unmapped	0		0	GAACTTTTGAGTTTTCAGTGCCGTCTTGTGATGCTCTCTACACAATAAAGTTTTTATGGA	2913	0	UF_Msa_AF_107356	contig30820___1_nr0nt	contig30820___1_nr0nt	Unknown	
3052	38	18	unmapped	0		0	CAGTAATGTGAAGGGTGAGCTTGAGGCGGACCTGGAGAGGATTAAGGAGGAGTTCCAGAT	2915	0	UF_Msa_CF_118417	contig05764___0rc	contig05764___0rc	Unknown	
3053	38	19	unmapped	0		0	ATATCAGTGAAGACCTGAGCAAAGCCCTCTTCAGACACTTGCAGTTACCAGAACTCACAA	2917	0	UF_Msa_AF_101097	contig31948___1_nrnt	contig31948___1_nrnt	Unknown	
3054	38	20	unmapped	0		0	GAGCTGCGTTGACTACAACAGTATTAGAAACACTTTCTTATATGAAATAAAGTGACAGTC	2919	0	UF_Msa_AF_102160	contig28346___1_nrnt0	contig28346___1_nrnt0	Unknown	
3055	38	21	unmapped	0		0	CGCTGCTGCTGCTGCTTTTGAGAAGAGAGAAGGAATAAAAACTACCCTACCCCAAACTAA	2920	0	UF_Msa_AF_100590	contig27339___1_nrnt	contig27339___1_nrnt	Unknown	
3056	38	22	unmapped	0		0	CAAATATCGAACACTGGATGTGTTCTCTGGCTGCGGCGGTCTTTCTGAAGGCTTCCACCA	2921	0	UF_Msa_AF_101305	contig07645___1rc_nrnt	contig07645___1rc_nrnt	Unknown	
3057	38	23	unmapped	0		0	CTGCAATTGCTGAAACTGGAAAATAAACGCAGTTCAGAATCTGTGATGATCATCACAGGG	2923	0	UF_Msa_CF_120110	contig11956___0rc	contig11956___0rc	Unknown	
3058	38	24	unmapped	0		0	TCGACAGGGCTGGGAGAGGACTGATCCAGAGGAAGACAGCAACAAATCACTGCTAAAATA	2925	0	UF_Msa_CF_122103	contig26917___0rc	contig26917___0rc	Unknown	
3059	38	25	unmapped	0		0	AAATTCATCAAACTGAATGTGGAAAAAGCCCCATTTCTGACAGAGAGGCTGCGGATCAAG	2927	0	UF_Msa_AF_100695	contig28051___1_nrnt	contig28051___1_nrnt	Unknown	
3060	38	26	unmapped	0		0	ATTGCTCTCCCGAGCCAGAACAGCACTGTCAAAAGAGGGCGAGGATGGGACAAGGAGACA	2929	0	UF_Msa_CF_123649	contig01426___0rc	contig01426___0rc	Unknown	
3061	38	27	unmapped	0		0	ACTGGCTGTACAAGTACAACGCAAATGTAAAATACGAGACGGAGAAAAAGGCCAATTTGG	2931	0	UF_Msa_CF_124978	contig20168___0rc	contig20168___0rc	Unknown	
3062	38	28	unmapped	0		0	AAGCTTTTTAGGACTACCTGAAACTCACTAGTTAAAACAAACTATCAGCTACCAGGGCAG	2933	0	UF_Msa_CF_124841	contig05738___0rc	contig05738___0rc	Unknown	
3063	38	29	unmapped	0		0	GTGGCGTCTGTGTTGAGAGTGGCTCCCCAGACCGCACCTTTGTGACCCAGAAACGTTCCT	2935	0	UF_Msa_AF_103282	contig12371___1_nr0nt1	contig12371___1_nr0nt1	Unknown	
3064	38	30	unmapped	0		0	GCTTTAATCTCTGGTTGATGTACTACAGAATGCTGTCCAAAACTAAGTTGCCGTCGTTGT	2937	0	UF_Msa_AF_105359	contig18863___1_nr-1nt	contig18863___1_nr-1nt	Unknown	
3065	38	31	unmapped	0		0	TAAAAAGCTTCCCAGAAATGATCATCTTGAGAAAGCGGAGGCTTGTGTCTACAGTGCTCC	2939	0	UF_Msa_CF_122983	contig29184___0rc	contig29184___0rc	Unknown	
3066	38	32	unmapped	0		0	CCATTGTCGTAGCATCTCGTCTTAGAAGTCATTATTATTAGTGTTTTGGGTGCTCTTGTT	2941	0	UF_Msa_AF_107580	contig30086___1rc_nrnt0	contig30086___1rc_nrnt0	Unknown	
3067	38	33		0		0		2943	1	ETG07_105829	ETG07_105829	ETG07_105829		CONTROL
3068	38	34	unmapped	0		0	CAGTTTTCACATTAAGAAAAGAGTAGAAAGTTAGAAATGGTCTGGAGATTTATGGCTGAG	2945	0	UF_Msa_CF_119636	contig14622___0	contig14622___0	Unknown	
3069	38	35	unmapped	0		0	ACTGTTTAAGAATCACTGCTCCACACGGCTCAGAATACAGCCACGCTGTATCAGAAATCA	2947	0	UF_Msa_CF_122925	contig06961___0rc	contig06961___0rc	Unknown	
3070	38	36	unmapped	0		0	ATGTTGCTAAAACTTCCACCGCTGGTTGAACGGAACTCCTGGACAAATCTCATCAAGTCT	2949	0	UF_Msa_CF_120094	contig31810___0rc	contig31810___0rc	Unknown	
3071	38	37	unmapped	0		0	TTGGACCTGGAGCCAACAGTTCACAAGGGTCAAAATCGTCTCTCAGCAGCGGTGGCTCTG	2951	0	UF_Msa_CF_123717	contig04698___0rc	contig04698___0rc	Unknown	
3072	38	38	unmapped	0		0	AATGTCATCGAGTACACAGTGGCCCTGATGGCGGTAAGGGGTCAGGGTCAGGTCTGGGGG	2953	0	UF_Msa_CF_123866	contig03251___0rc	contig03251___0rc	Unknown	
3073	38	39	unmapped	0		0	TGAAGCTGCCGAGAGCGATGCCATAAAGGCTCTGCTCAAGTGAGACACCACAGTGTGGGA	2955	0	UF_Msa_CF_126013	contig11082___0rc	contig11082___0rc	Unknown	
3074	38	40	unmapped	0		0	GTCTCTGCTTGAACCAGAATCCCTGAGACAGGATTGGCTGGAGCTGGCACTTACCCATGA	2957	0	UF_Msa_AF_100139	contig11098___1rc_nrnt0	contig11098___1rc_nrnt0	Unknown	
3075	38	41	unmapped	0		0	CTGGAGCTCGTGCACCTGGACGCTGTTCCTGTCCTGCTGGGCTCGCGGCTCTCTCCCCGA	2959	0	UF_Msa_CF_126144	contig24025___0rc	contig24025___0rc	Unknown	
3076	38	42	unmapped	0		0	GGTGATGAAGGATAAGTGTGTGTAAGGTGCTTTTAGGAGTCAGATTGTTTTATATATGCT	2961	0	UF_Msa_AF_109256	contig32879___1_nr1nt0	contig32879___1_nr1nt0	Unknown	
3077	38	43	unmapped	0		0	TTTTCTACATCAAGCCAGCTGGGCCTAATGATAGTGACAATCGGACTAAACCAACCCCAA	2963	0	UF_Msa_AF_100194	contig25337___1rc_nrnt	contig25337___1rc_nrnt	Unknown	
3078	38	44	unmapped	0		0	AGAATGTACTTATTCTACGGGAACAAGACGTCAGTGCAGTTTGCCAGCTTCACTACCACA	2965	0	UF_Msa_AF_100419	contig02314___1_nrnt0	contig02314___1_nrnt0	Unknown	
3079	38	45	unmapped	0		0	AAACCACCTGTTCCTGAGGTCAAAGTGGTGTCTAACTTGCCATCTATTACAATGGAGGAG	2967	0	UF_Msa_AF_109777	LMB_S454.sd.582.C1___1_nrnt	LMB_S454.sd.582.C1___1_nrnt	Unknown	
3080	38	46	unmapped	0		0	CTCGTTGAGCGGTGAGCAGGGGGCATCGAGCAGGAGGATGGACAGCTACGAGAGACCTGT	2969	0	UF_Msa_CF_122939	contig10946___0	contig10946___0	Unknown	
3081	38	47	unmapped	0		0	GAAGAAGCAAATCTGTACAAAGCTAGGGTGGAAGTGCAGTGTGAGCAGTTGTCCCGGGAG	2971	0	UF_Msa_CF_118070	contig07444___0	contig07444___0	Unknown	
3082	38	48	unmapped	0		0	TCTCCGCCAGGAGGAAAGATAAACAGACCCAAAACTGAGCTGGGAAAGAAACTTTTCAAG	2972	0	UF_Msa_AF_104446	contig27473___1_nr1nt0	contig27473___1_nr1nt0	Unknown	
3083	38	49	unmapped	0		0	AGATTCCTTCCTGTATTTGGGTGCTGAGTACATGAGCATTGTCCGTTCCCTTAAGAGAGA	2974	0	UF_Msa_AF_104898	contig14105___1rc_nrnt-1	contig14105___1rc_nrnt-1	Unknown	
3084	38	50	unmapped	0		0	AGGAGAACAGTGCCTCACCACAGAAATCCCCATGCAGACCAACAGACTCTCCAGCCAAAT	2976	0	UF_Msa_CF_124275	contig02577___0rc	contig02577___0rc	Unknown	
3085	38	51	unmapped	0		0	TGTGTCAAGTGACCCCGCAGCTTACTCTGAAGCAGTGCTGGGAAAGACCAATGAGGAGTA	2978	0	UF_Msa_AF_100859	contig16497___1_nrnt0	contig16497___1_nrnt0	Unknown	
3086	38	52	unmapped	0		0	TACATGTTTAATGCGGTTGCCTAGTGCCTGCGTCGGACAGCTCTCCTACGTCTGCGGACA	2980	0	UF_Msa_CF_125439	LMB_S454.sd.595.C1___0	LMB_S454.sd.595.C1___0	Unknown	
3087	38	53	unmapped	0		0	GGAAAACAACATCTAAAGGACCCCAGCCTCACAGCAAAACACCAAATATTCCGCGTTTTT	2982	0	UF_Msa_CF_122722	LMB_S454.669.C1___0	LMB_S454.669.C1___0	Unknown	
3088	38	54	unmapped	0		0	GACAAAAGCTGGTTTTACAACTATTACTCACTCACATCCTAAACTACTCTCATCAGACCA	2984	0	UF_Msa_CF_127673	contig16774___0rc	contig16774___0rc	Unknown	
3089	38	55	unmapped	0		0	AATGATTTTGCGATGCTTCAGCCGCTGCAGTGGAACACAAGATATGAAGTGGAAATCACG	2986	0	UF_Msa_CF_124203	contig08878___0	contig08878___0	Unknown	
3090	38	56	unmapped	0		0	CAGAGGGTTACCTACCAAACCGCCCAGTTAGATAGCTGACAGTACAGAGCTTCAAATAAG	2988	0	UF_Msa_CF_120504	contig09015___0	contig09015___0	Unknown	
3091	38	57	unmapped	0		0	TTTGACTGTGAAGACAAGGAGCTCTCTCATTCTCCAGAGTGGAAGAAAAACTGCAGCCTA	2990	0	UF_Msa_AF_100137	contig29460___1_nrnt0	contig29460___1_nrnt0	Unknown	
3092	38	58	unmapped	0		0	TGAAGAGCATCCAGCACAGCAAGATAGGAGATTACCTGGTGACCATTGAGGAAAAGAACA	2992	0	UF_Msa_AF_108950	contig25462___1_nrnt0	contig25462___1_nrnt0	Unknown	
3093	38	59	unmapped	0		0	GGGGTGCACATTAAATGGAGAGAAAATCCGTTCTAAAGTTCAAAAAGGACAGAAACTGAA	2994	0	UF_Msa_AF_101838	contig20918___1rc_nrnt0	contig20918___1rc_nrnt0	Unknown	
3094	38	60	unmapped	0		0	AAACCAAGAACCTGATTGAGCTCAAGAGCTTCAGCTTGTACGCTGTAGTCCTGACGTTTT	2996	0	UF_Msa_AF_105175	contig29520___1rc_nrnt	contig29520___1rc_nrnt	Unknown	
3095	38	61	unmapped	0		0	TCAAATGTGGTGGTATTTCATATTGTCGCAGGTGTTTCTGAGGAAAGAGGAGGGATTTGG	2998	0	UF_Msa_CF_123930	contig13377___0	contig13377___0	Unknown	
3096	38	62	unmapped	0		0	ACAATCTAAGTGTGGGACCTGGACCCGTAATCACCAGCACCTGAAGCCAAGGTCAGCCAG	3000	0	UF_Msa_CF_118220	contig18837___0	contig18837___0	Unknown	
3097	38	63	unmapped	0		0	AGACTCCGACATGGAGCTGGTGGCTGAGGCCAAGGCTCGGATCCAGGAGCTGCAGAAAGA	3002	0	UF_Msa_CF_121667	contig02742___0rc	contig02742___0rc	Unknown	
3098	38	64	unmapped	0		0	ATACTTCTCTGCTCCTCCATTTCAGGAGTTACTTAGTGAAAATCCTATAGTGACGGTGTC	3004	0	UF_Msa_CF_122081	contig03133___0rc	contig03133___0rc	Unknown	
3099	38	65	unmapped	0		0	GGACAGCCTCAATGAGGCTTAAAGTACATTATTCTTGACTTTAAATAATCAGTACTTCCA	3006	0	UF_Msa_AF_101415	contig18218___1_nr0nt	contig18218___1_nr0nt	Unknown	
3100	38	66	unmapped	0		0	ACACGGGAGAGGAGCGGCCCAGTACTGATAATTCAACTTTAAAGTCAATATTGTACGTAC	3008	0	UF_Msa_CF_120672	contig15464___0	contig15464___0	Unknown	
3101	38	67	unmapped	0		0	TCAACTTCTACGTCCCTGGCAGCTCTCTGGGACGACAGGAGGGAAATATCTTCCCCAACC	3010	0	UF_Msa_AF_101386	contig17531___1rc_nrnt	contig17531___1rc_nrnt	Unknown	
3102	38	68	unmapped	0		0	CTACCAGGATGGAAAATTAGAGCAGAGGCTGGATGTAGCTCCTCTCATTGAGTGGCAGCT	3012	0	UF_Msa_CF_122929	contig02329___0	contig02329___0	Unknown	
3103	38	69	unmapped	0		0	CCTAAGGCTCGACCCAAGCCTGAGCCACAGCTCCCTAAACCAAGGAGGAAGCATCACAAT	3014	0	UF_Msa_AF_100565	contig23254___1rc_nrnt0	contig23254___1rc_nrnt0	Unknown	
3104	38	70	unmapped	0		0	GACATCGGACAGGTGGAGGGGGCGTTCATGCAGGGTCTGGGCCTCTTCACCCTGGAGGAG	3016	0	UF_Msa_AF_108066	contig22219___1_nr0nt1	contig22219___1_nr0nt1	Unknown	
3105	38	71	unmapped	0		0	AGACACTTCAGGGAACCCAGTCGCCCTAACCGCAGCAAGGAGGTCGCCATTTCTTGTTCC	3018	0	UF_Msa_CF_119039	contig15203___0rc	contig15203___0rc	Unknown	
3106	38	72	unmapped	0		0	CATCAAAATCTACCCTGTGCTCTTCACACAAGCGCTGGAGAGTATGGAGGGTTACTACTA	3020	0	UF_Msa_CF_120217	contig12728___0	contig12728___0	Unknown	
3107	38	73	unmapped	0		0	TGACTGCAGCGCCCCCTCTGCCTCTCAGGCCAACGTGGACTTCCTGAAGAACATCGGAGA	3022	0	UF_Msa_AF_103125	contig29936___1rc_nrnt-1	contig29936___1rc_nrnt-1	Unknown	
3108	38	74	unmapped	0		0	TGCCTCCCTCTTCCAAATGTTTCAATGGAGATGCAGCCTGTAGACACCTCTCTCTTATTG	3024	0	UF_Msa_AF_104257	contig11907___1_nr0nt1	contig11907___1_nr0nt1	Unknown	
3109	38	75		0		0		2578	1	RC4	RC4	RC4		CONTROL
3110	38	76	unmapped	0		0	TCTGCCCAAGACGCGCAGGCCACCATGAGGCTCTACACACTGGTGAAAAAACAGTGGGAA	3027	0	UF_Msa_AF_105356	contig04490___1_nrnt	contig04490___1_nrnt	Unknown	
3111	38	77	unmapped	0		0	TTTACGCCACCACCCAGCTGGGTCTCAGTGGTCCTCCAGAATACTGCACATGAGGGACTG	3029	0	UF_Msa_CF_120963	contig09624___0rc	contig09624___0rc	Unknown	
3112	38	78	unmapped	0		0	CTTCCCGGCCACCGCAGCCGGAGCATTCATCACAACATCTGCCACTCAAAGGCAAACATA	3031	0	UF_Msa_CF_124644	contig18494___0rc	contig18494___0rc	Unknown	
3113	38	79	unmapped	0		0	GAAACCTTTGACACAATGTAAAGGAACTCTTCATATGTTTGGAAACAAAAATGGCTCATG	3033	0	UF_Msa_AF_107812	contig30451___1_nrnt	contig30451___1_nrnt	Unknown	
3114	38	80		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
3115	38	81	unmapped	0		0	AAGGGCTCATTTGGGAAAGTCCACTTGGCCCAGGATATCAGTACCAGGAAGAGAATGGCA	3036	0	UF_Msa_AF_104214	contig19709___1_nrnt0	contig19709___1_nrnt0	Unknown	
3116	38	82	unmapped	0		0	TAACGTGATCAGACTTAACCTCGTCTCAGCACCAACAACTGTTTCGAGCTACATCGTCTT	3038	0	UF_Msa_CF_118710	contig26150___0rc	contig26150___0rc	Unknown	
3117	39	1	unmapped	0		0	ATTTCAGTGTAACCAGTGTGAGGAGAATTTCCCTGTGTTCAAGGCCCTTCACAAGCACTA	3039	0	UF_Msa_AF_103522	contig22935___1_nrnt0	contig22935___1_nrnt0	Unknown	
3118	39	2	unmapped	0		0	CAAAACAAAAACAAACTAATCTTAAAGAAGACGTGCGACACCAGCTGCTGTCAGTGAAGA	3041	0	UF_Msa_AF_101302	contig19961___1_nr0nt	contig19961___1_nr0nt	Unknown	
3119	39	3	unmapped	0		0	TGTGGTTAGGCTGGCACTCTCTGATCCAGAAACACTGGAAGGTCAAGGTGGAGCGGGCTT	3043	0	UF_Msa_AF_102898	contig14266___1rc_nrnt0	contig14266___1rc_nrnt0	Unknown	
3120	39	4	unmapped	0		0	TGTAGCACAGTGGTAAACACTGTTCTGATGAATGGTTTTCATGTGTTTAATGATATGCCC	3045	0	UF_Msa_AF_108070	contig09728___1_nr0nt1	contig09728___1_nr0nt1	Unknown	
3121	39	5	unmapped	0		0	TTACATGCATGATAACGGACCATTAATTTTGGATGGCGGACTAGCACTGAACTGGAAGCG	3047	0	UF_Msa_CF_122282	contig02115___0rc	contig02115___0rc	Unknown	
3122	39	6	unmapped	0		0	CCCCGAATTCAACTGCCTCTGCTCCTTCGACTAGTCCCTCTCCTGCTACAGCCTACCCCT	3049	0	UF_Msa_CF_126257	contig05450___0rc	contig05450___0rc	Unknown	
3123	39	7	unmapped	0		0	TCCTGCGAATGTACGAGGACACAGCCCTGCTCAGAGACCGCACCACTGTCAACGCACTTA	3051	0	UF_Msa_AF_104185	contig07469___1_nrnt0	contig07469___1_nrnt0	Unknown	
3124	39	8	unmapped	0		0	ATTAGCACAGAAAGTTGCGGTTTAAGTCTGGGAGTCGTGCGAAATATGTCTGGAAGCAGA	3053	0	UF_Msa_CF_124612	contig03270___0	contig03270___0	Unknown	
3125	39	9	unmapped	0		0	CAGCAGGAGCAGCTGGTCTGTCAGGAGCTGCCACTGCAGCTGTAGCCGGCGCTGGAGGAA	3055	0	UF_Msa_CF_119620	contig21274___0rc	contig21274___0rc	Unknown	
3126	39	10	unmapped	0		0	CCACCTCAGACCTCCTGCCCTCATCATCATGGCACAGAACATGTATCCTAGCAACGTAGA	3057	0	UF_Msa_CF_124590	contig29597___0	contig29597___0	Unknown	
3127	39	11	unmapped	0		0	TGGAAACATCCAAATGTGAGCCTGACCAGGAAATGGGAGACAAGGGTCCCAGGTTCACCC	3059	0	UF_Msa_AF_102340	contig17812___1rc_nrnt0	contig17812___1rc_nrnt0	Unknown	
3128	39	12	unmapped	0		0	TATGCCGTCCAGATCTTCCACGATGCAATCAAATCCGGCAAGTTTGAGTGCAACTTGAAA	3061	0	UF_Msa_AF_102515	contig07278___1_nrnt	contig07278___1_nrnt	Unknown	
3129	39	13	unmapped	0		0	CCCAAGATGAACCACACTTTCCGGCCACACATAGAAACTGCCATCCATGATTTCCTGTCA	3063	0	UF_Msa_AF_109359	contig04697___1_nr1nt0	contig04697___1_nr1nt0	Unknown	
3130	39	14	unmapped	0		0	TTGGTCAGACAGCTTTTAGCGAAATGTGGTATTGTCCTAAGCTGGAAAAGGGTCCAAGGT	3065	0	UF_Msa_AF_107051	contig16383___1_nrnt	contig16383___1_nrnt	Unknown	
3131	39	15	unmapped	0		0	GCGAGGGACGGGAACCGGTGCAGGTTTGGGCTTGGACCTCCTCTGATGGTGGATCACTCA	3067	0	UF_Msa_CF_126575	contig26956___0rc	contig26956___0rc	Unknown	
3132	39	16	unmapped	0		0	AAGATGTTAATCCATTCACAGTACCTGAGCTGCACAGTAACACTCAGGAGAGCCAAGATC	3069	0	UF_Msa_AF_105679	contig28244___1rc_nrnt0	contig28244___1rc_nrnt0	Unknown	
3133	39	17	unmapped	0		0	ACACGGCATGACGGCTACTTCACCCTCAGCGTTGACTACAGGCACATCCTAAACCACAGG	3071	0	UF_Msa_CF_122753	contig16196___0	contig16196___0	Unknown	
3134	39	18	unmapped	0		0	TGATGTCGCTCACGTTTTAACCCATCTCTGACTTCAGAGTACAAACAAAGCCAGCACACT	3072	0	UF_Msa_CF_126620	LMB_S454.sd.66.C1___0	LMB_S454.sd.66.C1___0	Unknown	
3135	39	19	unmapped	0		0	ATTCTTGTGTCTCGTTCAGCAGGATTACTCAGCTGTGGCTGTGGCCTCTGGACTGGCTGC	3074	0	UF_Msa_CF_120636	contig10795___0	contig10795___0	Unknown	
3136	39	20	unmapped	0		0	GGTTTCGGTCAACCGCTACACCTGCCCGCAGTTTCTCAAATTTCTCCTCTCACAAGAACA	3076	0	UF_Msa_CF_121799	contig06711___0	contig06711___0	Unknown	
3137	39	21	unmapped	0		0	GACACAATTGATATACTTGCTGAAATATGTTTCAAACTGCCCGTCAAAGTGTCCAATTTT	3078	0	UF_Msa_AD_200029	LMB_Add_77_rc	LMB_Add_77_rc	Unknown	
3138	39	22	unmapped	0		0	AGACAACGTACGGGTCGCGAGTACAACCAGCCCTGCCTTACGCCATGAACAGTGAGTTCT	3080	0	UF_Msa_AF_106178	contig09344___1rc_nrnt-1	contig09344___1rc_nrnt-1	Unknown	
3139	39	23	unmapped	0		0	AGCCAGTCCATCACCAGCACCCCGATCCGGATCAAACAGGAACCTCTGGACTAACCACCA	3082	0	UF_Msa_CF_122196	contig05854___0	contig05854___0	Unknown	
3140	39	24	unmapped	0		0	TGTCCATTTGTCCTTTAGCTGGAGGAGGTGAACAGTGTCTGTTCCCTGTTTATTATCCCA	3084	0	UF_Msa_CF_120862	contig28705___0rc	contig28705___0rc	Unknown	
3141	39	25	unmapped	0		0	GCACCAGAGAGGTTTGTGGATGGAAGCATGTTTACCACTGAGAGCGACCAGAATACGCCG	3086	0	UF_Msa_AF_105229	contig07721___1_nrnt	contig07721___1_nrnt	Unknown	
3142	39	26	unmapped	0		0	TTCGGGGTCCGTCCATATTGCAGAACCGGCATCATGGTGCGCATGAACGTTCTCGCAGAT	3088	0	UF_Msa_AF_102976	contig14989___1_nr0nt1	contig14989___1_nr0nt1	Unknown	
3143	39	27	unmapped	0		0	CTCCATGGAGCATTTCCGCTGGGGGAAGCCTGTTGGGCGAAAGCGCCGCCCGGTCAAAGT	3090	0	UF_Msa_AF_101138	contig29258___1_nrnt	contig29258___1_nrnt	Unknown	
3144	39	28	unmapped	0		0	CCTGAGTCCAGGCTTGTCTGTATTCCAAGTCTTGTTTTGCAAAAAATTAAAGATGTAATA	3092	0	UF_Msa_AF_107888	LMB_S454.sd.551.C1___1_nrnt	LMB_S454.sd.551.C1___1_nrnt	Unknown	
3145	39	29	unmapped	0		0	ATCATCACCTACAGGAACCTCTTCAAGAAAGTGTATCTGTTGTTGAGGACTCACCAGCTG	3094	0	UF_Msa_AF_104829	contig29293___1_nrnt	contig29293___1_nrnt	Unknown	
3146	39	30	unmapped	0		0	TTTCTCAAGAGAGGAGGATGTCAACTTCAGACGAGGCAGACGGGCTCCGGCCGAGATATG	3096	0	UF_Msa_CF_118490	contig04735___0	contig04735___0	Unknown	
3147	39	31	unmapped	0		0	ATATGGAAGCAATGATGTGTTACGGTTCACTAAAAATGCCAGTTTCCCCGTCATCAACTA	3098	0	UF_Msa_AF_100103	contig07703___1_nrnt0	contig07703___1_nrnt0	Unknown	
3148	39	32	unmapped	0		0	TGTGTTTCTCACTCCCGAGGCTACAGAAACGGCCCAACCTCTGCGGGCACAGCAGACCGA	3100	0	UF_Msa_CF_118728	contig05386___0	contig05386___0	Unknown	
3149	39	33	unmapped	0		0	AAGGAGACGGGGTGACAGCCACCCTGATTTAAAGAAGGGAATCTAGCAGAATATCTCAAA	3102	0	UF_Msa_CF_117764	contig19750___0	contig19750___0	Unknown	
3150	39	34	unmapped	0		0	GATCACCAAGCGTTTACTGCTTCCTCTTTTCAACACCGTGGACCTGGTGGACGTGACGCA	3104	0	UF_Msa_AF_108399	contig03719___1rc_nrnt	contig03719___1rc_nrnt	Unknown	
3151	39	35	unmapped	0		0	AACAAAGACACAAGCTGTGACAAGGCTCACAGACACATTTTTGTCTGACTCAACAGCGAG	3106	0	UF_Msa_CF_119581	contig31455___0rc	contig31455___0rc	Unknown	
3152	39	36	unmapped	0		0	TTAGCAGCCAGCTGGGAAGTGTTCAAAATCCTTATTTGAGAGGCAAGTTGGGTCAGACAA	3108	0	UF_Msa_CF_119927	contig18641___0	contig18641___0	Unknown	
3153	39	37	unmapped	0		0	AGGAATGGGCATGGACGGGAATCTGAGGAATCAAGGGACTTCAGAAAGAGAAACAGTCCT	3110	0	UF_Msa_CF_118574	contig16060___0	contig16060___0	Unknown	
3154	39	38	unmapped	0		0	TTTGGTTGGTATGTAGTCTGGCAGCTCTTCTTGTCCAAGTTCAAGTTCCTGCGTGAACTT	3112	0	UF_Msa_AF_106119	contig11349___1rc_nrnt-1	contig11349___1rc_nrnt-1	Unknown	
3155	39	39	unmapped	0		0	AAAGTCTAAACTCAAAAGAAACTTCAGCTACTTCGCAGCGTTACTCTGTCCTACATCTCC	3114	0	UF_Msa_CF_126367	contig31901___0rc	contig31901___0rc	Unknown	
3156	39	40	unmapped	0		0	TCTGGAGCTGCTGTGCTGCTCTGGGGCCGTCTTGTCCTCTCTGCATGTTAGCTTCCTGTT	3116	0	UF_Msa_CF_124694	contig20108___0rc	contig20108___0rc	Unknown	
3157	39	41	unmapped	0		0	CCCTTAAACTGTTCGACTACTCAAAGCCTTACTGCAAAAAGAGCCTTTAAATATATACAG	3118	0	UF_Msa_AF_105965	contig22247___1rc_nrnt	contig22247___1rc_nrnt	Unknown	
3158	39	42	unmapped	0		0	TTTGAATCTGAAGCCTGTTTTCTTGCAGAAAGGAGAACTGACCTTGTGGCACTGGACAGT	3120	0	UF_Msa_CF_127488	contig18515___0rc	contig18515___0rc	Unknown	
3159	39	43	unmapped	0		0	AGAAGCTGTCAATCAGACTGTCAAGTCGGTATTCTTATGGGCAATTTGTCGAGATAAACA	3122	0	UF_Msa_AF_102134	contig04998___1_nrnt0	contig04998___1_nrnt0	Unknown	
3160	39	44	unmapped	0		0	CTGATGTGCAATTTTGGGATTCTAATTGTCTCTAGCATCCGTATCTTTTTGCTTCATTTC	3124	0	UF_Msa_CF_125347	contig28927___0	contig28927___0	Unknown	
3161	39	45	unmapped	0		0	AATAACTGAGGACTGTCAAGTGGGACTCTGGAGATTAAGCACATTTCACAGTGAATTAGT	3126	0	UF_Msa_CF_125944	contig20342___0	contig20342___0	Unknown	
3162	39	46	unmapped	0		0	TGAATGAGGTTAAGGGAGGAAGGGCACAGATGTGTCAAGGATCAAGTGGCTTTTACTTGT	3128	0	UF_Msa_CF_122629	contig17138___0rc	contig17138___0rc	Unknown	
3163	39	47	unmapped	0		0	AGTATGGGATGGAAAACGTCTCATGGCTGAGGAGACATTCACAGTTGGGAAAACAGACGG	3130	0	UF_Msa_AF_103778	contig18028___1_nrnt0	contig18028___1_nrnt0	Unknown	
3164	39	48	unmapped	0		0	TCTGTGGTAGATACAGCAGGTCAGAAAATATGGGGAAAGAGGTGAAAGGACTTGGAAAAC	3132	0	UF_Msa_CF_125517	contig04457___0	contig04457___0	Unknown	
3165	39	49	unmapped	0		0	TAGAGAAAGCCCACAGCCTCGTCAACTCTCTGATAGAGACCAGCAGGATCGAGGACCTCG	3134	0	UF_Msa_AF_108564	contig01255___1_nrnt0	contig01255___1_nrnt0	Unknown	
3166	39	50	unmapped	0		0	GTAAAGAACAGGAGGCTATATACAGAGAAGTGGTCAAATCCCCCACTACATCTCGGATCT	3136	0	UF_Msa_CF_118995	contig24542___0	contig24542___0	Unknown	
3167	39	51	unmapped	0		0	ATACACACTGACTCCTTTCCAAAAGGAATAGGAAGAGGCCCTTCCACAATTTAGCCAAGG	3138	0	UF_Msa_CF_122476	contig06525___0	contig06525___0	Unknown	
3168	39	52	unmapped	0		0	AGGATCTGGTGCGCAAAGAGACAGTATCTCCTGCTCACCAGATACTATCTGGTGTGCACC	3140	0	UF_Msa_CF_120522	contig16236___0rc	contig16236___0rc	Unknown	
3169	39	53	unmapped	0		0	AAGTTCGCGGTGCTGATGTGGATCCTGACCTACGTCGGCGCCTTGTTCAACGGGCTCACG	3142	0	UF_Msa_AF_109181	contig14071___1_nrnt	contig14071___1_nrnt	Unknown	
3170	39	54	unmapped	0		0	TGGGAAAGGGGTTTTCATTTAGTTTTGGCCTCCTTGCAGAAGAGCCAGAACTGACAAACT	3144	0	UF_Msa_AF_101096	contig08240___1_nr0nt	contig08240___1_nr0nt	Unknown	
3171	39	55	unmapped	0		0	TTCCATATAAAGCTAAGGAACAAGCCCAATGACCGCGGCCAAAGGCGATTGCAAATGTAA	3146	0	UF_Msa_CF_123789	LMB_Sanger.100.C1___0	LMB_Sanger.100.C1___0	Unknown	
3172	39	56	unmapped	0		0	GTAATCATGGCGCCGGCCAAAAAACGCAACGTGAGTTCGGCAAAAACACCAGAACAAAAG	3148	0	UF_Msa_CF_121855	contig21974___0	contig21974___0	Unknown	
3173	39	57	unmapped	0		0	CCAACTTTCCTCCGGGAGACCCGCAGCTGATCGGTATGATCGTGGAGCATCTGAAGAACA	3150	0	UF_Msa_AF_109492	contig05400___1rc_nrnt0	contig05400___1rc_nrnt0	Unknown	
3174	39	58	unmapped	0		0	TTAACAGATGGAAGTCTGGGGGGAGCTGAATATACTGAGGCTTTGTGCAACATGGAGAAA	3152	0	UF_Msa_AF_105882	contig09094___1rc_nrnt-1	contig09094___1rc_nrnt-1	Unknown	
3175	39	59	unmapped	0		0	ATATGTTCTGCACTGGACCCAGCAAGTTTGAGGAAAATGTTTGCTTTGGTGATGCAGGAG	3154	0	UF_Msa_AF_108875	LMB_S454.sd.403.C1___1_nr1nt0	LMB_S454.sd.403.C1___1_nr1nt0	Unknown	
3176	39	60	unmapped	0		0	CCTCCTCTCTGTCTGGAAAACCGAAGATAAATTTCTGTTGTCCGCATACTGCCAATGGTT	3156	0	UF_Msa_AF_105868	contig08550___1rc_nr1nt0	contig08550___1rc_nr1nt0	Unknown	
3177	39	61	unmapped	0		0	GGTCTATCCTCTACTGGTGACTAAAGACTACTGGAGTGATAACTCAGATGGTGTTTGCTT	3158	0	UF_Msa_CF_120652	contig00715___0rc	contig00715___0rc	Unknown	
3178	39	62	unmapped	0		0	AGAGGCAAGCGGACGTGGAGTATGAGCTGAGGTGTCTTCTCAACAAGCCAGAGAAAGACT	3160	0	UF_Msa_AF_109770	contig30364___1_nrnt	contig30364___1_nrnt	Unknown	
3179	39	63	unmapped	0		0	AGCAGAGTTATCAAGAAGAGCTGGAAACACCTGATGGTCTCGCTGGGACAATCCGCTCCA	3162	0	UF_Msa_CF_125096	contig17794___0	contig17794___0	Unknown	
3180	39	64	unmapped	0		0	TATGACAACCACAGAATCAAATGGAGATGCGGAGCAGAAGCCAAACGTCCAATCAGAAAG	3164	0	UF_Msa_CF_125646	contig25482___0rc	contig25482___0rc	Unknown	
3181	39	65	unmapped	0		0	GACTTTTATTTGGAGGCTGGGAAGAAGAGAGGATTTGTATGTAATAATTGTGTCTGTAAA	3166	0	UF_Msa_CF_127533	contig32754___0	contig32754___0	Unknown	
3182	39	66	unmapped	0		0	TATTTTTCCTGGATGACACGGACCAAGAAAGTATGAGGGACTTTGAAATCGTGGACCAGC	3168	0	UF_Msa_AF_105215	contig27504___1_nrnt	contig27504___1_nrnt	Unknown	
3183	39	67	unmapped	0		0	CCAAATCCAGAGTCCATACAGCAGAAAATCTATCACATGGATGTAAATGAGGCCAAGTCC	3170	0	UF_Msa_CF_121879	contig19582___0rc	contig19582___0rc	Unknown	
3184	39	68	unmapped	0		0	GGCTGGTACGCCATCATATAAGTCAACATGGGAGCATATAAGTATATGCAGGAGTTATGG	3172	0	UF_Msa_AF_104081	contig04834___1_nr0nt1	contig04834___1_nr0nt1	Unknown	
3185	39	69	unmapped	0		0	CTGCTGGACTCGCGAGGACATCTCAAACAGAGCAGCAACCCCTACGCAAAGTCCTACACC	3174	0	UF_Msa_AF_104011	contig20913___1rc_nrnt	contig20913___1rc_nrnt	Unknown	
3186	39	70	unmapped	0		0	ATGATCTTGGCGATAAACTGCTGGCCGAGACGATACATTTTCCCTCATAAAATAGGGCTG	3176	0	UF_Msa_CF_127105	contig14936___0rc	contig14936___0rc	Unknown	
3187	39	71		130	HybridizationNegative	0		3178	1	(+)eQC-42	EQC	EQC		CONTROL
3188	39	72	unmapped	0		0	TCTGGGATATTGTTAAGAGGTTGTGGACGACACCAAAGTTTGCAGCCAAGTTCTGCTGTT	3180	0	UF_Msa_AF_108591	LMB_S454.363.C1___1rc_nrnt0	LMB_S454.363.C1___1rc_nrnt0	Unknown	
3189	39	73	unmapped	0		0	AGACTTTCCTTCTTCTGCTAGCTCTTAAGGTGCGTTATCCAGACAGGATAACCTTGATCC	3182	0	UF_Msa_AF_104224	contig02489___1rc_nrnt	contig02489___1rc_nrnt	Unknown	
3190	39	74	unmapped	0		0	ATATTCCTCTGATCAAAGTTCAAAACGGAAGCACCCACCACATGTGTGGAGCTAACTGCT	3184	0	UF_Msa_AF_100104	contig22840___1_nr0nt1	contig22840___1_nr0nt1	Unknown	
3191	39	75	unmapped	0		0	TAAAAATAACTAATTTGGCGTGCATTCAGTAGGGGTGACTTGTTACAGGCCTGCCTCCTG	3186	0	UF_Msa_CF_120860	contig26758___0	contig26758___0	Unknown	
3192	39	76	unmapped	0		0	ACGCCCGCAAAAAGCAGCAGGAAGAAGATGCTCTGTGGCAGGAAACTGATAAACATGTAC	3187	0	UF_Msa_AF_110013	contig29543___1_nr0nt1	contig29543___1_nr0nt1	Unknown	
3193	39	77	unmapped	0		0	TACCCAGCCAGACCAGGGTCAATGTCCACAACATTAAAACTCTCAAGTTATTGATGTACC	3189	0	UF_Msa_AF_108190	contig12586___1rc_nr1nt0	contig12586___1rc_nr1nt0	Unknown	
3194	39	78	unmapped	0		0	CTGCGTCTGTGTACTGCTGTCCAGAACAAGTCAGGCAGTGGGGAAGGAGGCGTGAAAAAG	3191	0	UF_Msa_CF_126856	contig25368___0	contig25368___0	Unknown	
3195	39	79	unmapped	0		0	GCTCTGGCACCACACGCTACAGATCCACCAGGACCTGAGGGAGGATCTTGCCAAGGTGAA	3193	0	UF_Msa_AF_101925	contig18488___1_nrnt	contig18488___1_nrnt	Unknown	
3196	39	80	unmapped	0		0	AGAACATATCTCAGGTGTCCAGTTTAAGGGACCTCAGCATAGAAAGCTAAAAAGATGGCA	3195	0	UF_Msa_CF_120773	contig06401___0rc	contig06401___0rc	Unknown	
3197	39	81	unmapped	0		0	TACATCCACTCATTCAATTCTAACATTAACCCATACCGGTTATATCCCTGTTTAGCAACA	3196	0	UF_Msa_CF_126225	contig08639___0rc	contig08639___0rc	Unknown	
3198	39	82	unmapped	0		0	ATGGAGAGCTACACACCTTGATGACCCTGCGTTCAGAAGAGCTGAGGTACCAGTGCTGGC	3198	0	UF_Msa_AF_104223	contig23754___1_nr0nt	contig23754___1_nr0nt	Unknown	
3199	40	1	unmapped	0		0	AACTGTGGCATACTAGTCCATGAACCCACCGTACCTCTTCTGTAACTCACTGCCGTTCTC	3040	0	UF_Msa_CF_117691	contig15606___0rc	contig15606___0rc	Unknown	
3200	40	2	unmapped	0		0	CGTTCCTTGCACAGTATTAAAATGTTGTATCCCAAATACAAGGGGGGTCAAAATATTATA	3042	0	UF_Msa_AD_200043	LMB_Add_70	LMB_Add_70	Unknown	
3201	40	3	unmapped	0		0	TTTGGACAGTTTGTCATGAGCCCTTATCCTAGTGTTGCCCCCTGTTCTCCAATTACATTC	3044	0	UF_Msa_AF_106571	contig27549___1_nr0nt1	contig27549___1_nr0nt1	Unknown	
3202	40	4	unmapped	0		0	ATGACCAGTATGGGGAAGAAGGAGAAGCCGAAGCCGAAACCCCTGATGCTGCTGCTCAGA	3046	0	UF_Msa_AF_102819	contig30188___1_nr0nt1	contig30188___1_nr0nt1	Unknown	
3203	40	5	unmapped	0		0	CAGCTGAACCTCTGCTTGAAGCAGCACAGCATGACATCTGCGTCAGTGTCAGTGACTGGG	3048	0	UF_Msa_CF_119986	contig23049___0	contig23049___0	Unknown	
3204	40	6	unmapped	0		0	TGTTCACTAAACAGCCTGGCTGGAGTTCACCATGTGAGGAGGTTGCGCGCATACCGGTGT	3050	0	UF_Msa_AF_103172	LMB_S454.249.C1___1_nr0nt	LMB_S454.249.C1___1_nr0nt	Unknown	
3205	40	7	unmapped	0		0	TTTATGTTCAGTGTTAACTGCGATATCGCGACCGAACAGAGCTCAGTCAGGTAAATAAAT	3052	0	UF_Msa_AD_200147	DQ786405_rc	DQ786405_rc	Unknown	
3206	40	8	unmapped	0		0	TGTCTGTAAGGGCAGTATATGAGATTGCCCAGGTGAAAGTCCAGGATGAGTGCTTCAAAA	3054	0	UF_Msa_AF_107301	contig13379___1_nrnt	contig13379___1_nrnt	Unknown	
3207	40	9	unmapped	0		0	GTCAGACTGAGCCACAAACCTGAATCTCAGTGGTCAGAACAGCCGAAGCAAAATTCACCA	3056	0	UF_Msa_AF_103085	contig21350___1_nrnt0	contig21350___1_nrnt0	Unknown	
3208	40	10	unmapped	0		0	ATGAGGAGCAAAAGACCAAGGATGGTCAGGACGCAGCACCCAATGATGAGGCCCAGAAGG	3058	0	UF_Msa_CF_123135	contig14814___0	contig14814___0	Unknown	
3209	40	11	unmapped	0		0	AGAGCACTCCATGGACTCAAGACACAGCACTGCAGCAAAGTCTCATGAGTGAATGGTCAG	3060	0	UF_Msa_AF_110215	contig05050___1_nrnt0	contig05050___1_nrnt0	Unknown	
3210	40	12	unmapped	0		0	ACCTTTCAGTTTGGCTACGCTGAGCTTCCACGTTACACAGCCCTGGATGCTGTGGGATGG	3062	0	UF_Msa_AF_102984	contig09513___1rc_nrnt0	contig09513___1rc_nrnt0	Unknown	
3211	40	13	unmapped	0		0	TTCTCTAACTGGTAGCTACGTTATCGTTCCCCCTCGTTGTTTTAACCTGTCCAAAGCTGA	3064	0	UF_Msa_CF_119377	contig12313___0	contig12313___0	Unknown	
3212	40	14	unmapped	0		0	AGAAGTTTGACGATGAGTTGGTGGAGAGTAGCCTTGTGAAGTCGTCTAGTAGAGTCAAAG	3066	0	UF_Msa_AF_101107	contig01459___1_nr0nt1	contig01459___1_nr0nt1	Unknown	
3213	40	15	unmapped	0		0	TGATCAAGAGGAGAAGGACAACACAGTCAGGATGAGGACCAACCTGTCCATACCATTGCT	3068	0	UF_Msa_AF_104742	contig07712___1_nrnt0	contig07712___1_nrnt0	Unknown	
3214	40	16	unmapped	0		0	TCTTCATGTGTTGAAGTGTTGATATTTTTAATAATCTGACCTGTTAACCTGAGCTGACCA	3070	0	UF_Msa_CF_118164	contig32213___0	contig32213___0	Unknown	
3215	40	17		1028	E1A	0		479	1	(+)E1A_r60_1	E1A_r60_1	E1A_r60_1		CONTROL
3216	40	18	unmapped	0		0	TATGTATTTGATGTTGAGAGCCGTGAGCTGGAGAAAGACATGCACTACTACCAGTCCTGT	3073	0	UF_Msa_AF_103774	contig16287___1rc_nrnt	contig16287___1rc_nrnt	Unknown	
3217	40	19	unmapped	0		0	ACAGATGCTGAAGAACACTTTCATAGCCCCCATCAAATTTGAGGTGAACTTAAGAGGTCC	3075	0	UF_Msa_CF_123566	contig23037___0rc	contig23037___0rc	Unknown	
3218	40	20	unmapped	0		0	TTCATGTACCACGTTTTCTTTATCACCACACGGAAAAGGAGGCACCCAAATGAGTGTGAC	3077	0	UF_Msa_CF_124354	contig05195___0rc	contig05195___0rc	Unknown	
3219	40	21	unmapped	0		0	CTTGATGATTGCTGTTAATCTCTCATTCACTGGGAATGAACCTCGCTTTAATGCCGTTGA	3079	0	UF_Msa_CF_122655	contig08312___0rc	contig08312___0rc	Unknown	
3220	40	22	unmapped	0		0	TTCCTTGGCCTCTACCGAGCCCTCTACACAGCCAACTGGGTGTGGCGTTACCACACCGAG	3081	0	UF_Msa_AF_108096	contig06038___1_nrnt	contig06038___1_nrnt	Unknown	
3221	40	23	unmapped	0		0	TTCAGACACGGACTACTGATGCAGGCGTTTCCGCACATTACAGTCCCGGGAGCGACCGGG	3083	0	UF_Msa_CF_124218	contig23742___0	contig23742___0	Unknown	
3222	40	24	unmapped	0		0	AGACCCACACTGCACCTGCAACTGTTGTACTAGTATCCTCGGATGTGAACTTTGCAAGTG	3085	0	UF_Msa_AF_101845	contig20015___1rc_nrnt0	contig20015___1rc_nrnt0	Unknown	
3223	40	25	unmapped	0		0	TTCAGCAAAGTTGGAACGGAAGTACTAAGAAGACAGTGAAGGCAAAGCAATAGCCCTGCT	3087	0	UF_Msa_CF_123820	contig12161___0rc	contig12161___0rc	Unknown	
3224	40	26	unmapped	0		0	GGAAGCAAACAGAAACACCCAACAAATGAACTATGAGGGGACATTAATCTTAATTTGATT	3089	0	UF_Msa_CF_119890	contig29634___0	contig29634___0	Unknown	
3225	40	27	unmapped	0		0	ATTGACGTTACTGGAGCTCTTTTACAACACACCAACTGACGCCTCACAGACTTTCAGTCT	3091	0	UF_Msa_AD_200246	LMB_Add_139_rc	LMB_Add_139_rc	Unknown	
3226	40	28	unmapped	0		0	CATTGCAGTGGCGACGACCAACAACCTCTACATATTCCAGGATAAAGTGAATTAACTATT	3093	0	UF_Msa_AF_105096	contig09032___1rc_nrnt	contig09032___1rc_nrnt	Unknown	
3227	40	29	unmapped	0		0	ACTGAGTGTCTGATCGCAGGTATCGCGGCTAGAGGAGGGAGCAGAGAGCAGAGTTAGTGT	3095	0	UF_Msa_CF_124268	contig18613___0	contig18613___0	Unknown	
3228	40	30	unmapped	0		0	TGGACCCAGCAAAGCTGTGAAAGATATTTTTGAAGATACACATGTGGTGTGAAACACATC	3097	0	UF_Msa_AF_103120	contig29059___1rc_nr1nt0	contig29059___1rc_nr1nt0	Unknown	
3229	40	31	unmapped	0		0	ACGGAGGAGCTAGGAAGCCTGGTGTCGCTCAATGACCTGCTGGTGTCTCAGAACCTCATT	3099	0	UF_Msa_CF_123501	contig19257___0	contig19257___0	Unknown	
3230	40	32	unmapped	0		0	TGATGTCTTTGAGTTCCACGAGGCATTCGCAGGTCAGATAATGGCAAATCTGAAGGCTAT	3101	0	UF_Msa_AF_107971	contig00475___1_nrnt	contig00475___1_nrnt	Unknown	
3231	40	33	unmapped	0		0	ATCCAGACCGGTCTTTATGAATGGTGCCAATGTGACTGTAATAAATGCAAGTGCAAATAA	3103	0	UF_Msa_AF_102726	LMB_S454.1108.C1___1_nrnt	LMB_S454.1108.C1___1_nrnt	Unknown	
3232	40	34	unmapped	0		0	TATGAGAAGCTGAAGGCGTCTGTCTCTTCGACGTCAGAACCGGCGGTTTCGTCCGTCAAC	3105	0	UF_Msa_CF_118355	contig24877___0rc	contig24877___0rc	Unknown	
3233	40	35	unmapped	0		0	ATGTCTCTCCCACTCAGGTGAGTGCAAGTGTGGTGAGTTCAAGCGTGGTGAGTGCAGGTG	3107	0	UF_Msa_CF_118339	contig22262___0rc	contig22262___0rc	Unknown	
3234	40	36	unmapped	0		0	ACATTGAGGCTTGTGAGGATTCCTGTGGTCCAGTCACTGCACTTGGTTGAGGAAGTTCTC	3109	0	UF_Msa_CF_120296	contig31714___0	contig31714___0	Unknown	
3235	40	37	unmapped	0		0	CAGCAGTGTGCAGAATTTTTTCCCATATCAGTATTCTACAATGAGCCATTTTTTGTATAC	3111	0	UF_Msa_AF_108153	contig27717___1rc_nr0nt1	contig27717___1rc_nr0nt1	Unknown	
3236	40	38	unmapped	0		0	AACAGAAGAGGATTCTTGACCTTGACACTAAGATATGCTGTCTCTCCTGCAGTGACACAC	3113	0	UF_Msa_CF_118640	contig22620___0rc	contig22620___0rc	Unknown	
3237	40	39	unmapped	0		0	TGAGGTGTTCAGGAACGATGTGGTGCCCAACTTCATGACCAGCTCCTATGTACCGGCCTC	3115	0	UF_Msa_AF_104548	contig03392___1_nrnt	contig03392___1_nrnt	Unknown	
3238	40	40	unmapped	0		0	TATTATCTCCAATGACATCAGTGAACTGCAGAAGAACCAGGCGACCACAGTGGCAAGATT	3117	0	UF_Msa_AF_102635	contig23441___1rc_nrnt	contig23441___1rc_nrnt	Unknown	
3239	40	41	unmapped	0		0	CTCCTCCCAGCAAAAGATCAGGGAAACAAAGTTGTCTTTTTAGCTCCCTCTACAAGAAAG	3119	0	UF_Msa_AF_109230	LMB_S454.432.C1___1_nr0nt	LMB_S454.432.C1___1_nr0nt	Unknown	
3240	40	42	unmapped	0		0	CATGGTCATTTTTTAACAGCCATGATATACTTCAAAACAGACATGACATGCAGACAAAGT	3121	0	UF_Msa_AF_109309	contig09741___1_nr0nt1	contig09741___1_nr0nt1	Unknown	
3241	40	43	unmapped	0		0	GAGGCGTTCAAGTGCTTGATGTGTGATGTCAGGAAAGGGACGTCAACTCGAAAACCACGG	3123	0	UF_Msa_AF_107064	contig25094___1rc_nrnt	contig25094___1rc_nrnt	Unknown	
3242	40	44	unmapped	0		0	AGCAACGGTCTGCTGAGCTGTGGAAGGAGCGTCTGGCAATGCTGAAAGAGGTCAATGACC	3125	0	UF_Msa_AF_107925	contig27972___1rc_nrnt-1	contig27972___1rc_nrnt-1	Unknown	
3243	40	45	unmapped	0		0	GTCCCTCATATCTAACTAACTGTTTGAAAGCTCAGAGAATATCCAAGGAATACCCCACCC	3127	0	UF_Msa_CF_121448	contig31179___0rc	contig31179___0rc	Unknown	
3244	40	46	unmapped	0		0	CTGAAGCGCTGTCCGGTGCTCCTCCGCATTGTGGACTCGAGGTCGTAAAAGCCCGAAACG	3129	0	UF_Msa_AF_106093	contig06121___1_nr0nt	contig06121___1_nr0nt	Unknown	
3245	40	47	unmapped	0		0	ATGTTAAATCTATAAATACGAGTGTAAATACTGACGGTTTGGTCTGTTGGGTGTACAGAG	3131	0	UF_Msa_CF_123459	contig01235___0	contig01235___0	Unknown	
3246	40	48	unmapped	0		0	AACCCCATATAACACAAAAGTTGAACTGAGTTTAGCTCAGGTGATCAATGAGGACTACTC	3133	0	UF_Msa_CF_122519	contig09465___0rc	contig09465___0rc	Unknown	
3247	40	49	unmapped	0		0	TGGAACATGGTGAACCTATGTGTGCGGTCTTTAATTCATGGGAAACATGTGAGCTGTCCA	3135	0	UF_Msa_AF_106971	contig20263___1_nrnt0	contig20263___1_nrnt0	Unknown	
3248	40	50	unmapped	0		0	GTCCGCATGGAGCTGAGCAGCAGTGAGGGCCGACTGTGCATCAGCATTGAAGCCAACACC	3137	0	UF_Msa_CF_119680	contig08647___0rc	contig08647___0rc	Unknown	
3249	40	51	unmapped	0		0	GATACCCTAAGCACCTGCCTCTTCTTGACTGCAGAGGTGATTAGAGGTGGTATAGACAAG	3139	0	UF_Msa_CF_124369	contig25320___0	contig25320___0	Unknown	
3250	40	52	unmapped	0		0	GAAAGAAGGAGGAGAAGGAGGAAAAGGAGGCAAAAGGGCCAAGTGAGGAGCAGGTGAAAG	3141	0	UF_Msa_CF_123030	contig31189___0	contig31189___0	Unknown	
3251	40	53	unmapped	0		0	ACGTCTGGTCTGTAACCCATCTCACCTCTGGTCTGTAACCCGTCTCACACCTGGTATGTG	3143	0	UF_Msa_CF_126937	contig01516___0	contig01516___0	Unknown	
3252	40	54	unmapped	0		0	AACGCATTTGGTGCTTTTCACTTTCTGTCTTCATTTATCGAATTAACTCCTCTGTGGTCT	3145	0	UF_Msa_AF_105596	contig09055___1rc_nr0nt	contig09055___1rc_nr0nt	Unknown	
3253	40	55	unmapped	0		0	CCACCTTGTGATACATCAAGAATATCTGCTATGATGTTCTTTTACTACAGTGTGAGTAAA	3147	0	UF_Msa_AD_200238	DQ786405	DQ786405	Unknown	
3254	40	56	unmapped	0		0	GTTTGATGCTTAAACACAGACATGTTCGTGTGTTGAGGAGTATTTGTGGTGCCTGAAGCA	3149	0	UF_Msa_AF_109173	contig12602___1_nr0nt	contig12602___1_nr0nt	Unknown	
3255	40	57	unmapped	0		0	AGGCCACAGCACAGATGAGGAACAGGGAAGCACAAGTGCTAAAAAGTGTTTATTCAAACT	3151	0	UF_Msa_AF_110132	contig28678___1rc_nrnt0	contig28678___1rc_nrnt0	Unknown	
3256	40	58	unmapped	0		0	GCCTCCATCACTCCGGCCGACGTCCATCACTTCCCATCAAGGCGTCCTGAAGGGAATCAG	3153	0	UF_Msa_CF_121776	contig18407___0	contig18407___0	Unknown	
3257	40	59	unmapped	0		0	CGGTCGGTATTCAGCTCCGTGTTCTCCCAGTCGTAAAAAGCCAGGCCCATTCACTGACCT	3155	0	UF_Msa_CF_126681	contig21638___0	contig21638___0	Unknown	
3258	40	60	unmapped	0		0	AGAGATGATACCCTGTAAAGAACACCTGTCCTCTTGATTCTACCAGTCCGACTCTACTCT	3157	0	UF_Msa_CF_124868	contig07841___0rc	contig07841___0rc	Unknown	
3259	40	61	unmapped	0		0	AGTTTGCCAGTTGGAGGCACAACGGAAAGTCAGGATGATGAGTTGCAGAGAGATTATAAC	3159	0	UF_Msa_CF_121169	contig07758___0	contig07758___0	Unknown	
3260	40	62	unmapped	0		0	AAACAGAAGGATCAGGTGAACTCGACGTTGACTAAAAATGATTTCCGCAGCCTCGACAGT	3161	0	UF_Msa_CF_124660	contig11808___0rc	contig11808___0rc	Unknown	
3261	40	63	unmapped	0		0	ATCAAAGATACCTACTGCAAGCGCATATGTGGTGACTGCACACATGAGAGCACTGAAACA	3163	0	UF_Msa_CF_118162	LMB_S454.358.C1___0rc	LMB_S454.358.C1___0rc	Unknown	
3262	40	64	unmapped	0		0	ATGAAGAACTCAGAATGGGCGACCCGTCTGACACAATCCGTCGGGCGTCTATGATGCCTG	3165	0	UF_Msa_AF_100587	contig07334___1_nrnt0	contig07334___1_nrnt0	Unknown	
3263	40	65	unmapped	0		0	TTTGTAGAATACTACACCCGTACAGGCGCAGAAAATGCCATGCGCTTCATTAATGGCACA	3167	0	UF_Msa_AF_109200	contig00579___1rc_nrnt	contig00579___1rc_nrnt	Unknown	
3264	40	66	unmapped	0		0	GGAGGAGGCTTTGACTTCCACAGGGGCTTTGAGGCTGACATTACTCCTGAGGACCTCTTC	3169	0	UF_Msa_AF_109468	contig13766___1rc_nrnt0	contig13766___1rc_nrnt0	Unknown	
3265	40	67	unmapped	0		0	CCCAAAGACGTGGAAGGAGCTCGTAGATGCCTTCGACATCAAAGACACAATGATTCACCC	3171	0	UF_Msa_CF_126071	contig08223___0rc	contig08223___0rc	Unknown	
3266	40	68	unmapped	0		0	TTGAGAATCTGTTGAAGAAGGGTTACGAGGTGATCTACCTGACAGAGCCTGTGGATGAGT	3173	0	UF_Msa_AF_103560	LMB_S454.sd.305.C1___1_nrnt	LMB_S454.sd.305.C1___1_nrnt	Unknown	
3267	40	69	unmapped	0		0	GCTGCTGGGTCACGTTATATTTGCAGGGTCGATTTCACAATGAATCTGAAGGCTACAGAT	3175	0	UF_Msa_CF_124927	contig29066___0rc	contig29066___0rc	Unknown	
3268	40	70	unmapped	0		0	ACATGGCCCCCAGCACGCAACTAAAGGAGGCAATAGCCGATGTGCACGAGGGGATCCGTG	3177	0	UF_Msa_CF_125938	contig00366___0	contig00366___0	Unknown	
3269	40	71	unmapped	0		0	TGACATATCAGTTCCTCTTTATCCTCAGCAGCACTTGAAGTTGATGACTAAAACAGCTAA	3179	0	UF_Msa_CF_126434	contig05529___0	contig05529___0	Unknown	
3270	40	72	unmapped	0		0	TGTGAGGTGTCTCTGTGGGACTCTGATGAACCTGTGCCGAGGGAAGAGCTTCAAAGGGGT	3181	0	UF_Msa_AF_103434	contig31390___1rc_nrnt-1	contig31390___1rc_nrnt-1	Unknown	
3271	40	73	unmapped	0		0	GACATTTCTTCTGGACTAACTACGTCCTCATACGTACTGTTTGCAGGTAGTTCAGTGCAA	3183	0	UF_Msa_CF_127305	contig21975___0rc	contig21975___0rc	Unknown	
3272	40	74	unmapped	0		0	TTTCTAACTGAGAAAAGGTTCTTGTCAGACTATGATGAGCAGTTCCCCATCGCAGACGAC	3185	0	UF_Msa_AF_101158	contig09632___1rc_nrnt0	contig09632___1rc_nrnt0	Unknown	
3273	40	75		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
3274	40	76	unmapped	0		0	AGATAGAAAACAAAGGAAAGGCGTTCTCCAAGCAGATCCTCTCGATACGATGACCACGAT	3188	0	UF_Msa_AF_106109	contig13661___1_nr0nt	contig13661___1_nr0nt	Unknown	
3275	40	77	unmapped	0		0	TGCAAGGCAATACGGGCTTCTGCCATGGAACGCGGTGCCAGGGAAAGCTTGTGGTATAAC	3190	0	UF_Msa_AF_102247	contig15992___1_nrnt	contig15992___1_nrnt	Unknown	
3276	40	78	unmapped	0		0	ACACACCCGAGAAAAGGACAGGGACATGATTTAGACACTAACAGATGATGGATAGAGGGA	3192	0	UF_Msa_CF_120550	contig03090___0rc	contig03090___0rc	Unknown	
3277	40	79	unmapped	0		0	GCGGAGGAGGAGAGCAGCCAGCAGCAGACAGGCCCCGCTGCCGCCGTGACCCACAGCCGA	3194	0	UF_Msa_CF_117993	contig02399___0	contig02399___0	Unknown	
3278	40	80		1028	E1A	0		390	1	(+)E1A_r60_3	E1A_r60_3	E1A_r60_3		CONTROL
3279	40	81	unmapped	0		0	TGGCTGGGTCATCACTGCGGCTTGCTCCGATTACTAGCCCACCCTTTGAAACCTATGAGG	3197	0	UF_Msa_AF_101272	contig20399___1_nrnt	contig20399___1_nrnt	Unknown	
3280	40	82	unmapped	0		0	AATGGAGAACTACTGAACAACAACAATATCGCTGCACCTGATAGCAGCAACGCTGGTGAA	3199	0	UF_Msa_CF_121939	contig09221___0rc	contig09221___0rc	Unknown	
3281	41	1	unmapped	0		0	AAGGTAAACCCCAGTACTTTGAGGAGTCATGAGGGGGAACAGGAGGACGGCAGACGCTTC	3200	0	UF_Msa_AF_107959	LMB_S454.sd.520.C1___1rc_nr1nt0	LMB_S454.sd.520.C1___1rc_nr1nt0	Unknown	
3282	41	2	unmapped	0		0	TTAAATGGAGAGTGGATGTTACTATTTCTACAAGCTCTTTAGCCAGGGCCCTGCAGCCTT	3202	0	UF_Msa_AF_109325	contig12483___1_nrnt	contig12483___1_nrnt	Unknown	
3283	41	3	unmapped	0		0	GAAAGTTTTTCTTTCCCAGTTTCTTTTGTTTCCCTGCTTTCAGTCACAACTCTGCCAAAG	3204	0	UF_Msa_AF_102826	contig28352___1rc_nrnt	contig28352___1rc_nrnt	Unknown	
3284	41	4	unmapped	0		0	CAAACCAAGAGGAGACGATGCCGGAGTGTACATGTGTGTCTACACCTTCGATATGACTCC	3206	0	UF_Msa_AF_104540	contig32480___1rc_nr1nt0	contig32480___1rc_nr1nt0	Unknown	
3285	41	5		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
3286	41	6	unmapped	0		0	TGGAGGAGAAAAGACTCCATCACTTTATTGACAACCATTGAAAATGAGACGGCTTTGCAA	3209	0	UF_Msa_CF_120144	LMB_S454.898.C1___0rc	LMB_S454.898.C1___0rc	Unknown	
3287	41	7	unmapped	0		0	TTGGAGCTCAGAGCTGAAGGTGTGGTTGCCAAGCAAGTCTTCCAGAAGGCTGATTGAAGT	3211	0	UF_Msa_AF_101399	contig28688___1_nrnt	contig28688___1_nrnt	Unknown	
3288	41	8	unmapped	0		0	GATCACATCCTGTCTTTGTCACGATCAGTTGACAAATACACAACAACACATCCAATACAA	3213	0	UF_Msa_CF_124581	contig30495___0	contig30495___0	Unknown	
3289	41	9	unmapped	0		0	GACGAGCGAAGGGACGAGCGAAAGGATGTGCTGCGTGAATGCCCTACAGTGCTCTGCAAT	3215	0	UF_Msa_CF_125839	contig21340___0	contig21340___0	Unknown	
3290	41	10	unmapped	0		0	ATCCCAAACAGTCTACTGAAACATTGTGTCCGTGAACACCGGAGAAAGAACAGACTGCAT	3217	0	UF_Msa_CF_126694	contig28966___0	contig28966___0	Unknown	
3291	41	11	unmapped	0		0	GAGTTCCAGTCTGCTTCTGAGGTCGACTTTTACATTGATAAGGACATGATCCACATTGCA	3219	0	UF_Msa_AF_103517	contig02147___1_nrnt	contig02147___1_nrnt	Unknown	
3292	41	12	unmapped	0		0	TCCACCTACTGGAAACACACTGGCTCAGGGACCGGGGGTGTACAAAGCGCAGGCTAGAGG	3221	0	UF_Msa_CF_121465	contig25761___0rc	contig25761___0rc	Unknown	
3293	41	13	unmapped	0		0	TAAAGAGGAGGAGCTGCCCGCCCTAGAGTTTATTGAGGACAATGAGGTCAGCCGCCACAT	3223	0	UF_Msa_CF_125595	contig20369___0	contig20369___0	Unknown	
3294	41	14	unmapped	0		0	TTACTCTGAAGTTTGTCACCGTGAGCAGCCGTTAGCAGCATCGCTGGAAACCGTCGGCTG	3225	0	UF_Msa_CF_126075	contig29074___0	contig29074___0	Unknown	
3295	41	15	unmapped	0		0	TCAGATGCTGTCAATGGGCCTGAAATCCGCAGACTACTTCTGGGAGAAATACATTCATAG	3227	0	UF_Msa_CF_127776	contig09452___0	contig09452___0	Unknown	
3296	41	16	unmapped	0		0	AAGTTGGAGCTGGACCAGGAACCAGAGGAGCATGTGGACCGACACCAGGTTCTGAGTGAA	3229	0	UF_Msa_CF_120239	contig24468___0rc	contig24468___0rc	Unknown	
3297	41	17	unmapped	0		0	ACTGGAAGGTGAACAAACCCATGGAGCTCTACTTTGCGCCTACTAAAGAACACAAGTAGT	3231	0	UF_Msa_AF_104918	contig01331___1_nrnt	contig01331___1_nrnt	Unknown	
3298	41	18	unmapped	0		0	ACACCTCCAGGACTTTTTTGCTAAACTAACTCAAAAAAGTCACCATGGCAGAGACGTCGG	3233	0	UF_Msa_CF_120632	contig30756___0	contig30756___0	Unknown	
3299	41	19	unmapped	0		0	ACGTGTATGAAGGAATCTGCACTGCTGGATTTCTATGTCTGTGGTTTCTGGTGGGCAAAA	3235	0	UF_Msa_CF_123986	contig00251___0	contig00251___0	Unknown	
3300	41	20	unmapped	0		0	ATTCAGCTGGAGGAGGATGGGACACACATCGTCTGCGACTAACAACGAACCGCTGCGTAC	3237	0	UF_Msa_AF_102283	contig08115___1_nr1nt0	contig08115___1_nr1nt0	Unknown	
3301	41	21	unmapped	0		0	CATGGGTGCAGCCATGTTTTTGGAGAAGGTGGGACTAAAGGAGAACTAGCTCTCCCCCCG	3239	0	UF_Msa_CF_126626	LMB_S454.353.C1___0rc	LMB_S454.353.C1___0rc	Unknown	
3302	41	22	unmapped	0		0	ACAGAGAGCGCAGTGGCAAAGTCTGATCACAAAGTTTCAGCAGAGGGCATTGCTGCAAAA	3241	0	UF_Msa_CF_126185	contig06428___0	contig06428___0	Unknown	
3303	41	23	unmapped	0		0	ACACACAAAGCAATCCCAGTCATGTCTGTTCTCATCTGTAACACCACAGTGGTGGAACAA	3243	0	UF_Msa_CF_121134	contig00407___0rc	contig00407___0rc	Unknown	
3304	41	24		0		0		3245	1	ETG09_35454	ETG09_35454	ETG09_35454		CONTROL
3305	41	25		1028	E1A	0		1348	1	(+)E1A_r60_a20	E1A_r60_a20	E1A_r60_a20		CONTROL
3306	41	26	unmapped	0		0	CTTGAGTTGTCATGAATACACAGAATGCAAAATTGGCTACCATATTATACTAGGCTGTTT	3248	0	UF_Msa_AF_102319	LMB_S454.sd.102.C1___1_nrnt	LMB_S454.sd.102.C1___1_nrnt	Unknown	
3307	41	27	unmapped	0		0	AACACTCCCACAATCCACCGCGGTCCTCCACATTTAGGATCTTCAACTTTAAGTGTCAAA	3249	0	UF_Msa_CF_119362	contig27150___0	contig27150___0	Unknown	
3308	41	28	unmapped	0		0	CACATACGAAATGCTACACACTGAGGACATGGAGGACAGAGAAATGAGCTTACCTTTTGA	3251	0	UF_Msa_CF_120937	contig16909___0rc	contig16909___0rc	Unknown	
3309	41	29	unmapped	0		0	TACTGGCCTGAATGTGGATCTCTTTGGTGGTTCGTCCTGCTGGGTTGCCTGTTCGGAGCT	3253	0	UF_Msa_CF_120277	contig05973___0	contig05973___0	Unknown	
3310	41	30	unmapped	0		0	TCACAGGATTCTTATGGGCAGCAGTGGAAGTAGATGAACCAAAAGGTATTTGGCAAAGTA	3255	0	UF_Msa_AF_107375	contig13533___1rc_nrnt	contig13533___1rc_nrnt	Unknown	
3311	41	31	unmapped	0		0	CTAAACAAGCCACCGTCACCTACCAGAAACCAGACAAGCAGGAGGAGTTTTACGCATAAC	3257	0	UF_Msa_AF_103542	contig04858___1_nrnt	contig04858___1_nrnt	Unknown	
3312	41	32	unmapped	0		0	TGTGATGTCAGAGGACAAGCTCGATGACATACGAGGAAGAGGATCAGGGGATGGGCTTCA	3259	0	UF_Msa_CF_122950	contig28441___0rc	contig28441___0rc	Unknown	
3313	41	33	unmapped	0		0	TCCACAATGCAACATGGGTTGGGCGATGGAGCCTGCTAACTTCTATGAGAGTGTCAAGCT	3261	0	UF_Msa_AF_107880	contig26926___1_nr0nt1	contig26926___1_nr0nt1	Unknown	
3314	41	34	unmapped	0		0	TGGTGGGGGGCCCCATCATTGCTGCAAGCCCCCTACCCAAAAGCAACAATTTACTCATAC	3263	0	UF_Msa_CF_123493	contig14903___0rc	contig14903___0rc	Unknown	
3315	41	35	unmapped	0		0	TGTACCGTCAGATCACCACACCTCGACATGTCGGAAGTGAAGGTGAAGAAGGCAGCGAGG	3265	0	UF_Msa_CF_118678	contig23768___0	contig23768___0	Unknown	
3316	41	36	unmapped	0		0	CTGAGCTGGGGGACTCTGGAGTCTGGGGTCTGAAGAAGAACTTTGCTCTGCTTGAACTCC	3267	0	UF_Msa_AF_105616	contig19681___1rc_nr1nt0	contig19681___1rc_nr1nt0	Unknown	
3317	41	37	unmapped	0		0	ATTGTCGCCTGGCAGGGGAACGGGCTTCCTACTTTTCGTCTTGGGGAAAATCCCTGGCTT	3269	0	UF_Msa_CF_125051	contig12752___0rc	contig12752___0rc	Unknown	
3318	41	38	unmapped	0		0	TACTCTGAGCACACAGGAGTCCTTAACGAATATGCCGGCACGTCTACACATACCAAAAAA	3271	0	UF_Msa_CF_123259	LMB_S454.sd.29.C2___0	LMB_S454.sd.29.C2___0	Unknown	
3319	41	39	unmapped	0		0	CGTCAAGCCGAAGTTTCTCTAATGACTGGATTTGTATTATGGGTAAAGTGTATGTTTATA	3273	0	UF_Msa_CF_126775	contig20826___0rc	contig20826___0rc	Unknown	
3320	41	40	unmapped	0		0	ATAACCTGAATCTCCCCAAGCCTGCAAAAATAGATATTTCAGTGCCTGCTAATCTGGTTT	3275	0	UF_Msa_AF_109392	contig29241___1rc_nrnt	contig29241___1rc_nrnt	Unknown	
3321	41	41	unmapped	0		0	CGTCGTGTTTGAATTCCCAGAATTCCAGCTGTAAATGCAGATGACAAAATAAATTTGTTT	3277	0	UF_Msa_AF_109378	LMB_S454.sd.440.C1___1_nrnt	LMB_S454.sd.440.C1___1_nrnt	Unknown	
3322	41	42		1028	E1A	0		1133	1	(+)E1A_r60_a104	E1A_r60_a104	E1A_r60_a104		CONTROL
3323	41	43	unmapped	0		0	AGCCTGAGTCCGTAGCCGTCGCTGGCGTTGGTGACGACTCGTAATCTGACTGTGCTGCAG	3280	0	UF_Msa_CF_125036	contig32878___0	contig32878___0	Unknown	
3324	41	44	unmapped	0		0	TATCTCCAGATGGTCGTTGCTGTGGTATCGTAATCTGGTTTTGCAGATTCGTCTGTGTCT	3282	0	UF_Msa_AF_109163	contig26091___1_nr0nt	contig26091___1_nr0nt	Unknown	
3325	41	45	unmapped	0		0	AGTCCTGAGAACAGCTCCCTGCTTAACAGCTAGGTGTTAATGGTGTACATAAAAGCTGGA	3284	0	UF_Msa_CF_125696	contig05296___0	contig05296___0	Unknown	
3326	41	46	unmapped	0		0	GCAAGGTGTACGGAGTGGAGCGCATGGATCAGTGGTGCACCGCCTGCCGCTGGAAAAAAG	3286	0	UF_Msa_AF_106680	contig06141___1_nrnt	contig06141___1_nrnt	Unknown	
3327	41	47		130	HybridizationNegative	0		3178	1	(+)eQC-42	EQC	EQC		CONTROL
3328	41	48	unmapped	0		0	TAAAGTAGACATCAACAAGTCCAACACAGAGGCCAAGCTCAATGATGTGGCTGGACCTAA	3289	0	UF_Msa_AF_105165	contig30568___1_nrnt	contig30568___1_nrnt	Unknown	
3329	41	49	unmapped	0		0	GACAAAACCTAGACAATTTAGCAAATGAAGCACCTAAAGATTAGACGTTGTCTAAGGAAA	3291	0	UF_Msa_CF_118230	contig11846___0	contig11846___0	Unknown	
3330	41	50	unmapped	0		0	GACAGACATAGCTGCCACTAAACAGCCTACACTGGACCAGAATGCCAATGTGCAGCCAAG	3293	0	UF_Msa_CF_123904	contig20547___0	contig20547___0	Unknown	
3331	41	51	unmapped	0		0	ACCGGTCCCGACTGCCCCGCAGCCCGCCATTACACAGCCTTCCTGGGCAACCTGGCCGTA	3295	0	UF_Msa_AF_100641	contig16154___1rc_nr0nt	contig16154___1rc_nr0nt	Unknown	
3332	41	52	unmapped	0		0	TGGCTGTTTGACTGCGGGGAGGGAACCCAGACCCAACTGATGAAGAGCCAACTCAGAGCC	3297	0	UF_Msa_AF_105243	contig23199___1rc_nrnt	contig23199___1rc_nrnt	Unknown	
3333	41	53	unmapped	0		0	GATTGGCTGGTCAGGGCCTACAAGGCCGTGGACGCCGCGTCTCTGCGTGCGTCTCTACCT	3298	0	UF_Msa_CF_125191	contig04667___0rc	contig04667___0rc	Unknown	
3334	41	54	unmapped	0		0	TTCTCATCATACAGTGTCGGGGCCATGTCAGTGTTTCGTCTTTACACCTTGGACTGCTTT	3300	0	UF_Msa_CF_127273	contig03658___0rc	contig03658___0rc	Unknown	
3335	41	55	unmapped	0		0	GTCACATCCTCTATCTTCTCTGCACTAATGAACACATGTGCTTCATTGCCATCATGGACG	3302	0	UF_Msa_CF_125816	contig17991___0	contig17991___0	Unknown	
3336	41	56	unmapped	0		0	CTGCTGATGGGCTGTTTGAAGGACAAAGAAACAGGATTCAGACTGGCTTTACAGATTTGG	3304	0	UF_Msa_AF_102913	contig17801___1_nrnt0	contig17801___1_nrnt0	Unknown	
3337	41	57		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
3338	41	58	unmapped	0		0	TTTCTGGACACATCACAAGATGTGCACAGTGAAAAATGAAGTGTGAGGATTCCCACTAAA	3307	0	UF_Msa_CF_121897	contig28783___0	contig28783___0	Unknown	
3339	41	59		0		0		1978	1	ETG02_36680	ETG02_36680	ETG02_36680		CONTROL
3340	41	60	unmapped	0		0	TTTACTATTAGCAGCTAGTGCTACATCTATCTGGAGATACGGAGCACGGCCCATAGCTTT	3310	0	UF_Msa_CF_120298	LMB_S454.866.C1___0	LMB_S454.866.C1___0	Unknown	
3341	41	61	unmapped	0		0	GTCCTCAAGATCACCTTCAACGCCGACCGTCACGCCAGCATGCAGTGGAACTTCAAACCG	3312	0	UF_Msa_AF_107565	contig08196___1_nrnt0	contig08196___1_nrnt0	Unknown	
3342	41	62	unmapped	0		0	AATTCAGACATTGCAAAAGCTTGTGGAACCGTTTTCATCACTATTACACTTACGGCACCT	3314	0	UF_Msa_CF_118314	contig30696___0rc	contig30696___0rc	Unknown	
3343	41	63	unmapped	0		0	ATTACACTTGCACCGTGTTTGTGCCAGAAAAAATCCCATTTGAGGAGCTTGGTCCGTTTG	3316	0	UF_Msa_AF_100420	contig28932___1rc_nr1nt0	contig28932___1rc_nr1nt0	Unknown	
3344	41	64	unmapped	0		0	TGATCTCACAGACCCTAAAGCTCAGCTATTCCTGGATTCAGATGTGGCATCTGAGGACCG	3318	0	UF_Msa_AF_105444	contig08252___1rc_nr1nt0	contig08252___1rc_nr1nt0	Unknown	
3345	41	65	unmapped	0		0	CACAGGTTGGCATCCTCGAAGAGTGACGACAATCCAAATTTCTTGATAAGTTGTTCATGT	3320	0	UF_Msa_CF_120214	contig18219___0	contig18219___0	Unknown	
3346	41	66	unmapped	0		0	ATAAACACCGGAAGCAGTCAGCTTTCCGCTTCCTATCCAGAGATCCGCTCTACTACATCG	3322	0	UF_Msa_CF_124838	contig21061___0	contig21061___0	Unknown	
3347	41	67	unmapped	0		0	GGACCTCAAGAAGGAGCAACAGCAGAAGTACAAAATGTCTAAATGTTGTACACAGAAAAA	3324	0	UF_Msa_CF_118440	contig10836___0rc	contig10836___0rc	Unknown	
3348	41	68	unmapped	0		0	CTGAATAGTCAACAGGAGCTGAGTGTAAAAACACTGGCCGGAAAATGACAACTAGAAAAA	3326	0	UF_Msa_CF_127015	contig18032___0rc	contig18032___0rc	Unknown	
3349	41	69	unmapped	0		0	TTCTTTCATCAAGGCCCTGGCCAGTGAAATACTTTTAGACGTTCAAGAGGTCAAGCAGCA	3328	0	UF_Msa_CF_120169	contig22379___0	contig22379___0	Unknown	
3350	41	70	unmapped	0		0	ACATCACGAGGCAGGTGCCTCTCGACTTCCCTGTGAGGAATTCTGTGTACAGTGTCACCG	3330	0	UF_Msa_CF_125397	contig02461___0rc	contig02461___0rc	Unknown	
3351	41	71	unmapped	0		0	ATCAAAGATCAGTCTGTGCAGTGTGTCAGTTTGGTGGTAAAAATAATGTTCTCTGGTGCG	3332	0	UF_Msa_CF_119148	contig07546___0	contig07546___0	Unknown	
3352	41	72	unmapped	0		0	TTCGAGCAGTGTGACCCCGAGTCCCTGACTAAGAAATATCAACACCTTTCCCCGCGTACT	3334	0	UF_Msa_CF_127375	contig14159___0	contig14159___0	Unknown	
3353	41	73	unmapped	0		0	CTCTGTCTCTTCATCACTTCTAGGAGCAGGTGCTGTCTCAGTCTCTGTTCGTTCTTACCT	3336	0	UF_Msa_CF_124599	contig21378___0rc	contig21378___0rc	Unknown	
3354	41	74	unmapped	0		0	AAGAAGCTGAAAGCACAGAGATCCCCCGCCTCCGTACTCTGAACAAACCCTGCAGGACTC	3338	0	UF_Msa_AF_108677	contig14016___1rc_nr1nt0	contig14016___1rc_nr1nt0	Unknown	
3355	41	75	unmapped	0		0	CTAACAGGGTGATCGTGTACGGCGGAAGAGGCGCTCTGGGCTCAAAATGTGTCCAACATT	3340	0	UF_Msa_AF_105328	contig16103___1rc_nrnt-1	contig16103___1rc_nrnt-1	Unknown	
3356	41	76	unmapped	0		0	TAATCCGGGTAACTTTTTGTTTTAGAGGATTTGCGATATCGGCTTTTGTTCAAAAGCGCT	3342	0	UF_Msa_CF_122598	LMB_Sanger.15.C2___0	LMB_Sanger.15.C2___0	Unknown	
3357	41	77	unmapped	0		0	CTTCAAACTAAAGCCCAAGCAGTAGAATAATGAGGCATTTCTGTGTATTATTACTACGGG	3344	0	UF_Msa_CF_127351	contig02046___0rc	contig02046___0rc	Unknown	
3358	41	78	unmapped	0		0	TTGGTTCAGTGTAAGCACAGAAAGAACTTCGAAGGGAAGGGAAGCTAATGGCCTGAGTAA	3346	0	UF_Msa_AF_106059	contig19072___1_nr0nt	contig19072___1_nr0nt	Unknown	
3359	41	79	unmapped	0		0	AACATGTAGCAGGACATCATGGCAAGGTTCCTCACCTCGTCATTGGTCATACAGTTTTGT	3348	0	UF_Msa_CF_125479	contig10304___0rc	contig10304___0rc	Unknown	
3360	41	80	unmapped	0		0	GAAAAAACAAAAACAAATACAACGGCTTTCGAGGACTTCGTCCAGTCGATGGACGTCGCT	3350	0	UF_Msa_AF_102443	contig28918___1rc_nr0nt	contig28918___1rc_nr0nt	Unknown	
3361	41	81	unmapped	0		0	ACTGCAAGACGATAATTTACCAAACTCCGGACGGTAAATCCTACTGAAGGAGAGAGCTCT	3352	0	UF_Msa_CF_122605	contig08815___0	contig08815___0	Unknown	
3362	41	82	unmapped	0		0	AATGAGGCTAAGATGGCTTACATGAGGCCTCCTGGGGGTAGCGCTGCTGCCATGGATGAA	3354	0	UF_Msa_AF_107428	contig16839___1rc_nrnt0	contig16839___1rc_nrnt0	Unknown	
3363	42	1	unmapped	0		0	ATTTACGATCCATCCGGCGATTCTACTATTCCCTCCACCTCAAAGAAGAGGAAGTTTGAG	3201	0	UF_Msa_AF_109655	contig29254___1_nrnt	contig29254___1_nrnt	Unknown	
3364	42	2	unmapped	0		0	TGGTGTATAGATGTTCCTTCAATGGTAGCTATTTCTCTAACTGGACTTTTAGTGCACATA	3203	0	UF_Msa_AF_101364	contig07463___1rc_nr0nt1	contig07463___1rc_nr0nt1	Unknown	
3365	42	3	unmapped	0		0	GCTCACTCCGGGCATGATGGAGAACCTCTTTCATGAGATGGGACACGCCATGCACTCCAT	3205	0	UF_Msa_AF_108073	contig02162___1_nrnt	contig02162___1_nrnt	Unknown	
3366	42	4	unmapped	0		0	GGCCGGGTGGCATCCAGCCTCGTGGCAAGACGGACATTACAGGTTGATCCATGCATAGGT	3207	0	UF_Msa_AF_101175	contig07663___1rc_nr0nt	contig07663___1rc_nr0nt	Unknown	
3367	42	5	unmapped	0		0	CCATAAGGAGGAGGAGCTTCTCTCTGGTTGGTTTGTCCTCTGTCATTCAGGCTGTTTCTG	3208	0	UF_Msa_CF_127603	contig21726___0rc	contig21726___0rc	Unknown	
3368	42	6	unmapped	0		0	AATTAAGTCCTCCAACGAGATGTCGACGTTTCACAGGTGACATTCCAGGCCTCGAGTTCG	3210	0	UF_Msa_CF_125058	contig22277___0	contig22277___0	Unknown	
3369	42	7	unmapped	0		0	TGTGAACAGGAAGTGATGTCATGCTGTCAGCGTGTGAAATAAAGTGTGAGCTTTGTTGCA	3212	0	UF_Msa_AF_106967	LMB_S454.sd.112.C1___1_nrnt	LMB_S454.sd.112.C1___1_nrnt	Unknown	
3370	42	8	unmapped	0		0	ATTACAGAATCACTGTCTTCGCCACCTGCCACGCCATCAGGAGGAGCTTCAGTGGACCCT	3214	0	UF_Msa_AF_100221	contig21992___1_nrnt	contig21992___1_nrnt	Unknown	
3371	42	9	unmapped	0		0	CAATGGTCTGGTGAAAGGAACTGTGGGAGATGGATGGATGGTAGGCTCCAGCCTGCGTGT	3216	0	UF_Msa_CF_119551	contig08073___0rc	contig08073___0rc	Unknown	
3372	42	10	unmapped	0		0	TTTCCAGGCTATAAATGTGGTTCTGAAGGCCATGGAGGGCGCACACGGCTCGGAGAAACC	3218	0	UF_Msa_AF_103736	contig31008___1rc_nrnt-1	contig31008___1rc_nrnt-1	Unknown	
3373	42	11	unmapped	0		0	TGGTTAAAGAATGAGCTGGAAAGAGACAGTAAGATTGTAGTACCATCTCTGCCGGGCGAA	3220	0	UF_Msa_AF_100864	contig31387___1_nrnt	contig31387___1_nrnt	Unknown	
3374	42	12	unmapped	0		0	GACGCATCTCTATTCCAGACTTGTACGACATCCTCCCGGTCTCGAACACTAACACTGACA	3222	0	UF_Msa_CF_117885	contig03164___0rc	contig03164___0rc	Unknown	
3375	42	13	unmapped	0		0	TAAAAAAGAGGCCTGGAGTTGAAGTCCTGCGAGAGAAGCTGATGGATGTTTAATGGAGGA	3224	0	UF_Msa_CF_122496	contig07795___0	contig07795___0	Unknown	
3376	42	14	unmapped	0		0	CATGTGGTTGTTCCTACTTTACTGACAGAAAAGTCAGTGACATTAATTTGTTTGGAGAAA	3226	0	UF_Msa_CF_127544	LMB_S454.701.C1___0	LMB_S454.701.C1___0	Unknown	
3377	42	15	unmapped	0		0	AATAGTTGCAGATTATTTTTCTGTCAAATCGACCGATCGTTTCACCCCTTGATGGGCCGC	3228	0	UF_Msa_CF_124111	contig22327___0rc	contig22327___0rc	Unknown	
3378	42	16	unmapped	0		0	CAGTTGCTCCATAATCCAGTGTCTGTGCTTGGGTTCATATGGATGTTAATAAAACCCTAC	3230	0	UF_Msa_AD_200281	LMB_Add_35_rc	LMB_Add_35_rc	Unknown	
3379	42	17	unmapped	0		0	AGTGTCTACCGGTTCAGTGAATTTTCTGCAGGGGCCCCTCAGACCTGGCTAAGGGACAAG	3232	0	UF_Msa_CF_120266	contig10259___0	contig10259___0	Unknown	
3380	42	18	unmapped	0		0	ATCAAGAATCTTGTTGTTAAATGCTTGGGTTTCGACACGCGAGTGACAATCCTGGGGCAT	3234	0	UF_Msa_AF_106525	LMB_S454.sd.227.C1___1rc_nrnt	LMB_S454.sd.227.C1___1rc_nrnt	Unknown	
3381	42	19	unmapped	0		0	GAAAATATCTCCAGAAATAAGACAGATTCTGGCTCTAGCACCCTTATCCCTCCAACACAT	3236	0	UF_Msa_CF_122347	contig02884___0rc	contig02884___0rc	Unknown	
3382	42	20	unmapped	0		0	ACGGCGTGACTGCCCAGCGCTCTGACAGCGAGGGTAGCGACTACACTCCTGGACGCAAAA	3238	0	UF_Msa_CF_126604	contig29489___0rc	contig29489___0rc	Unknown	
3383	42	21	unmapped	0		0	CAGGACTTTGTGGTTATGGCCTCCTTTATCAAATACTCCAGTATGTGATCTATGGCCTAG	3240	0	UF_Msa_AF_101405	contig06930___1rc_nrnt-1	contig06930___1rc_nrnt-1	Unknown	
3384	42	22	unmapped	0		0	CATTTATCAGACATCAATTCCATGGTGTTGAATAAGACTTCGCCTCGCTGAGAGGCAGAG	3242	0	UF_Msa_CF_117864	contig27062___0rc	contig27062___0rc	Unknown	
3385	42	23	unmapped	0		0	ACAAGCCGCTAAAATGAGTAAGGTTTCCAGGGATACGCTGTATGAAGCCGTAAGAGAGGT	3244	0	UF_Msa_AF_110249	LMB_S454.751.C1___1_nr0nt1	LMB_S454.751.C1___1_nr0nt1	Unknown	
3386	42	24	unmapped	0		0	AATGAGAGCACAGATTCCCTCAGACCAGCCAACCAAGAGTTAAAAGTCCAGATCACTTGA	3246	0	UF_Msa_CF_126220	LMB_Sanger.8.C1___0rc	LMB_Sanger.8.C1___0rc	Unknown	
3387	42	25	unmapped	0		0	CTGCTGTGTGTGCTGGGCTTTATATCTGCCATTGTAGTCAGTGCCCTGGACAAGATCGGT	3247	0	UF_Msa_AF_104493	contig11454___1_nr1nt0	contig11454___1_nr1nt0	Unknown	
3388	42	26		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
3389	42	27	unmapped	0		0	TACTCATATCGCAGGGCTATGTTGGATCAGTAGAGTGCTCTTACACATACCTTCACACAG	3250	0	UF_Msa_CF_122954	contig03605___0	contig03605___0	Unknown	
3390	42	28	unmapped	0		0	AGAGGAAAATAAGTCACCAGAGGTCTGCAGCAGAAAATCTTGTCATTTCTTTCAAATAGA	3252	0	UF_Msa_AF_103307	contig11321___1_nr0nt	contig11321___1_nr0nt	Unknown	
3391	42	29	unmapped	0		0	TGCTTTACAAAGGAGTGAAAGTACCAGAGTCATTTGACTGGAGGCTTTACGGTGCTGTGA	3254	0	UF_Msa_AF_104926	contig16121___1rc_nrnt0	contig16121___1rc_nrnt0	Unknown	
3392	42	30	unmapped	0		0	AAGTGCTTTTTATCTCAGGCCTGTTCCCTGCCACCAGACTTCATGTAAGCACACAAATTG	3256	0	UF_Msa_AF_100624	contig32659___1_nr0nt	contig32659___1_nr0nt	Unknown	
3393	42	31	unmapped	0		0	AAGAGGAGGAGCGTCTCAGACAATCTCCCATCATCCAAGAGCCGGAACCCGAGGAGGAAA	3258	0	UF_Msa_CF_127044	contig25385___0	contig25385___0	Unknown	
3394	42	32	unmapped	0		0	TTTACACATCAACTGCCTGCGTGCATTCCCTGTCAACATGGTGGTGTTTGTTACGTATGA	3260	0	UF_Msa_AF_108099	contig13113___1rc_nrnt0	contig13113___1rc_nrnt0	Unknown	
3395	42	33	unmapped	0		0	CCATTTATTGAAAAAGTTACGTGAGTGCATGTAACAGAGTAAATGTAACTCGTTACTACC	3262	0	UF_Msa_AF_100934	contig05676___1_nr0nt	contig05676___1_nr0nt	Unknown	
3396	42	34	unmapped	0		0	AGTGTCTGTGCACCAGTCTTCGCAACTCTTCATCTGAGTTCAGTTTACATTCATTCCAAG	3264	0	UF_Msa_CF_123926	LMB_S454.1068.C1___0	LMB_S454.1068.C1___0	Unknown	
3397	42	35	unmapped	0		0	TTGTGTTATTCCTGGAGGTTTTACGGTACTGCCCTTACAGTTTAGTTCCGACAGCGTTGC	3266	0	UF_Msa_AF_101891	contig30630___1_nrnt	contig30630___1_nrnt	Unknown	
3398	42	36	unmapped	0		0	AGACGAGGAGGCCAGCCTGCAGAAGGGCCTCAAGTTCAACCTCATCAACGACAACGTCAA	3268	0	UF_Msa_CF_124906	contig08876___0rc	contig08876___0rc	Unknown	
3399	42	37	unmapped	0		0	GGAAGGCATGGATATGTCATTTAACTCCCACAGTGCATCCCAAGAGACAAACACATTCTC	3270	0	UF_Msa_CF_127222	contig21672___0	contig21672___0	Unknown	
3400	42	38	unmapped	0		0	GTTGCCCAGGTTCACGATCCTGCCTCTCACAGATGCTCTGCTGGGAGTCTTATAGTTGCT	3272	0	UF_Msa_CF_127761	contig13730___0rc	contig13730___0rc	Unknown	
3401	42	39	unmapped	0		0	CTGCTCTCATCACAGCTCTGCAACTCATCTGTGAATTCTTGGCTCTTAAAAATGACATCA	3274	0	UF_Msa_CF_118680	contig19206___0rc	contig19206___0rc	Unknown	
3402	42	40	unmapped	0		0	GTGCCCCCTGTGTCGGGAGAAGTTCCAACCTCACAGACTGGTGTACTTGAGAACTACATA	3276	0	UF_Msa_AF_103843	contig20815___1_nrnt	contig20815___1_nrnt	Unknown	
3403	42	41	unmapped	0		0	TCCAGTTGACGACTCCTTAAAGAATGACGACGCAGAGAAGGAAGTGAAGAAAGAGGGCGA	3278	0	UF_Msa_CF_126806	contig09295___0	contig09295___0	Unknown	
3404	42	42	unmapped	0		0	TACTGTTCATGCTGTGCTGCAGGTGACAACTGGAGTCATGTCAACTCTCAAGATTAACCA	3279	0	UF_Msa_AF_102611	contig26791___1rc_nrnt0	contig26791___1rc_nrnt0	Unknown	
3405	42	43	unmapped	0		0	TAATCTGGACAAACCTCAATTCAGTGCAGGACTTTAACCTCTTCTCCTCTGAAGCCTACG	3281	0	UF_Msa_AF_102084	LMB_S454.sd.380.C1___1rc_nrnt	LMB_S454.sd.380.C1___1rc_nrnt	Unknown	
3406	42	44	unmapped	0		0	TCTGTTCATGTAAAGCTGACCCGCCGGCGTCTGAGTACCGCTGGTCCTACAGTCAACATG	3283	0	UF_Msa_AF_106708	contig03503___1rc_nrnt0	contig03503___1rc_nrnt0	Unknown	
3407	42	45	unmapped	0		0	AAATGAAGAAGAGTACCACTACTAGATATCCGGTGTCTTAGTCCTGTATCCTGCATGACT	3285	0	UF_Msa_CF_119192	contig02452___0	contig02452___0	Unknown	
3408	42	46	unmapped	0		0	AGTGCAGCCACCTGCTTACAGTCAAAGGGCATGCTCTTTGGCGTGTTTGACGGCATAGGG	3287	0	UF_Msa_AF_107743	contig26421___1_nr0nt	contig26421___1_nr0nt	Unknown	
3409	42	47	unmapped	0		0	TGATTGTTTCACACCACCGCCTGTTGGAACCCCAAAAAATAATTCTGTTCCAAGCATTTG	3288	0	UF_Msa_CF_120054	contig07315___0	contig07315___0	Unknown	
3410	42	48	unmapped	0		0	AAGGACCCCTTATTAGACTTGCCGGGAAACTGCTACGGGGAAAAAGGAAGAAACAAAAAA	3290	0	UF_Msa_CF_125341	LMB_S454.sd.31.C2___0rc	LMB_S454.sd.31.C2___0rc	Unknown	
3411	42	49	unmapped	0		0	CTGCACTTATGACTACAAGAGTGCTGGTCGGCGATTTCTGCAGGAGACCAACCCTCTTAT	3292	0	UF_Msa_CF_117757	contig22152___0	contig22152___0	Unknown	
3412	42	50	unmapped	0		0	ATGTTGAAACTGAGCCAGAGAAAGTTTAAGTCATCAGGGTGGGGCGATGTTAAGACAGGA	3294	0	UF_Msa_CF_127316	contig17121___0	contig17121___0	Unknown	
3413	42	51	unmapped	0		0	TTTTTCATGAAGAGAGCGGAGGCCGTCTCTCCCTCGATGTCACTGTCGTCTGAGCTCTCC	3296	0	UF_Msa_AF_103040	contig15126___1_nr0nt1	contig15126___1_nr0nt1	Unknown	
3414	42	52		1028	E1A	0		1348	1	(+)E1A_r60_a20	E1A_r60_a20	E1A_r60_a20		CONTROL
3415	42	53	unmapped	0		0	TCTACCACAGGTTGGAGTTTTCTCGCACCCAGCACCATGTGACCGCACAGGTGTTCTCCA	3299	0	UF_Msa_AF_101968	contig00995___1_nrnt	contig00995___1_nrnt	Unknown	
3416	42	54	unmapped	0		0	GGCAGGCTGAACTCTTAAGTCACAAATTATTCCCTAAACTTTCACAATTTAAGAGCTTAT	3301	0	UF_Msa_CF_120566	LMB_S454.sd.194.C1___0rc	LMB_S454.sd.194.C1___0rc	Unknown	
3417	42	55	unmapped	0		0	AAGGTTGATGGAGGTTAATGGAACACTTCAGAAGGTCAGAGATGGCTTCCTGGAGAAATC	3303	0	UF_Msa_AF_103283	contig32352___1_nrnt	contig32352___1_nrnt	Unknown	
3418	42	56	unmapped	0		0	CGCTGGCGAAGTCCGTCTACAATCTGCTCTTCAGGAGAACGTCCACTTTCGCTATAACCA	3305	0	UF_Msa_AF_108483	contig05858___1_nr0nt	contig05858___1_nr0nt	Unknown	
3419	42	57	unmapped	0		0	ACCACAGATCCTGAACCCCCACTGGAAGAATTGTGCAACCACATGTTTTATAACAATCCA	3306	0	UF_Msa_AF_106480	contig27811___1_nrnt	contig27811___1_nrnt	Unknown	
3420	42	58	unmapped	0		0	AAAGTCAGCTGAAGGAAAACACTGCTGGCTACTTAAAACCATGGCTGCGGAGATTCATTC	3308	0	UF_Msa_CF_122089	contig15730___0	contig15730___0	Unknown	
3421	42	59	unmapped	0		0	TCTGCTCCATGTTCAGTGACAATACTGTGTCAGAGTACATCTACCACCTGAACGTGCAAA	3309	0	UF_Msa_AF_108429	contig32377___1_nrnt	contig32377___1_nrnt	Unknown	
3422	42	60	unmapped	0		0	CTTTTAGGGAGGGGGCCTTAAAGAGACAGGAGCTAAAACAGAGTAAATATTAGAAAGATG	3311	0	UF_Msa_AF_101541	contig03296___1_nr0nt	contig03296___1_nr0nt	Unknown	
3423	42	61	unmapped	0		0	CGGGGCAGATCCCTCAGCAGCCTGCAAGACGGCCATTTCCAGAATCAAGAGGCATTACTC	3313	0	UF_Msa_AF_105478	contig14527___1_nrnt	contig14527___1_nrnt	Unknown	
3424	42	62	unmapped	0		0	ACTAAAAAGGGTTAAAATGAGAGTAAATTTCATGTCGTATAGTGGCTCTACTTTATGTAG	3315	0	UF_Msa_AF_106642	contig16612___1_nr0nt1	contig16612___1_nr0nt1	Unknown	
3425	42	63	unmapped	0		0	GGCTGTTATCAAGTCGCAACAAACACGCTGTCAACTTAAAGCACCTCCATACGAGGCAGA	3317	0	UF_Msa_CF_124550	contig15547___0	contig15547___0	Unknown	
3426	42	64	unmapped	0		0	AGACCCAGTTTGATGAGGGGAGAGTGGATGGTCGCATGCTGCACTACATGACAGTGGATG	3319	0	UF_Msa_AF_107668	contig07675___1rc_nrnt	contig07675___1rc_nrnt	Unknown	
3427	42	65	unmapped	0		0	TCACATGTCACAGTAGCTTGATTCTCAGATGTAATTTTGTGTATGCAGTATTCCTGTGCA	3321	0	UF_Msa_AF_108576	contig07624___1rc_nr0nt1	contig07624___1rc_nr0nt1	Unknown	
3428	42	66	unmapped	0		0	TCAGCCCCCATCAGGCAAATCCACTCCTAGCTCAAGTGATGTGCAGCTAACGGAGGAAGC	3323	0	UF_Msa_AF_101575	contig05464___1rc_nrnt0	contig05464___1rc_nrnt0	Unknown	
3429	42	67	unmapped	0		0	AGAAAGCCCTGGTAGAGATCCTCGCCTCCAGAACACCTCAGCAGGTGAAGGACATCATCG	3325	0	UF_Msa_AF_107667	contig22606___1_nr0nt	contig22606___1_nr0nt	Unknown	
3430	42	68	unmapped	0		0	TTCACAAGGACAACAAAGGTAAAGGTTTGGAGATTAAATAAATGCACATAATGTCTGACG	3327	0	UF_Msa_AF_109536	LMB_S454.478.C1___1_nrnt	LMB_S454.478.C1___1_nrnt	Unknown	
3431	42	69	unmapped	0		0	TGGCTCCGGAGGAGTTGGAGCTGGACCCCATGGCCATGACGCAGAAGTACGAGGAGCACG	3329	0	UF_Msa_AF_101428	contig09453___1_nr0nt1	contig09453___1_nr0nt1	Unknown	
3432	42	70	unmapped	0		0	GTTGGAACAGAGTATAACTTTCAAAGAGACTCTATGAATGAAGTATTTGGATGCCATGTA	3331	0	UF_Msa_CF_123212	contig05091___0	contig05091___0	Unknown	
3433	42	71	unmapped	0		0	TGCTTTGCCTTCAAGACTGGGACACAATGACAACTGTTCCCCAAAGCAGAAACTTCATCA	3333	0	UF_Msa_CF_123421	contig20377___0rc	contig20377___0rc	Unknown	
3434	42	72	unmapped	0		0	GAATGGTTTGATTAGTTTTATGTTGCTATTAATTGGCTCTGGGCTTTCCTTAATGAGTGT	3335	0	UF_Msa_CF_118759	contig31282___0rc	contig31282___0rc	Unknown	
3435	42	73	unmapped	0		0	GCCAGCGTCCACCGCCTGTTTGACCTCTTCGGCTGGGCCCAGATCAACCGCGCTCGTCTA	3337	0	UF_Msa_CF_123245	contig22329___0rc	contig22329___0rc	Unknown	
3436	42	74	unmapped	0		0	ATTCATCAAAAATGTAACACTGGCGCTGCCTGTGGACAAGGGAGGAATTAAATCCCACTC	3339	0	UF_Msa_CF_124253	contig27944___0	contig27944___0	Unknown	
3437	42	75	unmapped	0		0	CCCAGGTCCCTCCCGGTTGTAAATATTTGTGGGTTTTTAAAAGAAGCAGAACTGAAAACA	3341	0	UF_Msa_CF_122325	contig25224___0	contig25224___0	Unknown	
3438	42	76	unmapped	0		0	TGAGCCATTTGTCTCAGGCTGGAGAGAGAGTGAGCCCTGGAAGAAGAAGAAGAAGAAAAG	3343	0	UF_Msa_CF_126750	contig24064___0rc	contig24064___0rc	Unknown	
3439	42	77	unmapped	0		0	TCATTAATCAAGAACGAAAGTCGGAGGTTCGAAGACGATCAGATACCGTCGTAGTTCCGA	3345	0	UF_Msa_AF_104354	contig11325___1_nrnt	contig11325___1_nrnt	Unknown	
3440	42	78	unmapped	0		0	GAAGTCCACTGAAAACTCTGCTGCCACCGCAACAGCAATCACAAAAGGCCGTGACATCAT	3347	0	UF_Msa_CF_122678	contig13347___0rc	contig13347___0rc	Unknown	
3441	42	79	unmapped	0		0	TAACAAAGAGATTTGAGACACTAGACCTGACTCACACTGCGCTGACCAGAGAAAGGAACA	3349	0	UF_Msa_CF_118831	contig14568___0rc	contig14568___0rc	Unknown	
3442	42	80	unmapped	0		0	TCACTACCAACGACATTGACATGTGCCACATGAACAATGCTCGTTACCTCCGGGAGTGTG	3351	0	UF_Msa_AF_106736	contig31493___1_nrnt0	contig31493___1_nrnt0	Unknown	
3443	42	81	unmapped	0		0	TTGGTCATGATCCACATCTACGAGCCGGATGTCCCGGGCTGTGAGGCCATGAGTGGCAGC	3353	0	UF_Msa_AF_106914	contig10676___1_nrnt0	contig10676___1_nrnt0	Unknown	
3444	42	82	unmapped	0		0	ACCTGCAAGGAAACCAAGAATTACGGATGAAGAAACATTGTGTCGGCTTTTATTCACCCT	3355	0	UF_Msa_CF_119909	contig25249___0rc	contig25249___0rc	Unknown	
3445	43	1	unmapped	0		0	GTACTAACCTTTCTCTTCTTAGGAGTGGCTTGTATTATCTTGATGGTGTATCTTATGTTT	3356	0	UF_Msa_AF_106019	contig31127___1rc_nrnt0	contig31127___1rc_nrnt0	Unknown	
3446	43	2	unmapped	0		0	CTGGAAAAAGTGTTACTTTTCATATAAGTGCCTGAGGTTAACACCATGGATGGACTCATG	3358	0	UF_Msa_AF_107099	contig32847___1_nr0nt	contig32847___1_nr0nt	Unknown	
3447	43	3	unmapped	0		0	AGTATAAACAAGGCCCAAGTGACGCCGTTGACGGCAAATTAGCGGGGTTGAAACACAACG	3360	0	UF_Msa_CF_118280	contig24537___0	contig24537___0	Unknown	
3448	43	4	unmapped	0		0	ATCCAGAGTCTCTCTGCAGAGATTGAGAGTCTTAAAAACCCACTAGACCAGAACCAGAGT	3362	0	UF_Msa_CF_122760	contig18611___0	contig18611___0	Unknown	
3449	43	5	unmapped	0		0	ACTGGAACGGCTCAGCAGTGAGCAGGGCCAACGTGGCCGTTAGTGGCTGTAGCCCTAATG	3364	0	UF_Msa_CF_120565	contig26638___0rc	contig26638___0rc	Unknown	
3450	43	6	unmapped	0		0	AAGAACCCATACTTCCTGACCAATTCCTCACATTCAGCTGTGTCCTGGGAAATATCTGGA	3366	0	UF_Msa_CF_126452	contig09687___0	contig09687___0	Unknown	
3451	43	7	unmapped	0		0	ATGACAGTAAATGTACTCCATGATCACTCAAACGTGCTCCAGCACTTGGACCTAAGAAAG	3368	0	UF_Msa_AF_109436	contig26354___1_nr0nt1	contig26354___1_nr0nt1	Unknown	
3452	43	8	unmapped	0		0	GGGAGACATCATGGCAGCAGTCTCAGATCTTCAGACATAGCTTAAAGGAGCCAGAAGAGT	3370	0	UF_Msa_CF_121779	contig22532___0	contig22532___0	Unknown	
3453	43	9	unmapped	0		0	AACAAAATGATGATTTGGATTCAAACCACCACGAACATCCAGTTCCAGTGGAGGATGCAG	3372	0	UF_Msa_CF_118204	contig00625___0	contig00625___0	Unknown	
3454	43	10	unmapped	0		0	TAAAGAGGGACGTCCTGCTCAATAAAGACTATTTCCACATGCAGGAACAAGAGAGGCAGA	3374	0	UF_Msa_AF_105418	contig32704___1rc_nrnt-1	contig32704___1rc_nrnt-1	Unknown	
3455	43	11	unmapped	0		0	TCTTTTTAGGTCATCTGATGCCAGTCCTCTCAGTCCAGTGGATCTGCTGCTTTGAAAAGA	3376	0	UF_Msa_CF_118404	contig30310___0rc	contig30310___0rc	Unknown	
3456	43	12	unmapped	0		0	ACTATGATGCTGCCAGCAGCAGCGAGCTTTCCCTGCTGGCTGATGAGGTCATCACAGTCA	3378	0	UF_Msa_AF_100607	contig12292___1_nr0nt1	contig12292___1_nr0nt1	Unknown	
3457	43	13	unmapped	0		0	GATCAAGATGGCGTCGTCCATGAGTGGGATGTTCTCCGGTCAGCAGCCGTCTGGTGCGCA	3380	0	UF_Msa_AF_105131	LMB_S454.990.C1___1_nr0nt	LMB_S454.990.C1___1_nr0nt	Unknown	
3458	43	14	unmapped	0		0	TATCTGGTCTGCTGCAATGGATGCGGACTTGGAGCGGGTCAAGTACTTGATCCAGAAGGG	3382	0	UF_Msa_CF_125236	contig07309___0	contig07309___0	Unknown	
3459	43	15	unmapped	0		0	GTGATGATGAGACAATAAAGCTGTGGGACAAAAACAGCAGAGAGTGTATTCATTCTTTCT	3384	0	UF_Msa_AF_107009	contig27003___1rc_nrnt0	contig27003___1rc_nrnt0	Unknown	
3460	43	16	unmapped	0		0	AAGGACACTTTGGCAACAATCTCAGAGCCAGTAACTCACAACACGTATGGCAGGAATGAA	3386	0	UF_Msa_AF_100226	contig24461___1_nrnt0	contig24461___1_nrnt0	Unknown	
3461	43	17	unmapped	0		0	TCCTGAGTGACGGTCAGCCCGGACACGAGGCGCGTCCTCACGGCTACAGTAGCTGCTCAG	3388	0	UF_Msa_CF_123506	contig00489___0rc	contig00489___0rc	Unknown	
3462	43	18	unmapped	0		0	ACCCCATCTGCACCTTCCTGTTCTCCATATTTGTCTTGTGCACCACCTTCACCATCATGA	3390	0	UF_Msa_AF_107723	contig11742___1rc_nr0nt	contig11742___1rc_nr0nt	Unknown	
3463	43	19	unmapped	0		0	TTTTAATGAGTTGGGAAGCCAACATGTGACTCCCAGAAAGTTGGTGTTGGGCCATGATGT	3392	0	UF_Msa_CF_125437	contig22102___0	contig22102___0	Unknown	
3464	43	20	unmapped	0		0	CCCACTGGATTTTGCCGGGAGAGGTTGACCATGCTGACAATGAAGCCAAACACTTGATCC	3394	0	UF_Msa_AF_103176	contig24476___1_nrnt	contig24476___1_nrnt	Unknown	
3465	43	21	unmapped	0		0	CCACCACTGTTAACTTAGACAACCAACACATGATGGACCTGCTGACATATCAGTAAAGCA	3396	0	UF_Msa_CF_117832	contig17981___0	contig17981___0	Unknown	
3466	43	22	unmapped	0		0	ATCAGCCCAGCCTGTTTCGGAGTTGGAGGTGGCAGCAGAAGAAGAGCTCCATGTTGCTTC	3398	0	UF_Msa_CF_125655	contig20678___0rc	contig20678___0rc	Unknown	
3467	43	23	unmapped	0		0	TTGTAATATCACTCTATATAGGATTGATTGGGCCGTACGTTGCATGCTACCGGCCTCCAT	3400	0	UF_Msa_AF_108971	LMB_S454.sd.24.C1___1_nr0nt1	LMB_S454.sd.24.C1___1_nr0nt1	Unknown	
3468	43	24	unmapped	0		0	ACTACGCAAGAAAGATGAGTACTCACTGCTAAGGACAAGGCAACAAGTCAAAGCCTTCTG	3402	0	UF_Msa_CF_123236	contig15347___0	contig15347___0	Unknown	
3469	43	25	unmapped	0		0	TGAAGCACCCATGCATGATGATGCAGAAAAAGCACCAACAGTGGCCAAAGCTGGTAAAAT	3404	0	UF_Msa_CF_119928	contig12643___0rc	contig12643___0rc	Unknown	
3470	43	26	unmapped	0		0	ATCAGCCTGTACGGAGTCAGTGTCCTGTCTGAAAACATCTCTTCTGGAAAGCATTTTGAG	3406	0	UF_Msa_CF_122865	contig25065___0rc	contig25065___0rc	Unknown	
3471	43	27	unmapped	0		0	TAGGCCCCGACATGGAGACCTTCCTCCAGCTCGTCCAGAACAAACCCTGCAACTCCGGCT	3408	0	UF_Msa_AF_103358	contig21135___1rc_nrnt	contig21135___1rc_nrnt	Unknown	
3472	43	28	unmapped	0		0	GTTCCTGTCACCTTCCTCAAAAAGGAGCCCAAAGTTGAGGAGACCCCCATGCCTACCACT	3410	0	UF_Msa_CF_122100	contig17458___0rc	contig17458___0rc	Unknown	
3473	43	29	unmapped	0		0	TATAGGTTTAAAAGTGCAGCTAGTTGGCAGCTTGTCAATAGGGGTGGGTTATCACCAGAG	3412	0	UF_Msa_CF_119534	contig22748___0	contig22748___0	Unknown	
3474	43	30	unmapped	0		0	AGAATACAGCTCCCCATCTCAACTACTACTGGGTACCCATCCTGACTGTGGCGCTGGGCT	3414	0	UF_Msa_AF_104344	contig17316___1rc_nrnt0	contig17316___1rc_nrnt0	Unknown	
3475	43	31	unmapped	0		0	TGTAGATAGAAGGGCAGTTCCTGTAATTGTCTGTGACATTGATTGACTGTTTGCTATTGT	3416	0	UF_Msa_AD_200278	LMB_Add_129_rc	LMB_Add_129_rc	Unknown	
3476	43	32	unmapped	0		0	TAAAAGGGGAAAGGAGGCTTGTCCAATTATACGTACAGTAGAAACCAGTGGTGGGAGAAG	3418	0	UF_Msa_CF_124741	contig02649___0	contig02649___0	Unknown	
3477	43	33	unmapped	0		0	GTGGGATCACATTAACAAAGTTTGGCCGGTTTCTAATCCTGGTCACTTTCCTAAGTCACT	3420	0	UF_Msa_AF_100543	contig22878___1rc_nr0nt	contig22878___1rc_nr0nt	Unknown	
3478	43	34	unmapped	0		0	TTACCAGATGGCCGAGTACCTAAAACTGGAGTTCATCAAGGAGATCGGTTACACTCACAT	3422	0	UF_Msa_AF_105424	contig14388___1rc_nrnt	contig14388___1rc_nrnt	Unknown	
3479	43	35	unmapped	0		0	TTCATGGCGGACTCTGTTGTCAAGGGGAACTTGATGATGGCATAATGATCCAACTTGTTC	3424	0	UF_Msa_AD_200110	LMB_Add_36_rc	LMB_Add_36_rc	Unknown	
3480	43	36	unmapped	0		0	AAACGAACCAGGAACACAGAACCATTAGAGTTGCAGCCAGAAAGCTCTAGTGTTCTTCCT	3426	0	UF_Msa_CF_122852	contig15209___0rc	contig15209___0rc	Unknown	
3481	43	37	unmapped	0		0	CAGGGTGAATTGCAGAGGTCTTGAAAAGGAAGGGTCAACACTGCAAATATTGACTCTTTG	3428	0	UF_Msa_AF_100519	contig28760___1_nrnt	contig28760___1_nrnt	Unknown	
3482	43	38	unmapped	0		0	TCTGCACAGACACACACAGAAGCTGCAGGCTCTACAGCAGGAGGCCAGACAGTTGGAGAA	3430	0	UF_Msa_CF_127110	contig25200___0	contig25200___0	Unknown	
3483	43	39	unmapped	0		0	GACATTGAGCTGCAGAAGTCAGTTATACTAATATAAACCGAAGTCACATTTTGGCTCAAA	3432	0	UF_Msa_CF_127681	contig05094___0rc	contig05094___0rc	Unknown	
3484	43	40	unmapped	0		0	TGAATGCAGCCAAATACCAGTACGCCATAGATCAACATCATCGGGTCCACAAGACAACAA	3434	0	UF_Msa_AF_104666	contig07971___1_nrnt	contig07971___1_nrnt	Unknown	
3485	43	41	unmapped	0		0	TTAAGATCGACAGGAAGATGTCAACAGGAAAATGGCGTCCGTCAGTAACACTGAAGCTCT	3436	0	UF_Msa_CF_118642	contig32491___0rc	contig32491___0rc	Unknown	
3486	43	42	unmapped	0		0	TCATCGTGGCAGTCCAGCACAGGATACAGACACAACCATGACCAGTACAACCAGTACCAG	3438	0	UF_Msa_CF_118716	contig28586___0	contig28586___0	Unknown	
3487	43	43	unmapped	0		0	ACACCCCAAGTGGAGAGTGACGCTACAGATCAGGCTACTTCAGTCTCTAAGAACACCATT	3440	0	UF_Msa_CF_119347	contig21386___0	contig21386___0	Unknown	
3488	43	44	unmapped	0		0	GACTCGGATTTATCCTCTGTGGAGGATAAGCAGGATAATAAAAAGAAGAAAACGGGGAAA	3442	0	UF_Msa_AF_106082	contig27227___1_nrnt0	contig27227___1_nrnt0	Unknown	
3489	43	45	unmapped	0		0	GATTATACCAAATATAAGAAGGAGCTGTTTTCTCTCCACATGCAAGATGTAACGACCACT	3443	0	UF_Msa_CF_118963	contig08134___0	contig08134___0	Unknown	
3490	43	46	unmapped	0		0	TCGCCTCCTCCCAGAGCTCTGTGTTAATCGCTCAACGGTTGCCTTATCTTGCATACCTAC	3445	0	UF_Msa_CF_123894	contig17279___0rc	contig17279___0rc	Unknown	
3491	43	47	unmapped	0		0	TGAATTTGAGCTCCGGCTCACTGCCTCCTATCTGGAGTATGCCTATAAGAAATGTAAGCT	3447	0	UF_Msa_AF_104882	contig13734___1_nrnt	contig13734___1_nrnt	Unknown	
3492	43	48	unmapped	0		0	AAAGTGACAGAGTGGTTATGTGGTTGGCTTGAAACCAACACATGGGGTTCGACTCCTCCC	3449	0	UF_Msa_AF_103397	contig04451___1_nr0nt1	contig04451___1_nr0nt1	Unknown	
3493	43	49	unmapped	0		0	GTCTGGGGTGACCTGTCTACATGTTACAAGGATGGCGATACTTGGAAGTTCCTACAGGAG	3451	0	UF_Msa_CF_126648	contig16227___0	contig16227___0	Unknown	
3494	43	50	unmapped	0		0	AGCTTGTGATGACTTCTGGCCGACATGAAATCCCTGAAGTCAGACGGCCCCACTCTCAGT	3453	0	UF_Msa_AF_107852	contig03696___1_nr0nt	contig03696___1_nr0nt	Unknown	
3495	43	51	unmapped	0		0	CTGATCCTGGCTGATTTAGGGAGCAGCTGCCCCAAGCTCAAGCTGCTCTACATCACTCCA	3455	0	UF_Msa_AF_103190	contig03342___1rc_nrnt0	contig03342___1rc_nrnt0	Unknown	
3496	43	52	unmapped	0		0	GAGATTTGATCTCATTTACAACCCCACCCCAAACTTTCATTTTTCACACAACCACTCCAA	3457	0	UF_Msa_CF_117847	contig14375___0rc	contig14375___0rc	Unknown	
3497	43	53	unmapped	0		0	AATCTTGGCCCATGGAGGAGTTCGTTTCATGTGGATCAAACACAATAACCTCTACTTGGT	3459	0	UF_Msa_AF_106062	contig26415___1rc_nrnt	contig26415___1rc_nrnt	Unknown	
3498	43	54	unmapped	0		0	TCACACTGCTATTTATTTAAGAAAACATGAGCAATAAACAAGATCATTGGTCCTAACACA	3461	0	UF_Msa_AF_102961	contig25645___1_nr0nt	contig25645___1_nr0nt	Unknown	
3499	43	55	unmapped	0		0	TCCAGTACGATGACTATAGACTCGGTTCTCGATGAAGCAAATTTGTTTTGGAGCAAAAAA	3463	0	UF_Msa_CF_120417	contig00486___0rc	contig00486___0rc	Unknown	
3500	43	56	unmapped	0		0	TTCCTGCAAAGTACAACCACTTCCTGATGGCAATTGAGTCTCTCAGAGTAACTCACACAC	3465	0	UF_Msa_CF_122227	contig02921___0rc	contig02921___0rc	Unknown	
3501	43	57	unmapped	0		0	ACAAATATGAAGTGGACGACATTGATGAAGAAGGCAAAGAGAGACACACTCTGAGCAGGC	3467	0	UF_Msa_AF_101417	contig32768___1rc_nrnt	contig32768___1rc_nrnt	Unknown	
3502	43	58		1028	E1A	0		853	1	(+)E1A_r60_a97	E1A_r60_a97	E1A_r60_a97		CONTROL
3503	43	59	unmapped	0		0	ACATCCGACCTCAAGTTTGACAGCCAGGAGGACCTCTGGAGCAAGTTGATCTTGGCCTGC	3470	0	UF_Msa_AF_107261	contig18406___1rc_nrnt0	contig18406___1rc_nrnt0	Unknown	
3504	43	60	unmapped	0		0	TGCAGAACATTTGAGTAGGAAACAAGAAAAAGAGGACACCAGAGCGGCTAACGTGGCATT	3472	0	UF_Msa_AF_108634	contig07513___1_nrnt0	contig07513___1_nrnt0	Unknown	
3505	43	61	unmapped	0		0	TAATCTCATTGGTTGGTTTAATCTACAAGGGGTGGAGACAAAGAACCTGCTGAGACACTA	3474	0	UF_Msa_CF_123924	contig08496___0	contig08496___0	Unknown	
3506	43	62	unmapped	0		0	TTCAGTGGCATCTGCTTGACAGTGGTCAAAAAGTCGATGTTGAAGATGAGTTCAACGCTG	3476	0	UF_Msa_AF_109862	contig31163___1_nrnt	contig31163___1_nrnt	Unknown	
3507	43	63	unmapped	0		0	GAAATGTTAAGACTGTGCGGGTCGCAAACGCAAGTTTTATTTATAGTAAGATGCTTTTTT	3478	0	UF_Msa_AF_103181	contig29278___1_nr0nt1	contig29278___1_nr0nt1	Unknown	
3508	43	64	unmapped	0		0	GTTTTTGTTTGTTTTAAAGCCAGAATGGGTATAGTATGGGTGCTTACAAATGTGCTTTTG	3480	0	UF_Msa_AF_104602	contig23750___1rc_nr0nt	contig23750___1rc_nr0nt	Unknown	
3509	43	65	unmapped	0		0	TGGAAATACTCCAGGGAAAAGTGGGACATCCTCAATGCACGTTATGGTGAAGCGTTGTTC	3482	0	UF_Msa_AF_106070	contig20937___1_nr1nt0	contig20937___1_nr1nt0	Unknown	
3510	43	66	unmapped	0		0	TGTGGGCAGCTTCGACGAGGACTCCAAGTCTGAGTTCATCATGGACCCCCGAAACCCAAA	3484	0	UF_Msa_CF_123807	contig14251___0rc	contig14251___0rc	Unknown	
3511	43	67	unmapped	0		0	TTTGTGGACACACATGACTTGCGGTTTCCCTGGGTGGCGTTCTTTGCCAGCAAGCGGATC	3486	0	UF_Msa_AF_108453	contig14158___1_nrnt	contig14158___1_nrnt	Unknown	
3512	43	68	unmapped	0		0	AAACTGGTGAGCCACTACACAACAACAACAATCCGACTGGAAATGAGCCTCGTGCCTGCG	3488	0	UF_Msa_CF_122149	contig13057___0	contig13057___0	Unknown	
3513	43	69	unmapped	0		0	CCACCGCCGCGCAGGATCCAAAAACATCCTGGAAATCCACGGAAGTCTGTTTAAAACACG	3490	0	UF_Msa_AF_102234	contig19405___1_nr1nt0	contig19405___1_nr1nt0	Unknown	
3514	43	70	unmapped	0		0	TTTCTCAAGAATGGCATTACGGAGGAGAACCTGTACAAGTTGATCCAGCATGCTCAGATC	3492	0	UF_Msa_AF_101579	LMB_S454.sd.451.C1___1_nrnt	LMB_S454.sd.451.C1___1_nrnt	Unknown	
3515	43	71	unmapped	0		0	TGGACAACAAAGCTCTGCAGCTTCAGAGCCTTGACACAGAGAAGAGAAAAGCAGCAGTTA	3494	0	UF_Msa_CF_124406	contig24617___0	contig24617___0	Unknown	
3516	43	72	unmapped	0		0	TGACAACAATGGGCGGCTGACTTTGTCTACATCTCATTAAAGGAAATTCATGGGGAAAGT	3496	0	UF_Msa_CF_121493	contig09478___0rc	contig09478___0rc	Unknown	
3517	43	73	unmapped	0		0	GAGATGATTCCTTCAACACCTTCTTCAGTGAGACTGGAGCTGGAAAGCACGTCCCCAGAG	3498	0	UF_Msa_AF_102899	contig29436___1_nrnt	contig29436___1_nrnt	Unknown	
3518	43	74	unmapped	0		0	AAGGAAAATGCAATGTCATAGTCGGAAGGAGATTCAATGAGGAAAAGCACCCGGAGTTGG	3500	0	UF_Msa_AF_103638	contig17386___1_nr1nt0	contig17386___1_nr1nt0	Unknown	
3519	43	75	unmapped	0		0	TCTACAAGAAAGCAGGCCTGGGGAAGGAGAAGAGAGAAGTAACATACCTTGTGACCAAAA	3501	0	UF_Msa_AF_106620	contig06468___1_nrnt0	contig06468___1_nrnt0	Unknown	
3520	43	76	unmapped	0		0	GCTGCATTCATTTATATTGTGTACATACTCTATTGACGGCAACAAGATCTACATGTTAAG	3503	0	UF_Msa_AF_108906	contig25414___1_nr0nt1	contig25414___1_nr0nt1	Unknown	
3521	43	77	unmapped	0		0	ATCAAACTACTGAGAAAATACAGTTTTGATGGACTAGACCTAGATTGGGAATACCCCGCT	3505	0	UF_Msa_AF_102920	contig05315___1_nrnt	contig05315___1_nrnt	Unknown	
3522	43	78	unmapped	0		0	TGTTATTTAAATTCTAATATATGAATCATATTTGGATTGAAGTCATAGTTACAGGGGCCA	3507	0	UF_Msa_AF_102988	contig12827___1rc_nr0nt1	contig12827___1rc_nr0nt1	Unknown	
3523	43	79	unmapped	0		0	TGTACTCAGACATCACAGCCTCCACCTGCAGCCATATTACAGTGATAATTTTGTACTTAA	3509	0	UF_Msa_CF_122766	contig28358___0	contig28358___0	Unknown	
3524	43	80	unmapped	0		0	TCAGAGCACAGAACAGAAACTGTTGATAAATTTTGATTTCCTACTTTCCACTCTGTTCCC	3511	0	UF_Msa_AF_100493	LMB_S454.233.C1___1_nrnt	LMB_S454.233.C1___1_nrnt	Unknown	
3525	43	81	unmapped	0		0	ATCCTGGTGTACTTCCCCACAGAGTCACTGAAGGGTTTCCAGCCACCTGAGGAATGGACC	3513	0	UF_Msa_AF_110101	contig25044___1rc_nrnt0	contig25044___1rc_nrnt0	Unknown	
3526	43	82	unmapped	0		0	AGGTCGTAATGATCCTAAGAAACCCCTTCCATCTCCTGTGGGCATGACCCAGACATGTTG	3515	0	UF_Msa_CF_126591	contig17576___0	contig17576___0	Unknown	
3527	44	1	unmapped	0		0	TTTCTGTACAGATAGCTGCAACACACAGTATAGCTTATTGCCAATGCCCTTAAAGAATTT	3357	0	UF_Msa_AF_109299	contig10256___1_nr0nt	contig10256___1_nr0nt	Unknown	
3528	44	2	unmapped	0		0	TAGACAGCAGCGGCTCGCCAAAGAAGTGGACGTTATCTCGGGGAATGAGCGAGGATGAGT	3359	0	UF_Msa_CF_121430	contig01040___0	contig01040___0	Unknown	
3529	44	3	unmapped	0		0	AGCTGAATGTGAGCAGTTCCCAGAATTTCACTGTCCCCTGTCATATTGCCAAACAATCCA	3361	0	UF_Msa_AF_105637	contig27470___1rc_nrnt-1	contig27470___1rc_nrnt-1	Unknown	
3530	44	4	unmapped	0		0	TCTGCTGTTAACGATAGCTGGCCACCCTTCTGAAGCAAATCCCCACACCTCGTCGACGGA	3363	0	UF_Msa_CF_121938	contig25161___0rc	contig25161___0rc	Unknown	
3531	44	5	unmapped	0		0	AGTGCGTGCTGCCAACAACATGGTGGAAGTGTTTGTGGATGGGAAACCATTGGAGGTGGA	3365	0	UF_Msa_AF_104247	contig22255___1rc_nrnt0	contig22255___1rc_nrnt0	Unknown	
3532	44	6	unmapped	0		0	AGATGGCGGCCGCGGTGAGAACCATCGGCTCCTCTTTGGGCAAAAACCTCCGAGAGATCC	3367	0	UF_Msa_CF_127308	contig32865___0	contig32865___0	Unknown	
3533	44	7	unmapped	0		0	AAACCTGCAACTGAATTTATGTACAGATTTTGCACTGGTTGTCCCCCATGTCATGTTTTT	3369	0	UF_Msa_AF_107531	contig31919___1_nrnt	contig31919___1_nrnt	Unknown	
3534	44	8	unmapped	0		0	AAAGGATTGAAAAGGAAAAGAATTAAGGATGAGCCTGTGGACGGCCCTTCAACATCCAGC	3371	0	UF_Msa_CF_124062	contig26593___0rc	contig26593___0rc	Unknown	
3535	44	9	unmapped	0		0	CGTATCCATCTGCAGTTGAATTCTCTTGTGAGGCATCAGAAGATAACATATTGCCTTGTT	3373	0	UF_Msa_AF_102430	contig28629___1_nrnt	contig28629___1_nrnt	Unknown	
3536	44	10	unmapped	0		0	TGAGTCAATGGACTCTTCATCGACCAATGAAACCGGCCTCACCTGCCCGAGACCCCGCCC	3375	0	UF_Msa_AF_106578	contig16382___1_nr0nt1	contig16382___1_nr0nt1	Unknown	
3537	44	11	unmapped	0		0	TCAAAAGGGAAGCCTCTCTGATCTTCGGCGACATTTGAAGTACAATTTGGAAGTTAAATC	3377	0	UF_Msa_CF_119829	contig24119___0	contig24119___0	Unknown	
3538	44	12	unmapped	0		0	TGAACAGGAAGGTCACAAGCGAGGGATACTGAGAGAAAAGATATGCATGACCTCCTCACC	3379	0	UF_Msa_CF_119084	contig18638___0rc	contig18638___0rc	Unknown	
3539	44	13	unmapped	0		0	TGAAAACTGTGTACCAAATGCACCTTGGGTATAAAGTAACCACCCAGTGTCGTGTCCTTG	3381	0	UF_Msa_AF_110024	contig00386___1_nr0nt	contig00386___1_nr0nt	Unknown	
3540	44	14	unmapped	0		0	CCTTCATGTTGCCCTCCAGGTGGACGTTGTGACCCAGGTACAGTAGATGTTGCATCTGTA	3383	0	UF_Msa_CF_117698	contig25689___0	contig25689___0	Unknown	
3541	44	15	unmapped	0		0	CAGCAATGGTATGTGGCGCATCGAGAGTTGACAACAGAGCTAAGGCGACCAGAGAATGAA	3385	0	UF_Msa_AF_106141	contig13146___1_nrnt0	contig13146___1_nrnt0	Unknown	
3542	44	16	unmapped	0		0	GACGCGGACACTTCCTGATTTACCTGTTCAGGTCAACAACAACAGTTTGTATCGGACTAA	3387	0	UF_Msa_CF_118129	contig05305___0	contig05305___0	Unknown	
3543	44	17	unmapped	0		0	CAGGATTATTTTTCTACTCCAGAACTCGAGAGAAACTGACCCAGTCACAACTTTTGAAGG	3389	0	UF_Msa_CF_125353	contig21904___0	contig21904___0	Unknown	
3544	44	18	unmapped	0		0	GCAAAAAACACAAAGAGAAGAAGAAGCTGGGCCTCAGATAGTTTATGCAAGTGGACAGAT	3391	0	UF_Msa_AF_105430	contig31350___1_nrnt	contig31350___1_nrnt	Unknown	
3545	44	19	unmapped	0		0	TGTAGAGATGAGGAAAGAGGCCCGAGTCAGCAAAGACACCACCTTCACCTCTGCCCGTAC	3393	0	UF_Msa_AF_102028	contig29088___1_nrnt	contig29088___1_nrnt	Unknown	
3546	44	20	unmapped	0		0	ACCTGGAGGTATGGGTCTCTGTGGTTGAGCTGGAGGTTCAGGATCCCCAAATATTCCGCT	3395	0	UF_Msa_AF_108252	contig09466___1_nr0nt	contig09466___1_nr0nt	Unknown	
3547	44	21	unmapped	0		0	TATTGTGTGGAGCGGTGACTGCGGCTGTGTGACCCCTCTGCCTCTAATTACAGACCGGAT	3397	0	UF_Msa_CF_119092	contig25481___0rc	contig25481___0rc	Unknown	
3548	44	22	unmapped	0		0	TGCTCAGATCCGTTCGGCCAATGGGAAGCTCCAAGAGGCTGAGAATCCTGTGCAGTTCTT	3399	0	UF_Msa_AF_102339	contig05775___1rc_nrnt0	contig05775___1rc_nrnt0	Unknown	
3549	44	23	unmapped	0		0	TTCCCTAGCTGAACCGATCAGCTATCGCAATCAATTGATGTCTTCAGATGAGATTTAAGG	3401	0	UF_Msa_CF_118074	contig30129___0	contig30129___0	Unknown	
3550	44	24	unmapped	0		0	TGACGACGACGACGAAGATGGAGACCTTTCAAAGTACGACCTGGACGCCAGTGGTGGTGA	3403	0	UF_Msa_AF_102810	contig29971___1rc_nr0nt1	contig29971___1rc_nr0nt1	Unknown	
3551	44	25	unmapped	0		0	TGCCACAAATTTAATTGGAAAGAAAGCTGCTGGTAACTAAATAAAAAATAGGGAAACTGC	3405	0	UF_Msa_AF_109482	contig05729___1rc_nr0nt	contig05729___1rc_nr0nt	Unknown	
3552	44	26	unmapped	0		0	GATCGTAAAAATTGACCTGTAATGGGCGTTGCTATAGTGACATGCAATATGTGTATTTAA	3407	0	UF_Msa_AF_102018	contig09198___1rc_nr0nt	contig09198___1rc_nr0nt	Unknown	
3553	44	27		0		0		3409	1	RC9	RC9	RC9		CONTROL
3554	44	28	unmapped	0		0	TCGACAGCTTTAAGAGATGTGGTGACCCAGCTGTCCGTCATCCTTAACGTCCCTCCCCCT	3411	0	UF_Msa_CF_125844	contig13497___0rc	contig13497___0rc	Unknown	
3555	44	29	unmapped	0		0	ACAAGCCAAATACAGAAGGCACATGATCTGAGGGGGAGACCAGAGGACAAATGATCAAAT	3413	0	UF_Msa_CF_121233	contig00495___0	contig00495___0	Unknown	
3556	44	30	unmapped	0		0	TCGGCCAAGAGCATCATGGGAAATTTTTTGGCTCTTTGTATGGCACGGACAAAAAACATC	3415	0	UF_Msa_CF_118392	contig13259___0	contig13259___0	Unknown	
3557	44	31	unmapped	0		0	AATTTTATCTCAAGGATCTGAAGACATCTCGGGGTCTCCATGACGAGATGAAGAAGGCAG	3417	0	UF_Msa_AF_105938	contig08178___1_nrnt	contig08178___1_nrnt	Unknown	
3558	44	32	unmapped	0		0	GTATGTCATTGTTTATTTATACTTTGTTACAGACAGTATAGTGATGGTCCGAGAGACAAC	3419	0	UF_Msa_CF_118853	contig12141___0rc	contig12141___0rc	Unknown	
3559	44	33	unmapped	0		0	CGACCACTTACAAGGTCGCAGAGTGTACAAAATTTACAAATCTTCCAGAATGCAGCAGCA	3421	0	UF_Msa_AF_104381	contig29194___1rc_nrnt-1	contig29194___1rc_nrnt-1	Unknown	
3560	44	34	unmapped	0		0	CAGGAACAAACATCTTCATGGGTGTTGTGCAGATTTAAAACTATAAATGCAAAAGGGTTA	3423	0	UF_Msa_AF_106338	contig19536___1_nr0nt	contig19536___1_nr0nt	Unknown	
3561	44	35	unmapped	0		0	ACGATGCCTTAGAGGAGCTGGATGAGTATGCTTGTCTCTGGAATGGATGTGAATTTCTAT	3425	0	UF_Msa_AF_105162	contig12230___1rc_nrnt0	contig12230___1rc_nrnt0	Unknown	
3562	44	36	unmapped	0		0	TTACCAGCGGGCCTACTCTGAAGCCTTGACGGCTTTTGGGAACGGAGCCCTGTTTGTTGA	3427	0	UF_Msa_AF_101605	contig12109___1rc_nrnt	contig12109___1rc_nrnt	Unknown	
3563	44	37	unmapped	0		0	CTGCAAATACAAATATTTATTCAACTTCCGAGGCGTGGCAGCCAGCTTCCGTTTCAAACC	3429	0	UF_Msa_AF_105732	contig26875___1rc_nrnt	contig26875___1rc_nrnt	Unknown	
3564	44	38	unmapped	0		0	TGTCAAAATAGCGATGAAAGCCTGCATGGACTGGGCGATCTCCGATGACATTTGAAAAGT	3431	0	UF_Msa_AF_108709	contig06204___1_nr0nt	contig06204___1_nr0nt	Unknown	
3565	44	39	unmapped	0		0	CATAGCTCCAGTGTATGGCTGGCTCACGGCCATTTGGGGCTTTGCAGGCTTTGGCATTGG	3433	0	UF_Msa_CF_118837	contig08248___0rc	contig08248___0rc	Unknown	
3566	44	40	unmapped	0		0	CCCCACCGTGAGCAAGTAGTTTATACTGTAGAAAATGGAAGAAACAAACAGACAGAACTG	3435	0	UF_Msa_CF_122884	contig00513___0rc	contig00513___0rc	Unknown	
3567	44	41	unmapped	0		0	ACTCATTCAGTCACTCACTGGTGGAAGACAATCTGGTCAGGGAAAACAAGATCGCAAGAT	3437	0	UF_Msa_CF_125717	contig32842___0rc	contig32842___0rc	Unknown	
3568	44	42	unmapped	0		0	CTATAGATGGAAGCCACTGGCTTAACATGAAAATTACTGGTGGAGCTGCTTCATTCTCGG	3439	0	UF_Msa_AF_101497	contig21845___1rc_nrnt-1	contig21845___1rc_nrnt-1	Unknown	
3569	44	43	unmapped	0		0	AGGAGGCATTGCAGTCCAGGGAAGCAAGTACGCAGCGGACAGGAATCGCTATAGGCGCTA	3441	0	UF_Msa_AF_101547	contig01527___1_nrnt	contig01527___1_nrnt	Unknown	
3570	44	44		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
3571	44	45	unmapped	0		0	AACATAAGGCACTTTGGACACACAGTCTGCATAAATCGCCTCAACCTCAAGAATAAAACA	3444	0	UF_Msa_CF_126555	contig15360___0rc	contig15360___0rc	Unknown	
3572	44	46	unmapped	0		0	ACTGCTATTAGCCTAGTAACACAGACCTTAAGCTTTGTTGTGAGCTTGTGCCGTACACTG	3446	0	UF_Msa_CF_120754	contig16438___0	contig16438___0	Unknown	
3573	44	47	unmapped	0		0	ATTTTTTGCCAGTAGTGTGCTTGCTTTTACTGTACTAAGGTGCAAGTAAAATGCACAAAC	3448	0	UF_Msa_AF_100114	contig31235___1rc_nrnt	contig31235___1rc_nrnt	Unknown	
3574	44	48	unmapped	0		0	CAAAGAGCATCCAGAAATGGCAGCGCTGCTGTTCACCTCCAGCGTGTGCGTTGGTCTTCT	3450	0	UF_Msa_AF_109418	contig25186___1_nrnt0	contig25186___1_nrnt0	Unknown	
3575	44	49	unmapped	0		0	ATTGTGTTAAATTCTACAACTTCTGCCTTTAAGTCACTTTTTGTACCCAAACGTTGACCC	3452	0	UF_Msa_AF_103561	contig17513___1rc_nr0nt1	contig17513___1rc_nr0nt1	Unknown	
3576	44	50	unmapped	0		0	TTAAGAATGGACCAATGGATGCGATGTGAAAACACAACCCACTCAGCACCAAACAGCAGA	3454	0	UF_Msa_CF_127224	contig21930___0	contig21930___0	Unknown	
3577	44	51	unmapped	0		0	GTCCTGACTGAAACTTAGTCGAGTGGGAATTATATATATGAGAGCAAATATGAGTTTGAT	3456	0	UF_Msa_AD_200044	LMB_Add_147	LMB_Add_147	Unknown	
3578	44	52	unmapped	0		0	TCTCCAGCTGTCCTTGTATAATCCATAGTGAACAATGGCAATAAAGTCTTGTTGTTTTTT	3458	0	UF_Msa_AD_200071	LMB_Add_137	LMB_Add_137	Unknown	
3579	44	53	unmapped	0		0	TCCTTGATATGGAAGTATTACTCTGATCCAGTGACAGTGGTCCCCAGTAAATGGATAGCC	3460	0	UF_Msa_AF_102535	LMB_S454.1089.C1___1_nrnt	LMB_S454.1089.C1___1_nrnt	Unknown	
3580	44	54	unmapped	0		0	TGCTGCTGCACCCGTGGAGGAAGTAGAGGTGCCGGAGTCGAAGCCTGCTGGTGTATATCG	3462	0	UF_Msa_AF_100175	contig17382___1_nr0nt	contig17382___1_nr0nt	Unknown	
3581	44	55	unmapped	0		0	CTGGAGTGGTGAAAGGCATGGATGCCACTCTGAAGAGTATGAATCTGGAAAAGATTTCAG	3464	0	UF_Msa_AF_108605	contig05794___1rc_nrnt	contig05794___1rc_nrnt	Unknown	
3582	44	56	unmapped	0		0	ACATTGAGATGCTCAAAGAGCAAGGTCTGAAGGGTCAGGAAATAATTCAGCAGCTTATAG	3466	0	UF_Msa_CF_127803	contig16786___0	contig16786___0	Unknown	
3583	44	57	unmapped	0		0	TGCAACAGCTGACTGCCGAGCACTTTACCCAGTGCCTCAAGGAACAAAGAGAGGAGGACA	3468	0	UF_Msa_CF_126466	contig10991___0	contig10991___0	Unknown	
3584	44	58	unmapped	0		0	GTGGGCAGCAAAGGGAGAGCTAGTAGAGGATGGAGTGCCTATACAGAGGGCCTATAACAC	3469	0	UF_Msa_CF_124727	contig02339___0rc	contig02339___0rc	Unknown	
3585	44	59	unmapped	0		0	CAAGGATTTATTGAACAAATCAACATGAACAAAGATTTACAACCTGGTGATGAGGTAGCC	3471	0	UF_Msa_CF_125786	contig00139___0rc	contig00139___0rc	Unknown	
3586	44	60	unmapped	0		0	TCGTCGTCGTCGCCAGGTGACGTGAACGAGTTCCTCGTAAGAGGCGCTTTTATTAATTAT	3473	0	UF_Msa_CF_121308	contig06087___0	contig06087___0	Unknown	
3587	44	61	unmapped	0		0	ACAGGTTGCAGGTGAGGCGGAATCAAAGTGGGATGCAGCCATCATTAAGGCAACACAAAC	3475	0	UF_Msa_CF_119957	contig01713___0rc	contig01713___0rc	Unknown	
3588	44	62	unmapped	0		0	AGACCAGGAAGGAAATCTAACAGGGCTGCCATTACTGCTTGACAAGTACACCCCTGTCAT	3477	0	UF_Msa_AF_103402	contig05467___1_nrnt0	contig05467___1_nrnt0	Unknown	
3589	44	63	unmapped	0		0	TTTCCCAGATGTGATTAGTAATAAAGGGAACGAATCACAGGCACCGACCACATGTTTCCC	3479	0	UF_Msa_CF_121880	contig28493___0	contig28493___0	Unknown	
3590	44	64	unmapped	0		0	TGGCAGTAGCTCTGGGAGGCCTCAGCCTGTGGCACCTCATACTCATCAGCAGAGGAGAGA	3481	0	UF_Msa_AF_102282	contig22440___1_nrnt0	contig22440___1_nrnt0	Unknown	
3591	44	65	unmapped	0		0	GCAGAGCTTTCAAGAAAACATGGCTTCCCCTGTTGGTTGTGAGCATTATGTGCGCAGGTG	3483	0	UF_Msa_CF_124308	contig03089___0	contig03089___0	Unknown	
3592	44	66	unmapped	0		0	GAACGAGGACAGCAAGGCAATGCATGCCAATGCACCAATTACATAACAGAACAATAATAA	3485	0	UF_Msa_CF_124106	contig15619___0rc	contig15619___0rc	Unknown	
3593	44	67	unmapped	0		0	GCCGTGCATTGGGGCCATAGCCTGTTGGTTTACTGAAATAAAAGCCTCTCTCTCCACACA	3487	0	UF_Msa_AD_200133	LMB_Add_11_rc	LMB_Add_11_rc	Unknown	
3594	44	68	unmapped	0		0	ACTATTGACCAGTTTGAATACGACGGCTGTGACAACTGTGAGTCCTACCTTCAGATGAAG	3489	0	UF_Msa_AF_102375	contig31652___1rc_nrnt	contig31652___1rc_nrnt	Unknown	
3595	44	69	unmapped	0		0	GCGCACATTTGTACATTTTCATTGTGCATGTGTGTTAAGCTTTTGTAATTTGAATGCAAG	3491	0	UF_Msa_AF_100310	contig29763___1rc_nrnt-1	contig29763___1rc_nrnt-1	Unknown	
3596	44	70	unmapped	0		0	GCTGGGCTACAGAAGTGGAAACCCCTAACACAGTCACCAGAACCACAAAGAAAGGTGGTG	3493	0	UF_Msa_AF_106702	contig06005___1rc_nrnt-1	contig06005___1rc_nrnt-1	Unknown	
3597	44	71	unmapped	0		0	CCCCCCTCACTTTAGCAGCTGGACGATGACAGCGTTGAGGAGATTGGCCTGCTGCAGCGT	3495	0	UF_Msa_AF_102477	contig08024___1_nr0nt1	contig08024___1_nr0nt1	Unknown	
3598	44	72	unmapped	0		0	ACAGGATGGTTTGTACTGAAGACAGTGCCTAACTACCAGAGGATAGTAGTGTTTCGACTG	3497	0	UF_Msa_AF_105027	contig28400___1_nrnt	contig28400___1_nrnt	Unknown	
3599	44	73	unmapped	0		0	GGTACAGGAGGTCACTGCATCTCTGTGCTGAAGTGCTTCACCTAGGGGATGTACAATATG	3499	0	UF_Msa_CF_120950	contig00859___0rc	contig00859___0rc	Unknown	
3600	44	74		0		0		3409	1	RC9	RC9	RC9		CONTROL
3601	44	75	unmapped	0		0	TGTGACACTACAGCTTGACCTTGATTGGATACACTCGTTATATAGTGGACTTTTTGTTTG	3502	0	UF_Msa_AF_104372	contig29403___1_nrnt	contig29403___1_nrnt	Unknown	
3602	44	76	unmapped	0		0	TTTGAGAGAGTCAACATTCAGGGCACACGCACCGTTATTCAGGCCTGCATCGAGGCTGGA	3504	0	UF_Msa_AF_103623	contig21996___1rc_nrnt-1	contig21996___1rc_nrnt-1	Unknown	
3603	44	77	unmapped	0		0	ACGGGATTGATCATATGGAGATGGGGGAGAGTAAAGGTGGCTCAGGTCTCCGGCAGTACT	3506	0	UF_Msa_CF_126340	contig17265___0	contig17265___0	Unknown	
3604	44	78	unmapped	0		0	TACAGTTGGCAGAAGGGAGGCAAGGTGTTGACCAATAGACTCACGTCTGCTACTTTCACA	3508	0	UF_Msa_AF_103712	contig04944___1_nrnt0	contig04944___1_nrnt0	Unknown	
3605	44	79	unmapped	0		0	GATTTCCATTCCAGAGGTGCAGACAGACAAACGTTGCAGAAGAATTGTTGGAGATGCTAG	3510	0	UF_Msa_CF_123205	contig16564___0	contig16564___0	Unknown	
3606	44	80	unmapped	0		0	TTCCCATGCTTGTGACCAAATCTTTATCACCATGCATGCACTTTGAACAGTTTGATGGCA	3512	0	UF_Msa_CF_126200	contig20687___0	contig20687___0	Unknown	
3607	44	81	unmapped	0		0	CAATGTACCAATATTTCTATTTCTAGGGGATCCCAGGTTTTTGGGGGAGGGCATATATAG	3514	0	UF_Msa_AF_100707	contig15903___1_nr0nt	contig15903___1_nr0nt	Unknown	
3608	44	82	unmapped	0		0	AAATTACCTCACATATGCTGGAGGTTGTCCAAGCACACATGATGCTCAGCAAACCACAGT	3516	0	UF_Msa_AF_106327	contig21908___1_nrnt	contig21908___1_nrnt	Unknown	
3609	45	1	unmapped	0		0	TATCCTGATGTGTTAGCAAAGCTAGTGAATAGACTGAGAGACAGCAGGGCACACATGATG	3517	0	UF_Msa_CF_124410	contig29771___0	contig29771___0	Unknown	
3610	45	2	unmapped	0		0	TCTTAACTCTGAGCTGGGCACCACTGCTTGCTTCATGCTGCCAAGAAGAGAAGTAATAAT	3519	0	UF_Msa_AF_106325	contig29867___1_nrnt	contig29867___1_nrnt	Unknown	
3611	45	3	unmapped	0		0	CCTTGCCCATGAATTCTATGAAGAGACGGTTGTGACCAAAAATGGCAGAAAAAAGTCCAA	3521	0	UF_Msa_AF_104809	contig16579___1rc_nrnt	contig16579___1rc_nrnt	Unknown	
3612	45	4		0		0		2362	1	RC10	RC10	RC10		CONTROL
3613	45	5	unmapped	0		0	CTGGCTATTGTAATGTTTGCAGGCAGTGGGATCAGTTCTCAGTTGCACATGAAGTATCTC	3524	0	UF_Msa_CF_119219	LMB_S454.149.C1___0	LMB_S454.149.C1___0	Unknown	
3614	45	6	unmapped	0		0	ACATGGCCTGGATATCAGATGCGCTGACTCCCTCCTGGCTCTCTGGTCATCTGTCGTACA	3526	0	UF_Msa_AF_105255	contig10161___1_nrnt0	contig10161___1_nrnt0	Unknown	
3615	45	7	unmapped	0		0	AAATGAAGGATACAGAGTGGTGATCAACGATGGAAAGCACGGCTCTCAGTCAGTTTACCA	3528	0	UF_Msa_AF_100106	contig14253___1_nrnt0	contig14253___1_nrnt0	Unknown	
3616	45	8	unmapped	0		0	ACGGCCACGCCCATGTTGAATATGAATGGTGTCTGCAGCATGAAGACTTGGATGAAAGTG	3530	0	UF_Msa_AF_107552	contig06264___1_nrnt0	contig06264___1_nrnt0	Unknown	
3617	45	9	unmapped	0		0	ATAAAACTTGTGCGCATGTTTACTGTGAATGTTTCGTCGTGTTCACCACCCAGGTAGCAG	3532	0	UF_Msa_CF_127181	contig30656___0rc	contig30656___0rc	Unknown	
3618	45	10	unmapped	0		0	CTGTCACTTTGAGTGGTTTATCAACCAGAAGATTGTAGAAGTCTTCATCAACTTCGTCAT	3534	0	UF_Msa_CF_123636	contig19689___0rc	contig19689___0rc	Unknown	
3619	45	11	unmapped	0		0	ACTGGCAGAAAGCTGTGCAGAAAGTGAAGTGAAACAGGAAGAATTGATGCAGTGTCTCCT	3536	0	UF_Msa_AF_100199	contig01566___1_nr1nt0	contig01566___1_nr1nt0	Unknown	
3620	45	12		0		0		1978	1	ETG02_36680	ETG02_36680	ETG02_36680		CONTROL
3621	45	13	unmapped	0		0	TAAATGTATATAGTAAAGAACGCAATGGCGGCGTGGAGCTGTCGGTTTCTTCTTCAGACG	3539	0	UF_Msa_CF_122707	contig07369___0	contig07369___0	Unknown	
3622	45	14	unmapped	0		0	CTCTCCGTGTGCTTCGTGTGGCGGCTGCTGTGCGGGTTCAGGGTGTGGGTGCTGGGAAAC	3541	0	UF_Msa_AF_107768	contig14948___1_nrnt0	contig14948___1_nrnt0	Unknown	
3623	45	15	unmapped	0		0	TAGGAGAGAGTTACAACAGCAGAGCCAGAAAACACATAGCATTTCATATAGCAATGGATA	3543	0	UF_Msa_CF_123363	contig17311___0	contig17311___0	Unknown	
3624	45	16	unmapped	0		0	CAAATATAGACCATCCTCCCGCCGACACAAACACAGATATATACTCAAACATATACGTAT	3545	0	UF_Msa_CF_127770	contig02292___0rc	contig02292___0rc	Unknown	
3625	45	17	unmapped	0		0	CAGAGTGACTGAAAGAGGATGGGATAATAGACAACAACTTAGAGTGTAGGCAAGAGTGCA	3547	0	UF_Msa_CF_119920	contig02111___0rc	contig02111___0rc	Unknown	
3626	45	18	unmapped	0		0	TTTGGAGAAATGGAAAAAACGGGCTGTGAACCTCTTTCACGGATCCTGTTTGCACACTTC	3549	0	UF_Msa_CF_118476	contig19096___0rc	contig19096___0rc	Unknown	
3627	45	19	unmapped	0		0	CCACAACCACAAGTGATGCGAAGCACCAATGGTTTTCCAAATCTTTCCAAAAATATCCCA	3551	0	UF_Msa_CF_119209	contig12762___0	contig12762___0	Unknown	
3628	45	20	unmapped	0		0	CAGTCAAATAGGCAAATGACCCAACCACTCTGGCAGACAGGGAAGGAGGAACTCCGTGCC	3553	0	UF_Msa_CF_118800	contig24141___0rc	contig24141___0rc	Unknown	
3629	45	21	unmapped	0		0	GAAGAGGAAAGAGGAGAAAGCTCTGATCGCCGCTCAGCTGGACAACGCCATCGAGAAGGA	3554	0	UF_Msa_AF_104403	contig21799___1_nr0nt1	contig21799___1_nr0nt1	Unknown	
3630	45	22	unmapped	0		0	AAGTTGAGGATCTGTGCAGGCTAGACAAGATGATCGACCTGATCATTCCAAGGGGCTCGT	3556	0	UF_Msa_CF_118178	contig10033___0	contig10033___0	Unknown	
3631	45	23	unmapped	0		0	TTACACCCGGTTGAATGAGTACCTGGACGCCTTCTCCGGAACGCTTTCGATCTGTGGCTC	3558	0	UF_Msa_CF_126115	contig25039___0rc	contig25039___0rc	Unknown	
3632	45	24	unmapped	0		0	GACTCATCTTCTCCGGCTGTTGGACGCACCTGTCAGCGTCTGTCAAACTACAGTGTGAAC	3560	0	UF_Msa_AF_102576	contig00761___1_nr0nt1	contig00761___1_nr0nt1	Unknown	
3633	45	25	unmapped	0		0	ATTCGAAGTGGATCTGAAGACAAACTTGATGACAGAAAGGAGGAGCCTAAGCCAGAGGAA	3562	0	UF_Msa_AF_104750	contig29482___1_nr1nt0	contig29482___1_nr1nt0	Unknown	
3634	45	26	unmapped	0		0	TTCATCTTCCGCAGAGAAATAGTATGGGGATGTGTTGCCCTGCTTGTTATGGTTCCTATG	3564	0	UF_Msa_CF_120287	contig18808___0rc	contig18808___0rc	Unknown	
3635	45	27	unmapped	0		0	TATGACCGGCCGATCCAAGGCTGAATGTTCATTGATAACAGATGAATGTTAACTGATAAC	3566	0	UF_Msa_AF_106230	contig13667___1_nr0nt1	contig13667___1_nr0nt1	Unknown	
3636	45	28	unmapped	0		0	AAACAGGCCCTATGAAGCCTCAGCATGTCGCAGAGGTCCTGTGAGTCCCCACACATCCAT	3568	0	UF_Msa_AF_106138	contig11829___1rc_nrnt0	contig11829___1rc_nrnt0	Unknown	
3637	45	29	unmapped	0		0	TTAAAACATAAAAACCACAGTGCTGTGGATGTGTGCTGATATGCCCTGGGCGTGAACTCT	3570	0	UF_Msa_AD_200335	LMB_Add_68_rc	LMB_Add_68_rc	Unknown	
3638	45	30	unmapped	0		0	TTCCCAATAAACATGATCTGAATACTCCCTGCAAAATGAGAGGTACCCTGGCTCTCCACA	3572	0	UF_Msa_CF_125097	contig04202___0rc	contig04202___0rc	Unknown	
3639	45	31	unmapped	0		0	CTGCAAGAGTTACTGGTCAAGAAGAAGGCTGAGGAAGAGGAACAGCGAGCTCGTAAGCTG	3574	0	UF_Msa_CF_119613	contig01975___0rc	contig01975___0rc	Unknown	
3640	45	32	unmapped	0		0	AGTCAGCTGCTGAGAGGGGCAACCTGTTCTGGATCTGGATGGAGTTGCTCCACCAGTGAT	3576	0	UF_Msa_CF_121380	contig25342___0rc	contig25342___0rc	Unknown	
3641	45	33	unmapped	0		0	ATGGTTGGAAACTGCTGGACAATTCTGCACATAGCAATCTTTGTGACTGCTGCGAATCCA	3578	0	UF_Msa_AD_200053	LMB_Add_25_rc	LMB_Add_25_rc	Unknown	
3642	45	34	unmapped	0		0	AGGAGGAACATACCTTTTTGTAGCATTTGGACCAAACTCTCATGAAAAACTCCAAGCGGA	3580	0	UF_Msa_AF_103653	contig06594___1rc_nrnt0	contig06594___1rc_nrnt0	Unknown	
3643	45	35	unmapped	0		0	CTGCCCTCTTTGGGCCAAAAGGAGTGAACATTGGAGGAGCCGGCTCTTATGTGTACGATA	3582	0	UF_Msa_AF_102035	contig25569___1rc_nrnt	contig25569___1rc_nrnt	Unknown	
3644	45	36	unmapped	0		0	ATGGTGGAGGACTTTGTTGCTGTTGTAAAGGGTGGGAGCAGTGAATCTATCACTGCTTTA	3584	0	UF_Msa_AF_105698	contig17744___1rc_nrnt	contig17744___1rc_nrnt	Unknown	
3645	45	37	unmapped	0		0	ATCAATGTGAAACAACAGGACACTGCTTACAGTTTGATGGGTGAGGTACTACTGCCTATT	3586	0	UF_Msa_CF_120218	contig09495___0rc	contig09495___0rc	Unknown	
3646	45	38	unmapped	0		0	CCTAGGGCAATGGTTGGTTGATTTCGCATACCAATAATTACGGTTGCCAACCAAAGAGGT	3588	0	UF_Msa_AD_200356	LMB_Add_62_rc	LMB_Add_62_rc	Unknown	
3647	45	39	unmapped	0		0	AGGACAAAAACACTTTGGTCTGGCTCTTCAGACCGGGCCTACCTCTACTCCTTCATCTCC	3590	0	UF_Msa_AF_104505	contig23577___1rc_nr1nt0	contig23577___1rc_nr1nt0	Unknown	
3648	45	40	unmapped	0		0	GTTAGCCCCTGTGACACCAGACCTATGTTCAGATGTGAAAGATGAGATGGTCATTAAGAG	3592	0	UF_Msa_CF_118956	contig19639___0	contig19639___0	Unknown	
3649	45	41	unmapped	0		0	ACCCAGTAGAAACCGAACCAGTGCCACAGTAGAAAACCATACAGGATTCACTCAGTAAGT	3594	0	UF_Msa_CF_121249	contig28680___0	contig28680___0	Unknown	
3650	45	42	unmapped	0		0	GTGGAGGAAGCAGCTGAAAATCACTGATCGATAACGGATGAACGTTCAGTAACAGCAGGA	3595	0	UF_Msa_CF_118821	contig30610___0	contig30610___0	Unknown	
3651	45	43	unmapped	0		0	AAGAAGTTCCTGGTGCACAATATCAAGGAGCTCGAGGTCCTGATGATGAGTAACAAGACT	3597	0	UF_Msa_AF_107054	contig32127___1_nrnt	contig32127___1_nrnt	Unknown	
3652	45	44	unmapped	0		0	CTGCTATGATGTGGACTCTCAGACCTGGGAGGTGATCCATCCCAGCCTGGACAGTGAGAT	3599	0	UF_Msa_AF_102298	contig17393___1rc_nrnt	contig17393___1rc_nrnt	Unknown	
3653	45	45	unmapped	0		0	AATACAGAAGGAGTTAAATGACTTACAGAGGGACCCTCCAGCTTCATGTTTCAGCTGGAC	3601	0	UF_Msa_AF_108698	LMB_S454.375.C1___1_nrnt	LMB_S454.375.C1___1_nrnt	Unknown	
3654	45	46	unmapped	0		0	GATGTTGCCTCCTGTGGTTGGAGATATCTTCACCAGTGGTTTCTGGCTGGTTTGGGGTGG	3603	0	UF_Msa_CF_125751	contig21855___0	contig21855___0	Unknown	
3655	45	47	unmapped	0		0	ACTTTGTAAAATATTACTCTACGGACACTCCTGCCAGTTTTGAAACCACTTGATTTTTGA	3605	0	UF_Msa_CF_120497	contig01077___0	contig01077___0	Unknown	
3656	45	48	unmapped	0		0	AGGAGGCAGGCACAGACAACAGAAACATTGTAGATGATGGAAAATCACAGAAGCTGACCA	3607	0	UF_Msa_AF_107824	contig02288___1_nr1nt0	contig02288___1_nr1nt0	Unknown	
3657	45	49	unmapped	0		0	ATATTCAGATATGAAGAAAGCAAACCATGACAAGGCTGAAGGATGCGGCATGAATGGACA	3609	0	UF_Msa_CF_117823	contig27954___0	contig27954___0	Unknown	
3658	45	50	unmapped	0		0	ACACTTCAATGACATATCACGTGAGCCACATGGGTAGAAGAGCCAGTCTAATGCCAGATT	3611	0	UF_Msa_CF_123353	LMB_S454.sd.641.C1___0	LMB_S454.sd.641.C1___0	Unknown	
3659	45	51	unmapped	0		0	ATCGAGACACTAAAACAGGAGCTCACCACAGTCCCAAGGCGTAAAAGAAAGTCTTCAGAA	3613	0	UF_Msa_AF_101841	contig28505___1rc_nrnt	contig28505___1rc_nrnt	Unknown	
3660	45	52	unmapped	0		0	CGGCCTGAAGGAGCAGCTGGACAACTACCAGGCTCAGCTTGAGGCCCACACACTGGAGAT	3615	0	UF_Msa_CF_119508	contig10698___0	contig10698___0	Unknown	
3661	45	53	unmapped	0		0	ATCTATCATTAGTGCTCAAACAGAAGAAGGAGCCTCTGAACGCTCATCCCCAGAAACTGA	3617	0	UF_Msa_AF_107268	contig11043___1_nrnt	contig11043___1_nrnt	Unknown	
3662	45	54	unmapped	0		0	TTGGTTTCACTTCATTCAGGAAATTACTACAGAGAGAGAAACGGAGGGAGCGGCATGACA	3619	0	UF_Msa_CF_120251	contig09167___0rc	contig09167___0rc	Unknown	
3663	45	55	unmapped	0		0	ATCTGTAACCCCATGCAGTGTCCCTGGGGACAGAAAGCCTTCTCAGGATACCTGGGCTCT	3621	0	UF_Msa_AF_103555	contig31508___1rc_nrnt	contig31508___1rc_nrnt	Unknown	
3664	45	56	unmapped	0		0	CGCTCACACACACATGCTCTGTCACACACACGAGCCCTCGAGTTTCATCAACACCTACAG	3623	0	UF_Msa_AF_108769	contig17195___1_nrnt0	contig17195___1_nrnt0	Unknown	
3665	45	57	unmapped	0		0	AGCTCATCAGCAATATTCTCGAAGAGTCGGACATTGACAAGGATGGAACTGTGAACCTCT	3625	0	UF_Msa_AF_103225	contig18223___1_nrnt	contig18223___1_nrnt	Unknown	
3666	45	58	unmapped	0		0	AAATGTAGAGCCATGCTGTGATGCTCCTTCAGTACATAATAAAGATACAGATGTATTGTC	3627	0	UF_Msa_CF_122123	contig30651___0	contig30651___0	Unknown	
3667	45	59	unmapped	0		0	AGACGACTATAGCAGCATCATGATCAAAGCCCTGGCTGACCGACTGGCTGAGGCCTTTGC	3629	0	UF_Msa_AF_101932	contig21633___1rc_nrnt	contig21633___1rc_nrnt	Unknown	
3668	45	60	unmapped	0		0	TATTGATCCTTGTTGGACAAACACAGACCCACAATGTGGGAGTCTGCATCATGACAACAG	3631	0	UF_Msa_AF_108069	contig16613___1_nrnt0	contig16613___1_nrnt0	Unknown	
3669	45	61	unmapped	0		0	GGTGAGGCGCGTTCGTAATGAAAGGAGCGCGTGAGCAGCGCTTGCTGTGACTTCCTCGCT	3633	0	UF_Msa_AF_109524	contig26477___1_nr0nt1	contig26477___1_nr0nt1	Unknown	
3670	45	62	unmapped	0		0	GTGAAGGCAGGAGCTTCAGAGGTAGCCATATTTGGTAGTCTGCATCTGAGCTGTTCAGTA	3635	0	UF_Msa_AF_108495	contig03975___1rc_nrnt-1	contig03975___1rc_nrnt-1	Unknown	
3671	45	63	unmapped	0		0	TCCTTGTCTGAATGTGGAGGTCTAAATGTTGACGATCTGAAGCAGCGCACACTGAAATTC	3637	0	UF_Msa_AF_101425	contig00912___1rc_nrnt	contig00912___1rc_nrnt	Unknown	
3672	45	64	unmapped	0		0	GATCTTGTCGTCTGCATGTATTATTCTCCTAATCTTCTATCTTTAGTAGGAAGAAACTGT	3639	0	UF_Msa_AF_105714	contig16146___1_nr0nt	contig16146___1_nr0nt	Unknown	
3673	45	65	unmapped	0		0	AGACTCCAACATGGCAAGAGGACCGAAGAAGCACCTGAAGCGCGTCGCAGCGCCAAAGCA	3641	0	UF_Msa_AF_100442	contig08776___1_nr0nt1	contig08776___1_nr0nt1	Unknown	
3674	45	66	unmapped	0		0	AAGACGGATCACATCTCACCACAGCCGCCTGCCAACCCTTCAGGGTTACTTGGAGTATCT	3643	0	UF_Msa_CF_119578	contig21835___0rc	contig21835___0rc	Unknown	
3675	45	67	unmapped	0		0	GCTGAGTTTCCCTGACAGTCAGTCAGATTGTGATTTTAACCTTCGTTGAATATTATATTA	3645	0	UF_Msa_AF_101429	LMB_S454.sd.290.C1___1_nr0nt	LMB_S454.sd.290.C1___1_nr0nt	Unknown	
3676	45	68	unmapped	0		0	TGAACTTTCCCTTTGACATGTACCATCTGCGGTACCAGCAACCGGCCGAGGCCTTTCCTG	3647	0	UF_Msa_CF_126397	contig29077___0rc	contig29077___0rc	Unknown	
3677	45	69	unmapped	0		0	CGACGCGTCCGCCTTCGACCAGAGCAGCTTCCCGGTGCTGGTGGACGTGTCTTTCCGGAG	3649	0	UF_Msa_AF_108489	LMB_S454.857.C1___1_nr0nt	LMB_S454.857.C1___1_nr0nt	Unknown	
3678	45	70	unmapped	0		0	CCAGCGGAAGTGGCGGTGGTGGAGGAGAGTCTGAAGAAGATCTTCGGGATTTTGACGTGA	3650	0	UF_Msa_CF_123770	contig23123___0	contig23123___0	Unknown	
3679	45	71	unmapped	0		0	GTTGTCGCTGTTGCCTGGGAAGATCTTGTCTGTCTTTGTAGTCTCGTCCTTCACGATGGT	3652	0	UF_Msa_AF_103716	contig14629___1_nr0nt	contig14629___1_nr0nt	Unknown	
3680	45	72	unmapped	0		0	GGAGGCCAGCGTGGACTCGATGGGTCTGACGCTGCTCAGCACCGACCGGGCCACCGACAG	3654	0	UF_Msa_CF_126519	contig26406___0	contig26406___0	Unknown	
3681	45	73	unmapped	0		0	GTAACCAACACAGCCGATAATAATGCTTCACAAACCCAGCAAAACTTGATACGTACAGGG	3656	0	UF_Msa_CF_127383	contig00852___0	contig00852___0	Unknown	
3682	45	74	unmapped	0		0	GAACTCCAAATGAATGCTACTGATGCTAACCAGTTTGCTATTTTAACTTATGAGGGTATG	3658	0	UF_Msa_CF_126709	contig13846___0rc	contig13846___0rc	Unknown	
3683	45	75	unmapped	0		0	GCTGCATGTAAATGTGAAGGTAAAATGTTTGTATGCTGAGAGCTCCATATGCTTTTAAAT	3660	0	UF_Msa_CF_125859	contig30373___0rc	contig30373___0rc	Unknown	
3684	45	76	unmapped	0		0	TCCTTGAGGGGCCACTCTCACTTTGTAAGTGATGTTGTCATATCCTCAGATGGACAGTTT	3662	0	UF_Msa_AF_106631	LMB_S454.sd.488.C1___1_nrnt	LMB_S454.sd.488.C1___1_nrnt	Unknown	
3685	45	77	unmapped	0		0	TGTCAGAGTCTGCCTGCAATGCAATGCTAAATCACTGGAGCATCCCTTTAAAACCACACA	3664	0	UF_Msa_CF_124638	contig03896___0	contig03896___0	Unknown	
3686	45	78	unmapped	0		0	ACTGGAGGACAGAGACAAGCCATACGCCTGTGACACAGTCTGTGGGAAGCGCCACAAGAA	3666	0	UF_Msa_AF_109031	contig24374___1rc_nrnt0	contig24374___1rc_nrnt0	Unknown	
3687	45	79	unmapped	0		0	TGACATTGTACTGTAGTAATGTACAGTGTGGAGATGCAGTAGAAAAGGAGGCCACCTCCT	3668	0	UF_Msa_CF_125721	contig26773___0rc	contig26773___0rc	Unknown	
3688	45	80	unmapped	0		0	TGATGTTCCAAAACATTAGAAAAAGTCGTTCCACTCTTCACCCCGCAGCCTTTTCCTTTG	3670	0	UF_Msa_AD_200177	LMB_Add_54_rc	LMB_Add_54_rc	Unknown	
3689	45	81	unmapped	0		0	TGGCAGTGTCATCGTCAACACCAGGAGTAATTTCTTCAAGTCATGAGATGCTTTACCTTC	3672	0	UF_Msa_CF_123711	contig09927___0rc	contig09927___0rc	Unknown	
3690	45	82	unmapped	0		0	GTGCCGAAAAACAACACAAGAAATGCTCGTTTCTGTTCTCCAGTGTATTCAAAAGAGTCT	3674	0	UF_Msa_CF_121657	contig09581___0rc	contig09581___0rc	Unknown	
3691	46	1	unmapped	0		0	TAGAGTTGGCAAGAGAAAGAAGAAGACCAAGGGACCAGATGCTGCTAGCAAACTACCATT	3518	0	UF_Msa_AF_102056	contig11712___1rc_nr0nt1	contig11712___1rc_nr0nt1	Unknown	
3692	46	2	unmapped	0		0	ATTTTCTGTAAACATGGACTCTGTTGTTGACACAAGTGTCCTTTGTGTAGCCTTCGGTTC	3520	0	UF_Msa_CF_122419	contig07587___0	contig07587___0	Unknown	
3693	46	3	unmapped	0		0	TGAAAATGCCAGACAGGACCTGAAAGAAGGGTTGGTGCTATACAACACAGATAACAACGC	3522	0	UF_Msa_AF_107420	contig30793___1rc_nrnt	contig30793___1rc_nrnt	Unknown	
3694	46	4	unmapped	0		0	GAGTCATCTGTTGTACACCAATGATCTGACCTACATTTCCTCTCCCGATTCTAACATTCT	3523	0	UF_Msa_AF_105251	contig00656___1_nrnt	contig00656___1_nrnt	Unknown	
3695	46	5	unmapped	0		0	ATGGAAAAACAGTGGCAATCATGCAGTGGTTGAGAGCCAAGCACATTCTGCTTCAGCATT	3525	0	UF_Msa_CF_123177	contig19698___0	contig19698___0	Unknown	
3696	46	6	unmapped	0		0	TACATGCTTGCTGGCTCCATGCTGGGGATGGGCTTGCACCCCATCTCTGGTCACTTCATA	3527	0	UF_Msa_AF_109137	contig16329___1_nrnt0	contig16329___1_nrnt0	Unknown	
3697	46	7	unmapped	0		0	ATATATTTCCTGGAGTTTCCCAAGGTTTCTGGAAGCTCAGAGCAGGCAGATCAGACTCTT	3529	0	UF_Msa_CF_118214	contig06675___0	contig06675___0	Unknown	
3698	46	8	unmapped	0		0	TACTAGAGAACAGGGTCTTCTGCCGGCCACACTATGACATTATGATGGAGAATATCAAAC	3531	0	UF_Msa_AF_108751	contig31673___1_nrnt0	contig31673___1_nrnt0	Unknown	
3699	46	9	unmapped	0		0	TCTGACAGCCTATGAACAGTGTGCAAGTGAAGCAGAGAAAGAGAAACTCCTCTCTTCCAT	3533	0	UF_Msa_AF_109098	contig19930___1_nrnt0	contig19930___1_nrnt0	Unknown	
3700	46	10	unmapped	0		0	GTCTCAGGAACGTCCTCCATGAGTCGGCCATTGATAAGAGGGTCCAGTACATGATCGAGG	3535	0	UF_Msa_AF_102843	contig11134___1_nrnt0	contig11134___1_nrnt0	Unknown	
3701	46	11	unmapped	0		0	TGCAGCAGTCATGCTCAACCCAGGCCAGCAGCAGCCCTACTTTCCCTCTCCAGCTCCCGG	3537	0	UF_Msa_AF_107865	contig02253___1rc_nrnt0	contig02253___1rc_nrnt0	Unknown	
3702	46	12	unmapped	0		0	AATGGTCCACTCTGAGTACAGCAGGACAGGTGCCAGCTTCACCAAAGCCCAGCAGGAGTT	3538	0	UF_Msa_AF_108282	contig22642___1_nrnt0	contig22642___1_nrnt0	Unknown	
3703	46	13	unmapped	0		0	TCTCTCGGAAAGCTCTGATGAAGTGCTGCCTGGTCAAATGGATCATCGCCAGCACGCAGC	3540	0	UF_Msa_AF_102938	contig20477___1rc_nrnt	contig20477___1rc_nrnt	Unknown	
3704	46	14	unmapped	0		0	TGTTTCACAGAGTGGTGCGTGAGTTCATCGTTCAGGGGGGAGATCCCACTGGAACAGGGA	3542	0	UF_Msa_CF_122012	contig07030___0rc	contig07030___0rc	Unknown	
3705	46	15	unmapped	0		0	CTTTGCTTTCGCTCTGCAAGCATCCTGAGATGGGGCGCCTGGGGACTGAAGGAGGACAGA	3544	0	UF_Msa_CF_123753	contig22771___0rc	contig22771___0rc	Unknown	
3706	46	16	unmapped	0		0	AGGAACCACGCATACCCAGCCGCCATGTTTGTTCCTCCTTGTTGCAGCTGTGGCGCTGCC	3546	0	UF_Msa_CF_118896	contig20779___0rc	contig20779___0rc	Unknown	
3707	46	17	unmapped	0		0	ATATGGTCTCGAACAGAGCTGTTGGAATGGTGTGTCATCGCCGTGGTTTGAATGCGTGTG	3548	0	UF_Msa_AF_100802	contig19660___1_nr0nt1	contig19660___1_nr0nt1	Unknown	
3708	46	18	unmapped	0		0	TTAAGATTGAAGGTGGCAATGGAAACGTTTCCCCTACACCCAATGAGTTAGACGAAGAGC	3550	0	UF_Msa_AF_104865	contig24595___1rc_nrnt	contig24595___1rc_nrnt	Unknown	
3709	46	19	unmapped	0		0	AATCCACACAGGTGAGAAACCATTTTCTTGCATAACATGTGGGAAAGAATTCAGAACTAG	3552	0	UF_Msa_AF_100646	contig06622___1_nr0nt	contig06622___1_nr0nt	Unknown	
3710	46	20		1028	E1A	0		799	1	(+)E1A_r60_n9	E1A_r60_n9	E1A_r60_n9		CONTROL
3711	46	21	unmapped	0		0	TCTTCACCATTTCTTTGGAGTACGTCTTAACATAATGCTGGTCAACTGCCGAACTCCACG	3555	0	UF_Msa_CF_126113	contig09831___0rc	contig09831___0rc	Unknown	
3712	46	22	unmapped	0		0	AAACCACCAGAGGATAAGGAAGGAATAAAAACACTTCGAGAGCTGGAGAGGTGAAAACCT	3557	0	UF_Msa_CF_122619	LMB_S454.431.C1___0rc	LMB_S454.431.C1___0rc	Unknown	
3713	46	23	unmapped	0		0	AAGCTGTGTGAGAAGGAATACTGTGATACTGTGACTGAGACAATTTTGGCCAACGCTACA	3559	0	UF_Msa_AF_107551	contig00123___1_nrnt	contig00123___1_nrnt	Unknown	
3714	46	24	unmapped	0		0	CTTCTCCTGACTTTTGGAAACAGGAAAAACTGACGAACCTTTTTATTTGAGCTATCTAAA	3561	0	UF_Msa_CF_123499	contig02214___0	contig02214___0	Unknown	
3715	46	25	unmapped	0		0	CATATCCAAGAATGGGCTGGTGAATTTCACACACCCCCTGATTAAACTACATATTTCTCC	3563	0	UF_Msa_AF_106768	contig14079___1rc_nrnt0	contig14079___1rc_nrnt0	Unknown	
3716	46	26	unmapped	0		0	AAACCCAAAGCTGAGATGCACATGGCGGTGGCGCCTCCTGTCATGGCTACAGTAGAAGCA	3565	0	UF_Msa_CF_117821	contig05471___0rc	contig05471___0rc	Unknown	
3717	46	27	unmapped	0		0	ATGAAAGTTTGCTGGTAACCGCAATTTACCACCATTTGCACGGTTGCCAACTTAGCGGTA	3567	0	UF_Msa_CF_125200	contig32780___0rc	contig32780___0rc	Unknown	
3718	46	28	unmapped	0		0	AAGTGTATCAGAGGAAGAAGACATGATGAAGTACTGGAGATGCGCCAGAAGTGTGTTGAC	3569	0	UF_Msa_AF_102679	LMB_S454.sd.612.C1___1_nrnt	LMB_S454.sd.612.C1___1_nrnt	Unknown	
3719	46	29	unmapped	0		0	AAAGGAAACATTGAAGGTTTGGAGGAAGGAAGACTGCAGTCTCATTCCAACGTCTCTCTC	3571	0	UF_Msa_CF_124101	contig04790___0	contig04790___0	Unknown	
3720	46	30	unmapped	0		0	ATAGTGGAGATGCTGTCAAATGTCAACCTCAGTAAAGACCTCCAGATGTTGGCCTATGGA	3573	0	UF_Msa_AF_104076	contig09797___1rc_nrnt	contig09797___1rc_nrnt	Unknown	
3721	46	31	unmapped	0		0	CTTGTATTCTTTGCTGTTTGTCTGCTTTAATAAACATACACGCACACGTGTAACAAAAAC	3575	0	UF_Msa_AF_105000	LMB_S454.1140.C1___1_nr0nt1	LMB_S454.1140.C1___1_nr0nt1	Unknown	
3722	46	32	unmapped	0		0	TGTCGGAGTGCTGGCCACGTTACTGGAGCTCACCTGAGAAAATGGAGCTGTGGATGTGGA	3577	0	UF_Msa_CF_122551	contig10029___0rc	contig10029___0rc	Unknown	
3723	46	33	unmapped	0		0	ATATGTGCATGAAAAGGGACAAGGCGTCATAGAGGAGAACGAGGTGTACAGCAACACGCT	3579	0	UF_Msa_AF_106970	contig14809___1rc_nrnt	contig14809___1rc_nrnt	Unknown	
3724	46	34	unmapped	0		0	CTTCGACACTTGTTTCTGTAAATAAGATCCATTTTCATAGATCTGTCTGTCCAGTTTTGT	3581	0	UF_Msa_AF_109026	contig27336___1_nrnt	contig27336___1_nrnt	Unknown	
3725	46	35	unmapped	0		0	GCATCTGTATGCTGCAATTCAGTTTTAATGGTGGTTCAAGGGAATTTTGAACTTGAATTT	3583	0	UF_Msa_CF_122150	contig29144___0rc	contig29144___0rc	Unknown	
3726	46	36	unmapped	0		0	CACTATCATCAGTTGGATTCAAAAGATAGAAGCAGCTCTTTAAAATCCGGCAGACACGAG	3585	0	UF_Msa_CF_122285	contig18783___0	contig18783___0	Unknown	
3727	46	37	unmapped	0		0	GCTGAGCGGAGACAAGCCGGCAGCCTGCGGTCACTCTGTCTGCAGCTCCTGTCTCGGGAA	3587	0	UF_Msa_CF_120726	contig21518___0	contig21518___0	Unknown	
3728	46	38	unmapped	0		0	ATATCCTTCTGACCGGCATTCCTATGGCTGTCATTGTCACATGTGTGAATGTCTTCATCG	3589	0	UF_Msa_AF_103292	contig13256___1rc_nrnt0	contig13256___1rc_nrnt0	Unknown	
3729	46	39	unmapped	0		0	ATGGACTCAGAGGATGAAGATGAGTATTACAACCTACAAAAGAGGCCTTCCGTGGAGGAA	3591	0	UF_Msa_CF_123744	contig27601___0	contig27601___0	Unknown	
3730	46	40	unmapped	0		0	ATGATTGACTCCACTCTGCCATCTGTTGCCACCTGTCTGACAGACGAGCAGGAGGGCATG	3593	0	UF_Msa_CF_125792	contig09155___0rc	contig09155___0rc	Unknown	
3731	46	41		1028	E1A	0		853	1	(+)E1A_r60_a97	E1A_r60_a97	E1A_r60_a97		CONTROL
3732	46	42	unmapped	0		0	TAACGCTCAGCTGTCTTTGAACAGCAAGCTGGGCCAGCAGGTGGTGATTCCCCGGTACTT	3596	0	UF_Msa_AF_105294	contig01980___1rc_nrnt0	contig01980___1rc_nrnt0	Unknown	
3733	46	43	unmapped	0		0	AGAACTCAAAATGAACATCAGAGACACCAGATGCTGTGAAGTGATGACGTCCAGATGATG	3598	0	UF_Msa_CF_119962	contig25239___0rc	contig25239___0rc	Unknown	
3734	46	44	unmapped	0		0	CTGAAGAAGACTTATGAAGAGGGGCCAGACAGAAAGCTGAAGAGTTTAATGAATTCAAAG	3600	0	UF_Msa_AD_200227	LMB_Add_122_rc	LMB_Add_122_rc	Unknown	
3735	46	45		0		0		3602	1	ETG10_236652	ETG10_236652	ETG10_236652		CONTROL
3736	46	46	unmapped	0		0	GAAGCAGCAGCGTGGTTGTTTGACGCGGCGGAGTCCAACATGGAGGACATGTACATTAAA	3604	0	UF_Msa_AF_106025	contig20671___1_nr0nt	contig20671___1_nr0nt	Unknown	
3737	46	47	unmapped	0		0	TCCTTCAGGCTGGAGAGGGGGATGAGGAGGCGCAGGTGCCATTCTGAGCCCAACACCACC	3606	0	UF_Msa_AF_100350	contig17735___1rc_nrnt-1	contig17735___1rc_nrnt-1	Unknown	
3738	46	48	unmapped	0		0	ATCAGTGTCCAGTATGGACACGCTGTGGAGCTTTAACCAGAGGGGGAGTGTGGGAGAACC	3608	0	UF_Msa_CF_125743	contig21823___0	contig21823___0	Unknown	
3739	46	49	unmapped	0		0	TACCACTTTGTAGATGAGAATGGGAAGGACCAAGGTGTAAATGTGCGTCAGAAGGTGAAG	3610	0	UF_Msa_AF_105978	contig27402___1_nrnt	contig27402___1_nrnt	Unknown	
3740	46	50	unmapped	0		0	TCAGGCTGCTGAAGTCAGTACGCCAGAGGAAGATGTGAGCCCTATTCATTTTAGTTAACA	3612	0	UF_Msa_CF_124679	contig23640___0	contig23640___0	Unknown	
3741	46	51	unmapped	0		0	GCTGTCTGTAAAGAAGCCACAAAAACCTATGTATGAAAATAATGACAGACAATAAAACCG	3614	0	UF_Msa_AF_103720	contig18912___1_nrnt	contig18912___1_nrnt	Unknown	
3742	46	52	unmapped	0		0	CTCCCAGGAGGCCTGCTCCAAGAGCGAGAGAAACGGGCCAAGTGGCATGGCATAAACCCT	3616	0	UF_Msa_CF_118542	contig18355___0rc	contig18355___0rc	Unknown	
3743	46	53	unmapped	0		0	CCACACAGACAAAAAGAAAAGGACAGGGTTATTTTTGACTTCAATGTATATCTGTGTGAT	3618	0	UF_Msa_AF_104704	contig26009___1rc_nr0nt1	contig26009___1rc_nr0nt1	Unknown	
3744	46	54	unmapped	0		0	TTGAGACTTTGGAGGAGGGCTTGGTGCCGGGTCCGCAGAGACAGAAGGATGTTTCGATGA	3620	0	UF_Msa_CF_124597	contig19882___0	contig19882___0	Unknown	
3745	46	55	unmapped	0		0	AAGAGGCGAGCGCCAGAGGTCAAAAGGATGATAACAAAGCAGTCGTGAAAATGCTCTATA	3622	0	UF_Msa_CF_123451	contig02110___0	contig02110___0	Unknown	
3746	46	56	unmapped	0		0	AACAACATCAAAGCCAATGACTACGCCAATGTGGTGTTACAGGCGTTTTCCAATGTTCCG	3624	0	UF_Msa_AF_108471	contig26404___1_nrnt	contig26404___1_nrnt	Unknown	
3747	46	57	unmapped	0		0	ACATGGCCATCCCCCAGCAGCGGGGCCCGACAAAGCTGCCACACCAGTCCCTGCCCCACA	3626	0	UF_Msa_CF_117930	contig22629___0rc	contig22629___0rc	Unknown	
3748	46	58	unmapped	0		0	GGTGTACATCTCAAAGATGGTCCCCACCTCTGACAAGGGTCGCTTCTATGCATTTGGTCG	3628	0	UF_Msa_AF_103149	contig23934___1_nrnt	contig23934___1_nrnt	Unknown	
3749	46	59	unmapped	0		0	CTGCTCCCTCATCGGAGGAAAGAAGGAAGCATTTAAAGATGAATCAGAGAGTGAGGAAGA	3630	0	UF_Msa_CF_125959	contig07969___0	contig07969___0	Unknown	
3750	46	60	unmapped	0		0	TTTTGGAACAACATTGAATGTCCAGATTCTGTGGTTTTCCCCTGGGATCACAAGTCCACC	3632	0	UF_Msa_AF_106827	contig10752___1_nrnt0	contig10752___1_nrnt0	Unknown	
3751	46	61	unmapped	0		0	AAGTAGCTGTGACAAACTATTTATGAGTTGCCAAGGCAATGACACACGGAAACCGACCGA	3634	0	UF_Msa_AF_107215	contig32635___1_nrnt	contig32635___1_nrnt	Unknown	
3752	46	62	unmapped	0		0	ACAATGGCTACACTTACAAGGGGGAGTGTAGATTCAGGATGTCCTTCATTTTGATTGCGG	3636	0	UF_Msa_CF_127687	contig11824___0rc	contig11824___0rc	Unknown	
3753	46	63	unmapped	0		0	TTTACAACGACGACGGAAACGCAGAAGCGGCTGACAGATACAAGGTGAAGAAAACTTTGA	3638	0	UF_Msa_AF_107664	contig11204___1rc_nrnt0	contig11204___1rc_nrnt0	Unknown	
3754	46	64	unmapped	0		0	TTCTGCCTATCCGTACTGAGAAATGGCGGCGTCCGTGTGCCGAGTCGGGAGCACTGTGGG	3640	0	UF_Msa_AF_102834	contig25195___1_nr0nt	contig25195___1_nr0nt	Unknown	
3755	46	65	unmapped	0		0	AAGAGCTCGAGGGTCTGCATGCCACAACATCTGTGAGTGTGGAGGTAGATGAGACTCCCA	3642	0	UF_Msa_CF_126347	contig32119___0	contig32119___0	Unknown	
3756	46	66	unmapped	0		0	TAACTATGGCACTCAACGTGAGGACTGAGTTTTACCCATTAAAAACAAAACGAAGATAGG	3644	0	UF_Msa_CF_121782	contig32537___0	contig32537___0	Unknown	
3757	46	67	unmapped	0		0	TTCAAGAAGTTTGCTTCAGAGAAAGATGCTTGGGCGTTCTTCAGAGGAGTCGAACCTTCT	3646	0	UF_Msa_AF_102760	contig10524___1rc_nrnt0	contig10524___1rc_nrnt0	Unknown	
3758	46	68	unmapped	0		0	CAAAACTTCAGACAACTCCCTGCTGATCTCCAGATTCCAGGAGTTCCTTGAAATGGAGGA	3648	0	UF_Msa_CF_124033	LMB_S454.609.C1___0	LMB_S454.609.C1___0	Unknown	
3759	46	69		1028	E1A	0		853	1	(+)E1A_r60_a97	E1A_r60_a97	E1A_r60_a97		CONTROL
3760	46	70	unmapped	0		0	CCTTGTCTTCTACATCTGAGGAGATCAACCAGAAGTCTACGCGTGATTGTTGAGATCTAT	3651	0	UF_Msa_CF_121373	contig02137___0	contig02137___0	Unknown	
3761	46	71	unmapped	0		0	AAGCAGAGAAGAAAGAAGAGCATGCAGAAGAGAATGAGCATGAGGGGGAGTCCAAGAAGC	3653	0	UF_Msa_CF_126085	contig12063___0	contig12063___0	Unknown	
3762	46	72	unmapped	0		0	TAACAGTTTGGGACCATGTGTCACTGTAAAGAGCCCCCTACTGGAATATTCCTATCACCA	3655	0	UF_Msa_CF_119090	contig20809___0	contig20809___0	Unknown	
3763	46	73	unmapped	0		0	GAGGGACAGATGCTGGCAATCACGCTAACGAGGCTGACAAGTAACAATGACCCCCGACCT	3657	0	UF_Msa_CF_119517	contig19723___0rc	contig19723___0rc	Unknown	
3764	46	74	unmapped	0		0	GACAGAACTTTCCCAAAACATTCTACAGTTCGATCTGCAGATCATTCGATTCTCATCAAG	3659	0	UF_Msa_CF_118620	contig03556___0rc	contig03556___0rc	Unknown	
3765	46	75	unmapped	0		0	ATGTGTGATGCTCTGCAGTGCTAAACACGGAGACAAATACGACCAACTGTTTATTCCCCA	3661	0	UF_Msa_CF_126327	LMB_S454.246.C1___0	LMB_S454.246.C1___0	Unknown	
3766	46	76	unmapped	0		0	TTTCCCCACTCCAGGTTCAAACTCAAGTGTCCCAAAAAAGAAAACAGTAAAATTAGTTGT	3663	0	UF_Msa_AF_101161	contig28534___1_nrnt	contig28534___1_nrnt	Unknown	
3767	46	77	unmapped	0		0	TTTTTGCTGTGGCATCTCAGCTTCTTTTCTTCATGTGCTCAGAAGTCAAGGTGTGGCATC	3665	0	UF_Msa_CF_121021	contig02370___0	contig02370___0	Unknown	
3768	46	78	unmapped	0		0	AAGAGCATCATAGCTGACCACCCGGACCTGGAGGAGACCGACGTCATCAAAGAGGCAATG	3667	0	UF_Msa_AF_100611	contig28063___1_nr1nt0	contig28063___1_nr1nt0	Unknown	
3769	46	79	unmapped	0		0	TGTGTATCCCATTGAGTGTGTTTATAAAAGACGTGAGGGGTGGGTTCCACCTTTCCTGAA	3669	0	UF_Msa_AF_104332	contig19065___1rc_nr1nt0	contig19065___1rc_nr1nt0	Unknown	
3770	46	80	unmapped	0		0	TCTGCTGAATACAGTCATCATTGTGATGGTGTGGGTGTACAGGACCATTTCCACTATGAC	3671	0	UF_Msa_AF_101884	contig14827___1rc_nr1nt0	contig14827___1rc_nr1nt0	Unknown	
3771	46	81	unmapped	0		0	GAGGGAAAACATGCTGCCTTTGGCTTCATTATCATAGTTAAACCCTGATTTAAAATGTTG	3673	0	UF_Msa_CF_125254	contig16914___0	contig16914___0	Unknown	
3772	46	82	unmapped	0		0	TGATGGACACCACCACCCAGAACATGACAAGGGACAAGCCCCATGGTCCCCCTACACCGC	3675	0	UF_Msa_CF_123822	contig26067___0rc	contig26067___0rc	Unknown	
3773	47	1	unmapped	0		0	GTATAGCCGAGAAGGAGTTGGGCTGGAAAGCCAAATTTGACCTGGAAAGAATGTGCGAGG	3676	0	UF_Msa_AF_105203	contig00831___1rc_nrnt-1	contig00831___1rc_nrnt-1	Unknown	
3774	47	2	unmapped	0		0	GCCAGTAGATTTTATAGCTTTATATGCATGTCATGTACTGTATTTACATTAGAACTGGGC	3678	0	UF_Msa_CF_117843	contig28611___0	contig28611___0	Unknown	
3775	47	3	unmapped	0		0	GAAGAAGTTTCCGATGCAACAGCTAGGCATCACCATGCCTACTGCTGTGATTATGGAAGG	3680	0	UF_Msa_AF_100895	contig18717___1_nr0nt	contig18717___1_nr0nt	Unknown	
3776	47	4	unmapped	0		0	TGGAGAAGAACAATATTGGGAATGTCGACAATGAAGAAATTTCAGAGTCAATAGTGCATA	3682	0	UF_Msa_CF_126409	contig13506___0rc	contig13506___0rc	Unknown	
3777	47	5	unmapped	0		0	CAATGTGGAATTTGTCTTTTGAACAGGCCAGCAGGAATCTAATTTAGGTTATTTGTGTAT	3684	0	UF_Msa_AD_200162	LMB_Add_158_rc	LMB_Add_158_rc	Unknown	
3778	47	6	unmapped	0		0	TTTCATGAGAAGTTTGTACCTGCTGTGATGCACATCAAGAAGCAGCGTGTGATCAGTGTG	3686	0	UF_Msa_AF_101692	contig17890___1_nr0nt	contig17890___1_nr0nt	Unknown	
3779	47	7	unmapped	0		0	TATGTTGATTCTATGGGGAAAAGCTCAGGCCACTGGGATGGATCAAGGAAGATGGTTTAG	3688	0	UF_Msa_CF_119139	contig05482___0rc	contig05482___0rc	Unknown	
3780	47	8	unmapped	0		0	TACGCTTTGGCAACTCCCAGAGGAAGCAGAGGAAAATCAAGGCCTGAAGAGAGTGAGGAA	3690	0	UF_Msa_CF_127726	LMB_S454.126.C1___0	LMB_S454.126.C1___0	Unknown	
3781	47	9	unmapped	0		0	GTCCTTGTATTTCCCATCTGTAGAAGTGACAATTCATGAAAGCAGTTTTCACGCGAGTAG	3692	0	UF_Msa_CF_126170	contig05350___0rc	contig05350___0rc	Unknown	
3782	47	10	unmapped	0		0	ACAAATACTTTGAGGACAACAAGCACTACTTCTTTGGACGTCACCGCTGGGTGATCTACA	3694	0	UF_Msa_AF_100820	LMB_S454.sd.524.C1___1_nrnt	LMB_S454.sd.524.C1___1_nrnt	Unknown	
3783	47	11	unmapped	0		0	CCATCCTGCTGCATGAGGTCCCACATGAGATAGGAGACTTTGCCATCCTTGTCCAGTCTG	3696	0	UF_Msa_AF_109575	contig16155___1rc_nr0nt	contig16155___1rc_nr0nt	Unknown	
3784	47	12	unmapped	0		0	AATGGGAGTCCTTTGTTCACGAGAACCTGCTCATGTACACGAAGCTCTTCCAGGTTTTTT	3698	0	UF_Msa_AF_107521	contig07457___1_nrnt	contig07457___1_nrnt	Unknown	
3785	47	13	unmapped	0		0	TATATACCATGACCTCATACTGTCCATGGGAAGGAAGACTAGTGGGAAGAACGATCTACG	3700	0	UF_Msa_CF_122875	contig26129___0rc	contig26129___0rc	Unknown	
3786	47	14	unmapped	0		0	GCTTTTTGTCTTTTTTACAGAAAGACTGTGCAACACGTTATTATCATATGACAACACGAG	3702	0	UF_Msa_CF_125951	contig22516___0	contig22516___0	Unknown	
3787	47	15	unmapped	0		0	CTCACATCCTGACTAAGAGGGGGGTGAAGACAAAATGAGCTCAGAGCCGCTTCATAGCAA	3704	0	UF_Msa_CF_121518	contig07388___0rc	contig07388___0rc	Unknown	
3788	47	16	unmapped	0		0	AAACAGCTACAGAAACGAGCCAGAGTTGGTGCTTTCTCCTGTGAAGGAGTACAGCAAAAA	3706	0	UF_Msa_CF_122886	contig16686___0rc	contig16686___0rc	Unknown	
3789	47	17	unmapped	0		0	ACAAAAATTGGCATGTGGGTCAAGAGAATGTGAAGTTCACCTGTGGTGCCAAAGCAAACC	3708	0	UF_Msa_AF_103454	contig01632___1rc_nr1nt0	contig01632___1rc_nr1nt0	Unknown	
3790	47	18	unmapped	0		0	TCAATAGTTATTTCAAGTTACATATATAATGTTAATAAATGCCACTTTAATATACAACTA	3710	0	UF_Msa_AF_109579	contig13077___1_nr0nt	contig13077___1_nr0nt	Unknown	
3791	47	19	unmapped	0		0	CAACTATACAAACGTCTCTTCCCATTTTGTTTATACCGGATTTCTGTAACGTACAACAAA	3712	0	UF_Msa_AF_108819	contig13343___1rc_nr1nt0	contig13343___1rc_nr1nt0	Unknown	
3792	47	20	unmapped	0		0	CGCTGGAAACTCATGTAAAGTGTGACATCAGAGAGAGTGAGAAATGTCTTTACCGGAGCA	3714	0	UF_Msa_AF_106638	contig01574___1rc_nrnt0	contig01574___1rc_nrnt0	Unknown	
3793	47	21	unmapped	0		0	AAACAGGTCAGCACCAGACACATTATCAGCAAGCTGTTCTTTGATATTGGTGGAGAGGAG	3716	0	UF_Msa_AF_100288	contig15515___1_nrnt	contig15515___1_nrnt	Unknown	
3794	47	22	unmapped	0		0	ATGGTGCGGCTGGCGTCTGAGAGCCAGGAGAGGCTAGATAGAGGGAACATGAGCGTTGGG	3718	0	UF_Msa_CF_126563	contig06311___0rc	contig06311___0rc	Unknown	
3795	47	23	unmapped	0		0	GAGTTATCGTAAGCACGAGACTACAAGGAGTGAAAGAGAGTAACGTTAAAATGGATGTGG	3720	0	UF_Msa_CF_120140	contig14504___0rc	contig14504___0rc	Unknown	
3796	47	24	unmapped	0		0	AGTGAAGTCGAACAAGTGCTCTTTAAAATGACCAGTATCTGCACAGGTACTTTACACTAG	3722	0	UF_Msa_CF_123254	contig31546___0rc	contig31546___0rc	Unknown	
3797	47	25	unmapped	0		0	TTTAAGGGATTTGAAGGTTCAAGTAATCTTAACTGGCCCTCTGACTCCTAGGACAAAAAA	3724	0	UF_Msa_AF_103605	contig16508___1_nr0nt	contig16508___1_nr0nt	Unknown	
3798	47	26	unmapped	0		0	AACACGACAAGTAAGGCTGTCAACACGACAACATGAGACAGAGCGTATACACGCAACAAT	3726	0	UF_Msa_CF_123647	contig27931___0	contig27931___0	Unknown	
3799	47	27	unmapped	0		0	CGTGCTGCTCAGCCTCCTCTGTGGACTCATCCAGGCTGTAATGGCATTACTGAGATTAGG	3728	0	UF_Msa_AF_101153	contig07683___1rc_nrnt-1	contig07683___1rc_nrnt-1	Unknown	
3800	47	28	unmapped	0		0	GGACAGTCCACTGCAGGACATTCTGTTACTTGCACGTTTACCTCGGTAGTGTGCCTAAGG	3730	0	UF_Msa_CF_125283	contig18708___0	contig18708___0	Unknown	
3801	47	29	unmapped	0		0	TTAGTTTAAGTTGTTTGAGTTTTCTTACTGTGTTGACAGGCCCCACCCCCTCCCTACACA	3732	0	UF_Msa_AF_105149	contig19423___1_nrnt	contig19423___1_nrnt	Unknown	
3802	47	30	unmapped	0		0	TGGACCAGGAGGACCCACAGCCTCCACAGGTTAAAGAGGAACAGGAGGAACTCTGTACCA	3734	0	UF_Msa_CF_123323	contig26391___0rc	contig26391___0rc	Unknown	
3803	47	31	unmapped	0		0	GAAAGATACGTCGAGTTTGCTTGTTTACCTCTATCACCACAATTATCACGAGACCTCACA	3736	0	UF_Msa_CF_124995	contig31575___0rc	contig31575___0rc	Unknown	
3804	47	32	unmapped	0		0	CTGCATCCAGAGGGATGCATAAGTATCAACCGATGGGATCTTCAGACCAAAAAAGAAACC	3738	0	UF_Msa_CF_126650	contig30789___0rc	contig30789___0rc	Unknown	
3805	47	33	unmapped	0		0	TGATGAGAAGAAGAAGCTCTACTGTATCTATGTGGCCATTGGACAGAAGAGGTCCACTGT	3740	0	UF_Msa_AF_106717	contig26694___1_nrnt	contig26694___1_nrnt	Unknown	
3806	47	34	unmapped	0		0	ATTCAGGTGTGCTGCCAGCGATGAACAGAAACAAGGGAAGAAAAAAGACACAACAGAGCT	3742	0	UF_Msa_CF_119611	contig30700___0	contig30700___0	Unknown	
3807	47	35	unmapped	0		0	TAACTGGAAGAAGTCTCCTGCTCATTTCTTCCAACACATGCTTGTGCATCCTCAGAGACT	3744	0	UF_Msa_CF_124028	contig19311___0rc	contig19311___0rc	Unknown	
3808	47	36	unmapped	0		0	ATCAGTGGTCTCAGACCACGGCTGATGAGCTGCCACTCAATCAGGGGGCAGATGCAGCCC	3746	0	UF_Msa_AF_101951	contig05425___1rc_nrnt0	contig05425___1rc_nrnt0	Unknown	
3809	47	37	unmapped	0		0	ATGCTAACCAACCCTGACTGCTCCACTGCCACCACACACCCAACTGTTGAAGCAAGCACA	3748	0	UF_Msa_CF_120748	contig21012___0	contig21012___0	Unknown	
3810	47	38	unmapped	0		0	AAATCCCTGCAGGATATCATTGCCATTCTGGGTATGGATGAGTTGTCTGAGGAGGACAAA	3750	0	UF_Msa_AF_104880	contig27306___1rc_nrnt	contig27306___1rc_nrnt	Unknown	
3811	47	39	unmapped	0		0	TGCAGGTACGACTGGAACAGGCAGGATTCAAACCCAGTCCTCCCAACATGTGGCAACAGC	3752	0	UF_Msa_CF_127041	contig12810___0rc	contig12810___0rc	Unknown	
3812	47	40	unmapped	0		0	AGGACTGAAGTTCCTCGACCTCAACAAAAATCGCATCAAACTGATCGAGACAGGAGACTT	3754	0	UF_Msa_CF_125820	contig00965___0	contig00965___0	Unknown	
3813	47	41	unmapped	0		0	CAGCAGGTCACTGCTCTGTCAGCTCCCACTTTGTTAGGAGATGAGCGAGACTCCATCTTA	3756	0	UF_Msa_CF_118518	contig26948___0rc	contig26948___0rc	Unknown	
3814	47	42	unmapped	0		0	GAAGATAGGAGGGAGGCGCAAATGGGTAATGGTGTCTGTTAAGCAGTTAACACTGTATAC	3758	0	UF_Msa_CF_123514	contig31513___0	contig31513___0	Unknown	
3815	47	43	unmapped	0		0	AAGGCCGCCTGTCCATCCACAGGATAAAGCGTACAGCTGGAGACTATCCAGCCCGCGCCA	3760	0	UF_Msa_AF_100809	contig02353___1rc_nrnt-1	contig02353___1rc_nrnt-1	Unknown	
3816	47	44	unmapped	0		0	GACTACTACTGATCATCCGCGGTCATCAACAGAGAATAATAAAGAATGACAAATTCAAAA	3761	0	UF_Msa_AF_105479	contig31713___1_nrnt	contig31713___1_nrnt	Unknown	
3817	47	45	unmapped	0		0	CCATGATTGCAACATCAACTATACAGGCATACAAAGACAATACTAAGAGAGAGAGAGTAA	3763	0	UF_Msa_AF_105794	contig15151___1_nr0nt1	contig15151___1_nr0nt1	Unknown	
3818	47	46	unmapped	0		0	ATGTCAAGGCTAAAATCCAGGACAAGGAAGGCATCGCTTGGGTAGCTGCCGTGGAAGGAG	3765	0	UF_Msa_AF_104067	contig22690___1_nr0nt1	contig22690___1_nr0nt1	Unknown	
3819	47	47	unmapped	0		0	TTGATTAGGCTGCTATGGTTAACGCAGCCAAGCCTATAAAACATGGCAGGAGAGTATGGT	3767	0	UF_Msa_CF_117688	contig21684___0rc	contig21684___0rc	Unknown	
3820	47	48	unmapped	0		0	AGACCTGAAGCCTGCCAACATCATGTTTGGACTGGATGGGGAAGTGAAGATTGGAGACTT	3769	0	UF_Msa_AF_107493	contig17590___1rc_nrnt	contig17590___1rc_nrnt	Unknown	
3821	47	49	unmapped	0		0	TCTGCGCCTTCCCGTCTTCACTTATAAACAATTGTTACAAAAGCACACAGGAAGACGGAC	3771	0	UF_Msa_CF_117896	contig18924___0rc	contig18924___0rc	Unknown	
3822	47	50	unmapped	0		0	AGAAAGAGTTATGCCAGGTGGTGCGGCTGGTGCCAGGGGCCTACCTGGAATATAAACAGG	3773	0	UF_Msa_AF_100792	contig31667___1_nrnt	contig31667___1_nrnt	Unknown	
3823	47	51	unmapped	0		0	TAAGTTAATGTGAAGTTATGACGGAGTTTTTCTGTCTTCGGAGCCACATGGACGGTCAGG	3775	0	UF_Msa_CF_119282	contig24523___0	contig24523___0	Unknown	
3824	47	52	unmapped	0		0	AATCATTGTCCAGGAGCTGCCATGCTGCTGTTCTTCCTGCCCGATGGACAGACAGTCCTC	3777	0	UF_Msa_AF_106172	contig11489___1rc_nrnt0	contig11489___1rc_nrnt0	Unknown	
3825	47	53	unmapped	0		0	TCTTTGGCCTCTTCTGTAATTGTGAAGCACATAAGAGCTCACTCCTTCAACATGGTGTTG	3779	0	UF_Msa_AF_108142	contig15032___1_nrnt0	contig15032___1_nrnt0	Unknown	
3826	47	54	unmapped	0		0	GTCTTCTCTGTGCGCAACCCTGCGCGATGCGCGCTCCTCTGTTGTCCGCCTGTTCTCCCT	3781	0	UF_Msa_CF_119977	contig18031___0rc	contig18031___0rc	Unknown	
3827	47	55	unmapped	0		0	ACAGAGCCAGTTGAGCATGAATTCAGATGGGGTCAACGTGCTGAAATTGAAGTGTCAAAA	3783	0	UF_Msa_AF_100320	contig13148___1_nr1nt0	contig13148___1_nr1nt0	Unknown	
3828	47	56	unmapped	0		0	TGGTCGCTGTAACCTGTGGGTCAACCAGAGGGTCAGAAACAGTATCACAGGTGTGGGCAG	3785	0	UF_Msa_CF_123844	contig21722___0	contig21722___0	Unknown	
3829	47	57	unmapped	0		0	AAATGATGCTAACAGTCCTCACCAAATATAGCAGCCGTGTGACTGCTGCACACAAACACT	3787	0	UF_Msa_AF_103196	contig29336___1_nr1nt0	contig29336___1_nr1nt0	Unknown	
3830	47	58	unmapped	0		0	GAGAAACCCACCTTGGAAAAAGACAGGATTGTTAGAGGAAAAACCAAGTTGACAAGGACT	3789	0	UF_Msa_CF_122572	contig02661___0rc	contig02661___0rc	Unknown	
3831	47	59	unmapped	0		0	GCTCTTCTCGCTTTGAGAAACTTCTCCACACGATGAGAGCCAAGTGGAGGAAGAAGCGTA	3791	0	UF_Msa_AF_106492	LMB_S454.417.C1___1_nr0nt1	LMB_S454.417.C1___1_nr0nt1	Unknown	
3832	47	60	unmapped	0		0	CCTCACCTGGATGGATTCAGGAGCAACCAGGAACTCTGGTCAGAAAGGGAAAGCAATGTG	3793	0	UF_Msa_CF_125407	contig12993___0rc	contig12993___0rc	Unknown	
3833	47	61		0		0		2943	1	ETG07_105829	ETG07_105829	ETG07_105829		CONTROL
3834	47	62	unmapped	0		0	ACATGGAGGAATCTTCTGTGATGCAGGGAGCACAGGGAATGCTGGTCCAGAACTGGCCCA	3796	0	UF_Msa_AF_106353	contig05242___1_nr0nt	contig05242___1_nr0nt	Unknown	
3835	47	63	unmapped	0		0	CTGACCGGCTGTCGGCGCACCAATCTCCAGCTACATGCCTCAGCTGGGTGGCTACAGGCC	3798	0	UF_Msa_CF_118812	contig13584___0	contig13584___0	Unknown	
3836	47	64	unmapped	0		0	CACAACCACAAACAACACCCAGTGTAAGAACAACTACTCTGTGACTCCGAATTGTATACT	3800	0	UF_Msa_CF_122977	contig12273___0rc	contig12273___0rc	Unknown	
3837	47	65	unmapped	0		0	TCCAGCAGTTCCACTTCTAGTGACAGCCCAGCATTGGGGGGAACCTCAGGTTCAAGACTC	3802	0	UF_Msa_CF_120560	contig25642___0	contig25642___0	Unknown	
3838	47	66	unmapped	0		0	AGGACCGCGTGGAGGCCGTCAACATGGCCGAGGGCATCGTCCATGACACAGAATCCAAGA	3804	0	UF_Msa_AF_101201	contig10671___1_nrnt	contig10671___1_nrnt	Unknown	
3839	47	67	unmapped	0		0	TTGTGTGGACATCCTCCGGCAGCGAGGATCTCGGTCACTCAAGGCTCTCGATTCATCAGA	3806	0	UF_Msa_CF_120030	contig05186___0	contig05186___0	Unknown	
3840	47	68	unmapped	0		0	ACACATGACAGAACAGGGCTCCGTTTTCCCTGAAGTGTCTCGAGAGTTTCTCTTTGTTCC	3808	0	UF_Msa_CF_120051	contig05783___0rc	contig05783___0rc	Unknown	
3841	47	69	unmapped	0		0	CTCCTCATCACTGGGCTCCAGTAGACTGTACAGTAGGGAGACGGTGCTAAATAATGACCG	3810	0	UF_Msa_CF_122571	contig22636___0rc	contig22636___0rc	Unknown	
3842	47	70	unmapped	0		0	ATTCTGCTTTGTAATCGGTCAAGCTCTGCAGTGCTACAAATGCAGCATTGGCTTACGGAA	3812	0	UF_Msa_CF_127594	contig20976___0rc	contig20976___0rc	Unknown	
3843	47	71	unmapped	0		0	GTGTGTCAGAGGGCCGCACCGCGCTGCAGATGAAGCATGCCGGGCGACAGCGAGACAAAG	3814	0	UF_Msa_CF_127324	contig23809___0	contig23809___0	Unknown	
3844	47	72	unmapped	0		0	GAGGAGAGGGTAGTTTAGGAACATGATAAACGCCTAAAACATTTTAATGTTCAGTATCAA	3816	0	UF_Msa_AD_200153	LMB_Add_95_rc	LMB_Add_95_rc	Unknown	
3845	47	73	unmapped	0		0	GGTAATGGAGTGAAATATGAAGGAAATTATCAACATCACACAATCAGGGAAACGGTGTCA	3818	0	UF_Msa_CF_122331	LMB_S454.184.C1___0	LMB_S454.184.C1___0	Unknown	
3846	47	74	unmapped	0		0	CCCACTTCAGCAAGAAGCGCAGCAAGTGCATGAAGAGTCTGAAGAGGAACACTGCTGCCA	3820	0	UF_Msa_CF_126431	LMB_S454.992.C1___0	LMB_S454.992.C1___0	Unknown	
3847	47	75	unmapped	0		0	GTTCTCTTCACTCACTTTGCATATGTAACATGTTTTTATGCTCCATATAATGTGAGAGAG	3822	0	UF_Msa_AF_108719	LMB_S454.sd.477.C1___1rc_nr0nt	LMB_S454.sd.477.C1___1rc_nr0nt	Unknown	
3848	47	76	unmapped	0		0	TTAAAACTAGACTCATCACAACCCCTGGGAAAAACACTGGACTACCTTTGGCCACAGCAT	3824	0	UF_Msa_CF_124059	contig14464___0rc	contig14464___0rc	Unknown	
3849	47	77	unmapped	0		0	GACTCCTGTGGCTTTGCTCAGCTGTCTCCTACACACAGGGCAAAATCCTTGTCTACCCCA	3826	0	UF_Msa_AF_108901	contig03390___1_nr0nt1	contig03390___1_nr0nt1	Unknown	
3850	47	78	unmapped	0		0	ATCACTGAATACATGCAAAAAGGACGAGCAGTGGAGTGTGTTCAGTACCAACAGATCCTG	3828	0	UF_Msa_AF_105276	contig15154___1_nrnt	contig15154___1_nrnt	Unknown	
3851	47	79	unmapped	0		0	CAGATGTGTCAGATTTATCAAACCCATACAGGACCAAACTGCAAAAACACCGTACCAAAA	3830	0	UF_Msa_AF_102138	contig28958___1rc_nrnt-1	contig28958___1rc_nrnt-1	Unknown	
3852	47	80	unmapped	0		0	CTTCTGTATCAGACTTTAAGGTTATATGGTGCTTTGTTCATGTATGTGTTGGCGTAAATA	3832	0	UF_Msa_AF_100846	contig30217___1_nr0nt1	contig30217___1_nr0nt1	Unknown	
3853	47	81	unmapped	0		0	GGGGGGCCTTTTTTATCTCTGGTACTCTTTTTAATTTATTTGGGTGGCATATTAGTTGTG	3834	0	UF_Msa_AF_109156	contig25547___1rc_nrnt-1	contig25547___1rc_nrnt-1	Unknown	
3854	47	82	unmapped	0		0	TGCATGTGTTTATGTTGCCCTGCTCAACCCTAAAACCCTCATGCGAAGACATACTGTATA	3836	0	UF_Msa_CF_124171	contig20362___0rc	contig20362___0rc	Unknown	
3855	48	1	unmapped	0		0	AGGACTATGCAGAATATGAGTCCCGAGCTCGTCTGCTCACAGAGATCCATGCGATGGGCG	3677	0	UF_Msa_AF_105602	contig28627___1_nrnt	contig28627___1_nrnt	Unknown	
3856	48	2	unmapped	0		0	GATGGATGTACTGGAGACTTGTCATCACTGTGAGGTTGACAAGAAATTACTGTGAAGAAA	3679	0	UF_Msa_CF_121434	contig04778___0	contig04778___0	Unknown	
3857	48	3	unmapped	0		0	TCAAGGATGCAGTGAGGAGAGGCCACGAGTCAAAGGTTAACAGAAACACCTGAAAGACGG	3681	0	UF_Msa_CF_117868	contig06363___0	contig06363___0	Unknown	
3858	48	4	unmapped	0		0	AAGGAGCGGTGGTGAAAGCTTGGATGTTGGCAGAGACAGACCGAGGGGCAGCGAGCCACT	3683	0	UF_Msa_CF_122524	contig00434___0rc	contig00434___0rc	Unknown	
3859	48	5	unmapped	0		0	GAGTCTACTTTTTCTAGGCTAATTCACAGATTGGGTTTAGTTACATTATAAACCTGAGCA	3685	0	UF_Msa_AF_103865	contig00899___1_nrnt	contig00899___1_nrnt	Unknown	
3860	48	6	unmapped	0		0	TCTCGTACCATCTGGCACTACCAGTACTTGAGCTGGCCTGACCATGGTGTTCCTCAGGAG	3687	0	UF_Msa_AF_103526	contig26509___1_nrnt	contig26509___1_nrnt	Unknown	
3861	48	7	unmapped	0		0	TCTCTGCAGCCGCTAAATGTTACCTGGCTGCTGGTGCCAGTTTTGATGCTGCTAAAGTTA	3689	0	UF_Msa_CF_117786	contig22948___0	contig22948___0	Unknown	
3862	48	8	unmapped	0		0	TGAGCTATTTCCTGTTAAACTGCCAAGGGCGGGACATCCCATTTGTAGCTGTTTACAAGA	3691	0	UF_Msa_CF_123905	contig16308___0	contig16308___0	Unknown	
3863	48	9	unmapped	0		0	TCTCAGCCGAGCGCCTCGTCTCAGAAGTTGTCCATTAACGTTGTCCTGTTTGGAGCGCTG	3693	0	UF_Msa_CF_120499	contig03742___0rc	contig03742___0rc	Unknown	
3864	48	10	unmapped	0		0	CAAGAATCACTCCCATGATCCCTGCCAAAGTCTTGGAGCACGTCTCACGTGAGACTGCAT	3695	0	UF_Msa_AF_100158	contig24443___1_nr0nt	contig24443___1_nr0nt	Unknown	
3865	48	11	unmapped	0		0	AAATCAAATGGATGACTTTTCAAGCAAAGAAAATGAGACAGAAGCTTGACCAACAATTGG	3697	0	UF_Msa_CF_125853	contig21630___0	contig21630___0	Unknown	
3866	48	12	unmapped	0		0	CAGCCTGGTGAACCAGCAGAGCTTCCAGGACATCAAACCGATGAGGAGACCAGATCATCC	3699	0	UF_Msa_AF_103111	contig07569___1_nrnt	contig07569___1_nrnt	Unknown	
3867	48	13	unmapped	0		0	TCAGTAGCAGTTTGGTTCGATTGATCTCGCTCTCATCATCTAGGTTAATATGAACCTCAG	3701	0	UF_Msa_AF_101473	contig31041___1_nr0nt	contig31041___1_nr0nt	Unknown	
3868	48	14	unmapped	0		0	TGTGCAGCTGTAGACAGCTATCACCTCTATGCCTTCCATCAAGACAACTCTAACAGCAAT	3703	0	UF_Msa_AF_105412	contig01413___1_nrnt0	contig01413___1_nrnt0	Unknown	
3869	48	15	unmapped	0		0	AATTTCCAGATATCCAGTTTTTCTTCTCTTACCTGTCTACCGGCACCAACGATGTTGACA	3705	0	UF_Msa_CF_118207	contig22517___0	contig22517___0	Unknown	
3870	48	16	unmapped	0		0	CTTGGAGAAAACAATAACCGAGTCTGAGGAGGAGATGGAGAGCCGCCATCGCAAGCTGCC	3707	0	UF_Msa_CF_123892	contig11219___0rc	contig11219___0rc	Unknown	
3871	48	17	unmapped	0		0	AAGCTCTTCCAGGCGGTTTTCTGCGGCAAAGGAAGAGCATCAATGATTGTCAACATTAAC	3709	0	UF_Msa_AF_100898	contig03162___1rc_nrnt0	contig03162___1rc_nrnt0	Unknown	
3872	48	18	unmapped	0		0	TTTTGTGCCCTCTCGGAGCCATCATGAAGGTCGAGTTGTGCAGTTTCAGCGGGTATAAAA	3711	0	UF_Msa_AF_101393	contig26711___1_nr0nt1	contig26711___1_nr0nt1	Unknown	
3873	48	19	unmapped	0		0	GGAGAGGAGACGGAGCAGGCAGCTGAGAAGAACTGAACTGAACTTCAGAAAGAAAAACAA	3713	0	UF_Msa_CF_125677	contig07421___0rc	contig07421___0rc	Unknown	
3874	48	20	unmapped	0		0	GAAAGGAGCCTTTGAAACTCATGAGTCTTATGCTATTCTAGTCTGGATGTGAATAATTGA	3715	0	UF_Msa_CF_119034	contig29900___0rc	contig29900___0rc	Unknown	
3875	48	21	unmapped	0		0	GTTTACAGCCCTCATAATATATATACACAGAACTCCAACAGCTTTCAAAGAAACCAACAA	3717	0	UF_Msa_CF_118409	contig00358___0rc	contig00358___0rc	Unknown	
3876	48	22	unmapped	0		0	TCCTTGAGTATGAGTAGTCTTTGTGACCACTGACCATGAAGAACCACTGCTTCTAATGAA	3719	0	UF_Msa_AF_106336	contig30478___1_nrnt	contig30478___1_nrnt	Unknown	
3877	48	23	unmapped	0		0	ATTTCTAACACCAGCCAGCTGTCAGTCTGCCTCACGAGCAGGCATCTGATCTCCGATACC	3721	0	UF_Msa_CF_122262	contig26910___0rc	contig26910___0rc	Unknown	
3878	48	24	unmapped	0		0	ATCAGCAGATGAACTAATGATGACCACTATAAATGCATGCACTTCTGCAGTGTTGGTTTG	3723	0	UF_Msa_CF_124914	contig30703___0rc	contig30703___0rc	Unknown	
3879	48	25	unmapped	0		0	AGATAACTTCAACTCCACCTCAGGAAACTTGTGTGCGCGATACCCTCCGCCTCCTTCAAT	3725	0	UF_Msa_CF_122854	contig21036___0rc	contig21036___0rc	Unknown	
3880	48	26	unmapped	0		0	GTAGAAACAGCCAAAAGTCGTGAGTCGCTCTCTGGAGAGTCACGGCCGTTTGCAGAGGGA	3727	0	UF_Msa_AF_103769	contig03366___1_nr0nt1	contig03366___1_nr0nt1	Unknown	
3881	48	27	unmapped	0		0	TTCACTTCATGCTGTTCCTGGCATCACTCTACATCATGATGACGCTTACCAACTGGTACA	3729	0	UF_Msa_AF_105139	contig28232___1_nrnt	contig28232___1_nrnt	Unknown	
3882	48	28	unmapped	0		0	AAACACAAACCGAAATCTACAGCTAGTTTTTCCTGTTACTGTGATACTGGACAACTGGCC	3731	0	UF_Msa_CF_123668	contig06745___0	contig06745___0	Unknown	
3883	48	29	unmapped	0		0	ACACTTGTATTATTAAAAGTGAATCAGTCTGAGTGTGAATGCATCCTGGCCTGTGTGCAT	3733	0	UF_Msa_AF_101330	contig30672___1_nr0nt	contig30672___1_nr0nt	Unknown	
3884	48	30	unmapped	0		0	ATGGTAGAAGCTAAGGCTCGGGAACAGATCATGTTCTTTGATGAGGTGCTGTTGTTCGAA	3735	0	UF_Msa_AF_102937	contig09753___1rc_nrnt0	contig09753___1rc_nrnt0	Unknown	
3885	48	31	unmapped	0		0	TAAACCGAACGCTCTGCTGAACAGCAGTGTTGTGCTGGTTAAACTCTATTTGACCTCTGA	3737	0	UF_Msa_CF_124015	contig18099___0	contig18099___0	Unknown	
3886	48	32	unmapped	0		0	CTTGATCAAAAATCAATGCAAGCTGGCCTCTAGGAGACTGCTTAAAGACAGTGATAGACA	3739	0	UF_Msa_CF_122604	contig01502___0	contig01502___0	Unknown	
3887	48	33	unmapped	0		0	GAGATAGAGGAGGAGGCATGGTGATTGGAGACCGCTGGATTATTGACTGCAGCTCATGTC	3741	0	UF_Msa_AF_102690	contig07294___1_nrnt	contig07294___1_nrnt	Unknown	
3888	48	34	unmapped	0		0	CTGCCCAGCTACAGAGACACACCGGCGTCTCCACAGGTTTATCTGAAGCCACACTTTAAC	3743	0	UF_Msa_AF_109441	contig14905___1_nrnt0	contig14905___1_nrnt0	Unknown	
3889	48	35	unmapped	0		0	CTGTCATTCCAGTTCACGCAACATAAAGAATATGAACAAAACACACACTAAGGAAAAACA	3745	0	UF_Msa_AF_105993	contig29708___1_nr0nt	contig29708___1_nr0nt	Unknown	
3890	48	36	unmapped	0		0	ACAGTGACAGCACAGAGCTGATCATGTCTGGAGCTGGGGCTCTGATCTTCTGCGGTTTCC	3747	0	UF_Msa_CF_121332	contig25020___0rc	contig25020___0rc	Unknown	
3891	48	37	unmapped	0		0	GCTGTTTGGCATCACTGCCCCAACTTCTGTGGAACTGACTGGTTGGAGGAAATACTTTAA	3749	0	UF_Msa_CF_125919	contig09415___0	contig09415___0	Unknown	
3892	48	38		0		0		3751	1	ETG08_142674	ETG08_142674	ETG08_142674		CONTROL
3893	48	39	unmapped	0		0	AACAGAAATTCAAGATGATGAGCTGCAGAGAGGTTGCAATAAAACGGGACTCTCCAGCAC	3753	0	UF_Msa_CF_117870	LMB_S454.sd.180.C1___0rc	LMB_S454.sd.180.C1___0rc	Unknown	
3894	48	40	unmapped	0		0	TTTAGGATCCTTTAGTTTTTCTGATCATCGCCTCCATGATATTCCACTGATCTGGAGTCA	3755	0	UF_Msa_CF_122279	contig32501___0rc	contig32501___0rc	Unknown	
3895	48	41	unmapped	0		0	TAGTGTTGTGCCCTGCTTCCCCCTAGGGCAGGTCACTGGTCTGCAGGCTCAAACAATACA	3757	0	UF_Msa_AF_100851	contig12248___1rc_nrnt0	contig12248___1rc_nrnt0	Unknown	
3896	48	42	unmapped	0		0	CAAAAACAGAAACGGACACTTTACCACTGTCTTCACACAGCCAGAGGAGGAGACAGTTAA	3759	0	UF_Msa_AF_106646	contig29332___1rc_nrnt0	contig29332___1rc_nrnt0	Unknown	
3897	48	43		0		0		1893	1	RC11	RC11	RC11		CONTROL
3898	48	44	unmapped	0		0	AAGAGAGGACCGTGTGTGTCTGAAGGAGACGAGAGGGTGGTGAACCCCTCAAAAGGACTC	3762	0	UF_Msa_CF_126683	contig06043___0rc	contig06043___0rc	Unknown	
3899	48	45	unmapped	0		0	TACTCCCTCAGAAGAAGGGAGGATGTTAAAGAAGAGAAAAATCACTCCAGGACCATCGAC	3764	0	UF_Msa_CF_120649	contig16866___0	contig16866___0	Unknown	
3900	48	46	unmapped	0		0	TAGTGATTCTACAGAACTTCAGACAGGCCACAAATGAAAAGGGAACGCCTGAAGAGGTGA	3766	0	UF_Msa_CF_120053	contig16986___0rc	contig16986___0rc	Unknown	
3901	48	47	unmapped	0		0	AGAGTGAGCTGTTTCTTCAGGTCCAACAGTACGGCTACCTCTGCGTGTGATCACGGCCTT	3768	0	UF_Msa_CF_119776	contig31367___0rc	contig31367___0rc	Unknown	
3902	48	48	unmapped	0		0	AAACAGCCTTTGTCAATCCCTGTTACCTGCAGGCGGCGCAAGAGAGGAGGCAGGGGTTTA	3770	0	UF_Msa_AF_104270	contig28580___1_nrnt	contig28580___1_nrnt	Unknown	
3903	48	49	unmapped	0		0	TAGTGTGCCGACAGCTCTGTGTGGAGACTAGGACGAAAGGCCACTGACGGCAAACGTATC	3772	0	UF_Msa_CF_127519	contig25996___0rc	contig25996___0rc	Unknown	
3904	48	50	unmapped	0		0	TATTACCCCGTGTCACAGGGCACACACAATGTTCAAGTATGCCTGAGGAACTAAATGAAG	3774	0	UF_Msa_AF_103094	contig00879___1_nr0nt	contig00879___1_nr0nt	Unknown	
3905	48	51	unmapped	0		0	AGTAGCCAAACATGGCGGACACGGATGAACCGATGGTGGTTGATGGAGGCACCTGTGAGT	3776	0	UF_Msa_CF_122725	contig17679___0	contig17679___0	Unknown	
3906	48	52	unmapped	0		0	TTCTTGATGACATAAATGATTGCCCCCTCCATGAAAGACAACTCGTCGTCCTTGTCCTTG	3778	0	UF_Msa_AD_200118	LMB_Add_44	LMB_Add_44	Unknown	
3907	48	53	unmapped	0		0	AACACTGAAAGAGTATAAAAGGAATCAAGAACATGTGTATATTTAATGTTTTTAAGATGT	3780	0	UF_Msa_AF_105880	contig19643___1_nr0nt	contig19643___1_nr0nt	Unknown	
3908	48	54	unmapped	0		0	TAACGGTTAGCCCTTCTCTCTCTTCCACCCCGCCTGGCTTTATAAAGGGCCACAAGCAGG	3782	0	UF_Msa_AF_108507	contig23791___1_nr0nt	contig23791___1_nr0nt	Unknown	
3909	48	55	unmapped	0		0	GAAACTAGGATAAATACGGAAACTCTTCTCCAGTACAAAACCAGCCCACTGTTATACCAT	3784	0	UF_Msa_CF_119784	contig15185___0rc	contig15185___0rc	Unknown	
3910	48	56	unmapped	0		0	AGGCGGCGATCAGCTGAAAACCTGCAACGCTGGGAGAATCAGCATGACCGAGCAAAGACT	3786	0	UF_Msa_CF_121045	contig00846___0rc	contig00846___0rc	Unknown	
3911	48	57	unmapped	0		0	TTTGGGTTTAGTGTTGGTACTTGCTGTTCTCTTTTGGCAAGTCTTTGCTACCTGCCTCTC	3788	0	UF_Msa_CF_122097	contig19967___0rc	contig19967___0rc	Unknown	
3912	48	58	unmapped	0		0	ACAAAACCAAGAAGATGAAACTCACAGTCAAAGGAGGAGCTGCTGTGGATCCTGATTCAG	3790	0	UF_Msa_AF_107227	contig23567___1rc_nrnt	contig23567___1rc_nrnt	Unknown	
3913	48	59	unmapped	0		0	AACAAAAGTACAGCTGATTGCTGTGTTTTGTGGTGGATTTGTGGAGTTCCAGAGTGCCCT	3792	0	UF_Msa_CF_121158	contig21938___0	contig21938___0	Unknown	
3914	48	60	unmapped	0		0	TTACATTGAGGAGGTACACTGAGGACAAACAGGTACAGGAAACAGAACCAAAAGGCTGGT	3794	0	UF_Msa_CF_121304	contig17865___0	contig17865___0	Unknown	
3915	48	61	unmapped	0		0	TAGAGATAGCTTTAAAGGTTAGCCCCATGCTGGGAGCCCACATGTTCCAGCCCCTGCTGC	3795	0	UF_Msa_AF_104660	contig18900___1rc_nrnt0	contig18900___1rc_nrnt0	Unknown	
3916	48	62	unmapped	0		0	TCAGCCAAAAAAGCGATTCCACTAAAGACATCCGAGGGGACAAAATCACTTGGATAGAGG	3797	0	UF_Msa_AF_101352	contig18467___1_nrnt	contig18467___1_nrnt	Unknown	
3917	48	63	unmapped	0		0	AACACCTACAGGAGGTATAACGTCTAACACTAGAAAGGTCATGGATGCCTACACTTGTTT	3799	0	UF_Msa_CF_121858	contig01205___0rc	contig01205___0rc	Unknown	
3918	48	64	unmapped	0		0	TCTTTGGTCTGGATGATGGCATTCTGCACTTTGACCGCACAGAGGAGGACTTCACTGCCT	3801	0	UF_Msa_AF_109104	contig18603___1_nr0nt1	contig18603___1_nr0nt1	Unknown	
3919	48	65	unmapped	0		0	CGAGAAAAGCCTCGATATCTCATGGGTGTGGGATATGCTGTGGATTTGGTGGTATGTGTA	3803	0	UF_Msa_AF_109323	contig06603___1rc_nrnt-1	contig06603___1rc_nrnt-1	Unknown	
3920	48	66	unmapped	0		0	TCTTGAGAAGGTGAGCAGCAGAGAGAAGTACATCAACAACCAGCTGGAGCATCTGATCCA	3805	0	UF_Msa_AF_106411	contig04054___1rc_nrnt	contig04054___1rc_nrnt	Unknown	
3921	48	67	unmapped	0		0	AGTCCATTCAAAGATCAGAGTAACATAAGCACTGGGGTTGTAAGAAGTAGTGCTTATAAA	3807	0	UF_Msa_CF_121268	contig19609___0	contig19609___0	Unknown	
3922	48	68	unmapped	0		0	CTACCCTCGCTCTGGAAAGGCTGTGTGGCTGCTGCTTTACAACGGATGTCCCAACCCCTT	3809	0	UF_Msa_AF_104367	contig10068___1rc_nrnt0	contig10068___1rc_nrnt0	Unknown	
3923	48	69	unmapped	0		0	CTCTCTTCAGGAAGTTAATGATTTGGGAAATCCTCAATCAGAAGCTGCTATAGGGGATCC	3811	0	UF_Msa_AF_106205	contig23751___1rc_nrnt-1	contig23751___1rc_nrnt-1	Unknown	
3924	48	70	unmapped	0		0	ACTTCTTGAAGCTCATGAGGAACAGAACAGCGAAGCTTTCACAGAGGCTGTTAAGGAGTT	3813	0	UF_Msa_AF_105196	contig09468___1_nrnt	contig09468___1_nrnt	Unknown	
3925	48	71	unmapped	0		0	ATTGTTCAGGAAGTTGAATAGATCCATCAAAGCCAGTATGTTTCCTCTAAACACTCAACC	3815	0	UF_Msa_CF_125068	contig22059___0rc	contig22059___0rc	Unknown	
3926	48	72	unmapped	0		0	AAACGAGCTCATCCTGATTGAGGATGATCAAGGGGAAAACAGTTCGGACAGAAATCCCAT	3817	0	UF_Msa_CF_118251	contig05497___0	contig05497___0	Unknown	
3927	48	73	unmapped	0		0	GGGACTCACATGCACCCTGACAACATCCCCGCTTCCTTCTATGCAAAGAAAACTAAAATG	3819	0	UF_Msa_AF_102852	contig28410___1rc_nrnt	contig28410___1rc_nrnt	Unknown	
3928	48	74	unmapped	0		0	GCTGGGGAGATCTGGACTACCCAAAATCTGCCTCCCCCTCTTTAACCCTGACTGTTACTT	3821	0	UF_Msa_AF_109215	contig23637___1rc_nrnt0	contig23637___1rc_nrnt0	Unknown	
3929	48	75	unmapped	0		0	AGGTCTCTCCCACGGGCGTCAACGGCAGTGACTCCAGCGGTTACCTTAGTGACCAGCCAA	3823	0	UF_Msa_CF_122463	contig11637___0rc	contig11637___0rc	Unknown	
3930	48	76	unmapped	0		0	AAGATGATGAAGACATGCAGATGGCTTTGGCATGCAGCCTGTCAGAAATGGAAGCCCAGC	3825	0	UF_Msa_AF_101785	contig31592___1_nr0nt	contig31592___1_nr0nt	Unknown	
3931	48	77	unmapped	0		0	TCAGAAGATGTCCTGATCTCTTCTTCTTTGAACAAAGGGGCCACGTTACCAGATGAGCTT	3827	0	UF_Msa_AF_108748	contig00126___1_nr0nt1	contig00126___1_nr0nt1	Unknown	
3932	48	78	unmapped	0		0	ATAATAAGCATTTTTCACATCGAAGAGTTCATCCACATCTCCCTGCTGCGCCGCCATGTT	3829	0	UF_Msa_AF_105406	contig14364___1_nr0nt	contig14364___1_nr0nt	Unknown	
3933	48	79	unmapped	0		0	AATACATTTGGGTCCTTGTAGTGTCGTTATTCGGCTCTACAGAAATATGATTAAATCTAG	3831	0	UF_Msa_AF_107106	contig32471___1_nr0nt1	contig32471___1_nr0nt1	Unknown	
3934	48	80	unmapped	0		0	CCTGCAGTGTCAAAATACCCAAGACCTATGACAACATCACCAAAGACTTCAACTTGTGTT	3833	0	UF_Msa_AF_105614	contig23945___1_nr0nt	contig23945___1_nr0nt	Unknown	
3935	48	81	unmapped	0		0	CAGGACTCTACTCTTGTCACTTTATTTAATCTGCACAAGGCTGAAACAATAAACAGAAAA	3835	0	UF_Msa_AF_110191	contig00115___1_nr0nt1	contig00115___1_nr0nt1	Unknown	
3936	48	82	unmapped	0		0	TGGCCTTGTGGCAGCCTACAGTGGAGACAGTGACCCTGAGGAGGGGCTAAGATTAAGCTA	3837	0	UF_Msa_CF_126042	contig00226___0	contig00226___0	Unknown	
3937	49	1	unmapped	0		0	ATTTCTGGTCCAGGCCCAGCCGTTCCTAACCCGACAGTAAGCCAAGGTGAAGATCCAGTC	3838	0	UF_Msa_CF_121956	contig15870___0	contig15870___0	Unknown	
3938	49	2	unmapped	0		0	AATCTGAAAGGATGGGTGCGGGCTGCTCCAGCGGCCCGGCTGTTTGGTCTGTCAGTCAGT	3840	0	UF_Msa_CF_125031	contig31773___0rc	contig31773___0rc	Unknown	
3939	49	3	unmapped	0		0	AAGAGGAGGAAGAGGCTGTGTCCACGCCTGCCAGCTCAGAGGAAGAGTCTGACTAAACAC	3842	0	UF_Msa_CF_126243	contig24130___0rc	contig24130___0rc	Unknown	
3940	49	4	unmapped	0		0	TTTAACACAGACGGTGGTGTATATGAGTAAGCTGGGACGGGATGGACAAACATACAATGG	3844	0	UF_Msa_CF_127339	contig03240___0rc	contig03240___0rc	Unknown	
3941	49	5	unmapped	0		0	ATACAAGCTGTTGCAGTGAATCATCTATTCTCCTTATCCAGAGACACTGCCAGCACTCTG	3846	0	UF_Msa_AD_200218	LMB_Add_128_rc	LMB_Add_128_rc	Unknown	
3942	49	6	unmapped	0		0	GATTAGTGAAAAAGGCCAAAAACAATGACATCTGCAAGTCTGCAGCCAAACCTTACCCCG	3848	0	UF_Msa_CF_122838	contig29660___0	contig29660___0	Unknown	
3943	49	7	unmapped	0		0	GCAGTACTTCTGTCAGTCCAGCAGGAGCAGCAGACTGCCCCCCAGACTCATCCACACCTC	3850	0	UF_Msa_CF_121532	contig26033___0rc	contig26033___0rc	Unknown	
3944	49	8	unmapped	0		0	GGGAAAAACAGGAGAAAAGAGCAGAAACAATAAACTACCCCCTAAAAGCTGCCTCAGGAG	3852	0	UF_Msa_CF_119322	contig09674___0	contig09674___0	Unknown	
3945	49	9	unmapped	0		0	ATCTCAACTCAATACTCTGTCAAAACGGCTGCTAAAAGGACAACAGTACGCTCTCCTTCT	3854	0	UF_Msa_CF_119925	contig01099___0	contig01099___0	Unknown	
3946	49	10	unmapped	0		0	TAGATTAGAGAAAACGACGGAGGGTCACATGAGAGCATGGAGTTGGGAGAATTCTTTCAG	3856	0	UF_Msa_CF_121179	contig01400___0rc	contig01400___0rc	Unknown	
3947	49	11	unmapped	0		0	ATGGACGGGCCAAGAAAGCCTGGCTCAGGACGACCCCGAGATGTGGGATCTGCTGCGAAA	3858	0	UF_Msa_AF_109659	contig25307___1rc_nrnt-1	contig25307___1rc_nrnt-1	Unknown	
3948	49	12	unmapped	0		0	ATCTGCTCTGGAGGAGATTCTATGGAGATGGAGGAGAAGAAGAAGAAGCAGCAGCAGCCA	3860	0	UF_Msa_AF_102459	contig03535___1_nr0nt1	contig03535___1_nr0nt1	Unknown	
3949	49	13	unmapped	0		0	TCTCAGCTGCAATGACGCCCCAGATACAGCTAACCCTAACCGTAGCAACAGCTCAGGTAC	3862	0	UF_Msa_CF_121818	contig31327___0	contig31327___0	Unknown	
3950	49	14	unmapped	0		0	TGTCAGCTATCACGAAAAATGGCAGGTATATTTCCCTCACGGTAAAGTCAAAGGGACGCA	3864	0	UF_Msa_CF_126214	contig06419___0rc	contig06419___0rc	Unknown	
3951	49	15	unmapped	0		0	AAACTTTTTATCTGTCAGAATGCAGGACCCGAATGAAGACACAGAGTGGAATGATATCCC	3866	0	UF_Msa_AF_106124	contig23799___1_nr0nt	contig23799___1_nr0nt	Unknown	
3952	49	16	unmapped	0		0	CCCCAGCCTGCTGGAGCAGATTGATGCCTTCAAAGCTCCTCAGAGGTCTGTAGAGAAACC	3868	0	UF_Msa_AF_104269	contig05085___1_nrnt0	contig05085___1_nrnt0	Unknown	
3953	49	17	unmapped	0		0	GGGGAAACGATGTCGGACGCCGAAAGTGCTCGCAGTCCAGACCAGCTGAATAAATTCGAG	3870	0	UF_Msa_CF_121927	contig17867___0rc	contig17867___0rc	Unknown	
3954	49	18	unmapped	0		0	ACCTTCAGGAAAGTCAGAAACACAGCGAGAACCTTAGAACCTCTAAATCAGCAACACCAT	3872	0	UF_Msa_CF_122644	contig29744___0	contig29744___0	Unknown	
3955	49	19	unmapped	0		0	GCGTGTCTCCCCTCCGGCCGTAGCGCAGCGCAACGCTACCAGATGCAAGTGCGGGGGAAG	3874	0	UF_Msa_CF_123680	contig07137___0	contig07137___0	Unknown	
3956	49	20	unmapped	0		0	ACAGCAAAATACATGCATGACTTTACCACATAAGAGTGAGTAAATCGCTCACACTTCTCC	3876	0	UF_Msa_CF_124625	contig21188___0rc	contig21188___0rc	Unknown	
3957	49	21	unmapped	0		0	GTGGGAAAATGTAATTGATGCCTGCAATTTTAGGCTGGTTTCATACTGTATACATAAACT	3878	0	UF_Msa_AF_109024	contig28447___1_nr0nt1	contig28447___1_nr0nt1	Unknown	
3958	49	22	unmapped	0		0	CATGGACATTTTTCACAGTACACACAGGATCAGATAGATGGTCAATATATTAAGTCTGTT	3879	0	UF_Msa_AF_102450	contig32068___1rc_nrnt	contig32068___1rc_nrnt	Unknown	
3959	49	23	unmapped	0		0	AACCAACCAGCTACGCAGGAATAAGAAAGACATGGTCCTGAACAGAAAAGACGACGTCTA	3881	0	UF_Msa_CF_124346	contig16251___0rc	contig16251___0rc	Unknown	
3960	49	24	unmapped	0		0	ATCAAGGTACGAGCAGGGAGCTGCAAACCATTAAAAGGGGCAGTTTTCTGTTCACTATCA	3883	0	UF_Msa_CF_120380	contig01937___0rc	contig01937___0rc	Unknown	
3961	49	25	unmapped	0		0	TGAATGGAGTGAAGATGGAGATGGATGGCCACCTCAATAAGGACTTCCATCAGGAGGTAT	3885	0	UF_Msa_AF_107964	contig17045___1rc_nrnt	contig17045___1rc_nrnt	Unknown	
3962	49	26	unmapped	0		0	GACCTTTTGGAAATGAGCAAAAGAGACGGCCCCTGCTGGTGTTGATGGATGGATGATCTG	3887	0	UF_Msa_CF_122804	LMB_S454.25.C1___0	LMB_S454.25.C1___0	Unknown	
3963	49	27	unmapped	0		0	CGGGGCATCAACAGGATCACACAGCAACCATGAGGTCTCTGGTCTTCGTTCTGCTCATCC	3889	0	UF_Msa_AF_107822	contig16070___1rc_nr0nt1	contig16070___1rc_nr0nt1	Unknown	
3964	49	28	unmapped	0		0	TCGAGTGAATCCTGGATGAGCAACTTGTAAGGATTTAATTTAAAGAGCTCTGCTTATGGG	3891	0	UF_Msa_AF_103081	contig29769___1_nrnt	contig29769___1_nrnt	Unknown	
3965	49	29	unmapped	0		0	TTTTAAAGTGGAAGTAAACGGCTGAAGCAGCGGAGTCGTTATTTCTTCTGAGGGAACGCT	3893	0	UF_Msa_CF_118115	contig01627___0rc	contig01627___0rc	Unknown	
3966	49	30	unmapped	0		0	AAACTCAGAATGAATCGTAACAAGGACACCAACCTGTCTATTCACAGTTCCTTTGCTATG	3895	0	UF_Msa_CF_120539	contig24259___0rc	contig24259___0rc	Unknown	
3967	49	31	unmapped	0		0	GAAAAGTCAGGCCGGGGATGTGTTGTGTCCCTATCTGCGGCAGTATGTGTGTCCTCTGTG	3897	0	UF_Msa_AF_109096	contig28593___1rc_nr1nt0	contig28593___1rc_nr1nt0	Unknown	
3968	49	32	unmapped	0		0	AGGTTTGTGCTGGACGCTGTGAAGATGCTGCTGGACTTCATAGAGACTCTGGAGGAGAAG	3899	0	UF_Msa_CF_120576	contig30508___0	contig30508___0	Unknown	
3969	49	33	unmapped	0		0	TCAGAAAGCCTTGGCAGCTGAGTACAGCTTCAGCGTGGATGGTCTCCTCTTCTACCACCG	3901	0	UF_Msa_AF_104480	contig10131___1rc_nrnt0	contig10131___1rc_nrnt0	Unknown	
3970	49	34	unmapped	0		0	AATGGTTTGTCCTTATGGGAAAACAGCAGATGGCTTCGAGATGCAGATCGGTGTCAATCA	3903	0	UF_Msa_AF_110109	contig30407___1rc_nrnt	contig30407___1rc_nrnt	Unknown	
3971	49	35	unmapped	0		0	AAGGCTGAGAGAAAGCGGATGAGGAACCGCATCGCTGCCTCCAAATGCCGGAAGAGGAAG	3905	0	UF_Msa_AF_106681	contig07189___1_nr0nt1	contig07189___1_nr0nt1	Unknown	
3972	49	36		0		0		3245	1	ETG09_35454	ETG09_35454	ETG09_35454		CONTROL
3973	49	37	unmapped	0		0	TGACTTTGTGCAACGCAAACAGGAAGAGGAAGCTTTGAGGGCAGCGCAGAAAAGGACGAA	3908	0	UF_Msa_AF_104191	contig24842___1_nrnt	contig24842___1_nrnt	Unknown	
3974	49	38	unmapped	0		0	GTTACACCTCGTCATCCTACCGGAAGATTTTCGGGGATTCCCCCAGGTTTTCCATTTCCT	3910	0	UF_Msa_CF_121758	contig10469___0	contig10469___0	Unknown	
3975	49	39	unmapped	0		0	TTCTAAATGACCTGGAACACTGGACCAAGTACTGCGTCCAAGTCCAAATCAACACCAAGA	3912	0	UF_Msa_AF_102890	contig01851___1_nrnt0	contig01851___1_nrnt0	Unknown	
3976	49	40	unmapped	0		0	GCATCATTGCTCAAGTAGTGAGCAATGATGCCCTGCGTGGTGCCACTCCCCAGGCCGCAG	3914	0	UF_Msa_AF_106442	contig23936___1_nr0nt1	contig23936___1_nr0nt1	Unknown	
3977	49	41	unmapped	0		0	TCGCACCACACCGGACTACCACGGCAAGATAAGCGCCTTCATCCGCAAACACGACGCCAG	3916	0	UF_Msa_AF_100650	contig00026___1_nrnt0	contig00026___1_nrnt0	Unknown	
3978	49	42	unmapped	0		0	GGAGAGACACTCCCTAACAATCTTAGCGTTCATGTTAAAACAGTGTGTTTTATATACATT	3918	0	UF_Msa_CF_126391	contig30472___0rc	contig30472___0rc	Unknown	
3979	49	43	unmapped	0		0	TACAAGGAGAACTTTGGCAAGGGCCTCAACCAGCCTCACTCGAAGATGCCGGTGTACACC	3920	0	UF_Msa_AF_106047	contig09233___1_nrnt	contig09233___1_nrnt	Unknown	
3980	49	44	unmapped	0		0	GGCGGACGAGCTAGCCAAGTACTACTCAGCCCTGAGACACTACATCAACCTCATCACAAA	3922	0	UF_Msa_AD_200346	LMB_Add_15	LMB_Add_15	Unknown	
3981	49	45	unmapped	0		0	GCCTTGGACCTGTCCAACAATGACCTTGTGATTCTTCCAGACGACACATTCACCAGCCTC	3924	0	UF_Msa_CF_121708	contig04084___0rc	contig04084___0rc	Unknown	
3982	49	46	unmapped	0		0	CTAGTCGTATTTTAGATGAGAAAGTCTGAGTGAGGAGGAGCAGGGTCCCTTGGTACTGGA	3926	0	UF_Msa_CF_123127	contig27026___0rc	contig27026___0rc	Unknown	
3983	49	47	unmapped	0		0	AACCACGTCAGCACCACACGCTACCACGGTGGGGAAGAGGAAGACGATGATAGGGAAAAT	3928	0	UF_Msa_CF_126487	contig16817___0rc	contig16817___0rc	Unknown	
3984	49	48	unmapped	0		0	TTTGGTCTCTCCTGACTACTTGGGCATGAGGAACATCTGGGAGCTTTGAACATACATTCT	3930	0	UF_Msa_CF_120381	contig16022___0	contig16022___0	Unknown	
3985	49	49		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
3986	49	50	unmapped	0		0	CAGAGCTAGCACCACAGGTGTCCGCAGCCATGGATGAAACCGGCAAAGCAGCACGAGCTG	3933	0	UF_Msa_CF_125477	contig19272___0	contig19272___0	Unknown	
3987	49	51	unmapped	0		0	ATCCTGCTTATCATGGAGTCTCGGCGCTCAGACGGAGTACACGTGTTGGAGCCTACGCAT	3935	0	UF_Msa_AF_101982	contig11331___1_nrnt	contig11331___1_nrnt	Unknown	
3988	49	52	unmapped	0		0	CCTGTCTAGTGTCTGTAGCAGTCCCACTTCAAGTCCCAAACCAAGACATCTGGTCTGTCT	3937	0	UF_Msa_AF_104903	contig22400___1_nr0nt1	contig22400___1_nr0nt1	Unknown	
3989	49	53	unmapped	0		0	GTGGAGCTCTGCTTTGATGGTTTTGAATTCACTAGCTGAAGGAAGGTGCTGTGTTTCATC	3939	0	UF_Msa_AF_100270	contig08500___1_nr0nt	contig08500___1_nr0nt	Unknown	
3990	49	54	unmapped	0		0	AGGCTGCAGTAGCATCCGCTCGGTGTAGCAGTCTAGTGACGATAATGTAGATGCAGTTGA	3941	0	UF_Msa_CF_123522	contig22958___0rc	contig22958___0rc	Unknown	
3991	49	55	unmapped	0		0	TATGGTGAGGAATGACGTCCCAACACACACACCCAAGCAGCTGCAACATGGCCAGAGTCC	3943	0	UF_Msa_AF_108865	contig06918___1_nr0nt1	contig06918___1_nr0nt1	Unknown	
3992	49	56	unmapped	0		0	ACGAAGTTGATCTTGAGGTTTTCAATACCACACTCAGTGTCATGGCTCCTGTCAATGCAC	3945	0	UF_Msa_AF_108684	contig32211___1_nr1nt0	contig32211___1_nr1nt0	Unknown	
3993	49	57	unmapped	0		0	ACTCCTGATGAGAAAGGAAACACTTTCTTCTTCAAAGGTGCCCACTTGTGGAAGGGTTTC	3947	0	UF_Msa_AF_105172	contig16528___1rc_nrnt-1	contig16528___1rc_nrnt-1	Unknown	
3994	49	58	unmapped	0		0	TTTTCATTCAGGCTACAGGGTTAGTGGTAACTTCCTCTAGCAGTGGTTGGTAGTGTTCTG	3949	0	UF_Msa_AD_200097	LMB_Add_129	LMB_Add_129	Unknown	
3995	49	59	unmapped	0		0	CCACTCGGCATTCTGGTACCTTCCACTGTCTACTTGGATGAGGAAGGGGGGTAAGGTAGG	3950	0	UF_Msa_CF_125826	contig25449___0rc	contig25449___0rc	Unknown	
3996	49	60	unmapped	0		0	TGGACTTGGATTCTCTAGATGAAAGAATTAAGATCAAGAGAGATGATCCTGAAGGGACAG	3952	0	UF_Msa_AF_110195	contig19782___1rc_nrnt0	contig19782___1rc_nrnt0	Unknown	
3997	49	61	unmapped	0		0	AGCCATGTCCAACAAAAAGGCAGCCAGAGAGCTAGAAGTCCATGAATGCCCAACCAACCT	3954	0	UF_Msa_CF_121129	contig21585___0rc	contig21585___0rc	Unknown	
3998	49	62	unmapped	0		0	AGGCTGTCCAAAACAAAGAGGCAATGAGGATGAAGCCCAGCAACAGCTAAAGCTAGTCAG	3955	0	UF_Msa_CF_119018	contig04562___0rc	contig04562___0rc	Unknown	
3999	49	63	unmapped	0		0	GGACGTGACGTGCAGAGAGCTGGAGTTGCCACTCACTTTGTAGAGTCTAAGAAGATCCCA	3957	0	UF_Msa_AF_105771	contig12707___1rc_nr1nt0	contig12707___1rc_nr1nt0	Unknown	
4000	49	64	unmapped	0		0	CCGTCAGAGGGAAGTGAAAATGAGATGGAGACAGAAATTCTGGATTACATGTAACAAAAG	3959	0	UF_Msa_CF_124830	contig14536___0rc	contig14536___0rc	Unknown	
4001	49	65	unmapped	0		0	CACCAGCGAGCTACCGCAGTGGGATACAGCGAACCATAACATTCTCCGAGAACAGTGTTA	3961	0	UF_Msa_AF_100734	contig30087___1_nrnt0	contig30087___1_nrnt0	Unknown	
4002	49	66	unmapped	0		0	GAGTTTGGCCTGAGTGCAGCAGTTCAATACAAACCTCATTAATGCCTTGTATTTCTAATA	3963	0	UF_Msa_CF_122835	contig12619___0	contig12619___0	Unknown	
4003	49	67	unmapped	0		0	AAGAGTGTGACCAGGAAGGAGGACAAGAAGATACAGAACTGGTCAAAAGTGCCAGAGCAT	3965	0	UF_Msa_CF_122920	contig13250___0rc	contig13250___0rc	Unknown	
4004	49	68	unmapped	0		0	CTCTGGAGATAAAGTAGCAGTATTTGGCACAACAAGGAGAACATGAGATACATTTAAATT	3967	0	UF_Msa_AF_105432	LMB_S454.1118.C1___1_nr0nt	LMB_S454.1118.C1___1_nr0nt	Unknown	
4005	49	69	unmapped	0		0	GCACTTCATTCCTGACTTCTCGTTTGATAAAATTCCTGACGACGAGTGGAACTTGCTGTA	3969	0	UF_Msa_AF_100132	contig10399___1_nr0nt	contig10399___1_nr0nt	Unknown	
4006	49	70	unmapped	0		0	CCAGACAATCCAGGAAGTTTCTAAATGTAGGTGATTGATATGCTTGTTTGTAGAAGTTTA	3971	0	UF_Msa_CF_118412	contig13564___0	contig13564___0	Unknown	
4007	49	71	unmapped	0		0	AATGAAGGGTATCAAATGGTGAGTAAGGACGACACCAGGACTTGTTTGCTGAACAAATGG	3973	0	UF_Msa_AF_106400	contig07175___1rc_nrnt	contig07175___1rc_nrnt	Unknown	
4008	49	72	unmapped	0		0	TGGAAAAGGACCTCTAGGCAGCAGTGGCATCAAGAAATCAGGCAAGAAGTAAAGTCAGAA	3975	0	UF_Msa_CF_118047	contig03351___0	contig03351___0	Unknown	
4009	49	73	unmapped	0		0	AGGAAGGATTTAAGGCTGTCTTCATTGGGAATTGGCCTCCCTCAGGCCAACAGAGCTAAA	3977	0	UF_Msa_AF_108679	contig26672___1rc_nrnt0	contig26672___1rc_nrnt0	Unknown	
4010	49	74	unmapped	0		0	TGCAAAACATATGGCATACAAATAACAAGAGGCATGGTATGGACGGTAGGAAGATGGAGA	3979	0	UF_Msa_AF_100046	contig00365___1_nr0nt	contig00365___1_nr0nt	Unknown	
4011	49	75	unmapped	0		0	TCCAATGAAAGAAGGCAGAAGTTTTTACGGTTGATGGGCGCTGGCAAGAAAGAACACACT	3981	0	UF_Msa_AF_102200	contig29595___1rc_nrnt	contig29595___1rc_nrnt	Unknown	
4012	49	76	unmapped	0		0	CTGGCTGGGAAAGCGCTGCACCTAGTCTACCACATGGGGAGAGCCGGAAAAGTTTTGGTT	3983	0	UF_Msa_CF_119761	contig21920___0	contig21920___0	Unknown	
4013	49	77	unmapped	0		0	TTTTCTCTCAGTCCTGTATTGAGATTAAAGACATGGGGGAACAGGTTGGTGTTTGGCTCC	3985	0	UF_Msa_CF_127203	contig15104___0rc	contig15104___0rc	Unknown	
4014	49	78	unmapped	0		0	AATTGCCACAAGCTCAGCAGTGGAAACAGACGTATTTAAACTACTAGAAGCTACTTTGTG	3987	0	UF_Msa_CF_124519	contig18245___0rc	contig18245___0rc	Unknown	
4015	49	79	unmapped	0		0	GTGCATTAGGCAAAGCTGAAGATGAAAAGGAAAAATGTAAACATCAGTGTCCATGCTGGG	3989	0	UF_Msa_AD_200077	LMB_Add_92_rc	LMB_Add_92_rc	Unknown	
4016	49	80	unmapped	0		0	AATGAGATCCCAAGCTGCATCAGAAGAGAAACAACAAGTCAATGATGAAGAGGAAGCAAG	3991	0	UF_Msa_AD_200276	LMB_Add_161	LMB_Add_161	Unknown	
4017	49	81	unmapped	0		0	AAATACTCATACCGCAAATAGAAAACCCTCCCCTGGGTGCAGACTGCAGCAGCGCCGGTG	3993	0	UF_Msa_CF_123466	contig05276___0rc	contig05276___0rc	Unknown	
4018	49	82	unmapped	0		0	CGGGATATTGATCGCTTCACTAAAGCCTTGTTGGAGTCCTGGTTATCCGCTGGGTCTGGA	3995	0	UF_Msa_AF_103487	contig32608___1rc_nr1nt0	contig32608___1rc_nr1nt0	Unknown	
4019	50	1	unmapped	0		0	CCTTAACCTATTGGTATTTTTGATATAGGATTTGCGCTTGGCTTGGTAAAAGACGTTTAA	3839	0	UF_Msa_AF_103651	LMB_Sanger.16.C2___1rc_nr0nt1	LMB_Sanger.16.C2___1rc_nr0nt1	Unknown	
4020	50	2	unmapped	0		0	TAGGCTTCCAGTTTCTACCTGGAGATCATTGAGCTGGACTAGTAAAGATTGACTGGGTAG	3841	0	UF_Msa_CF_123823	contig06092___0rc	contig06092___0rc	Unknown	
4021	50	3	unmapped	0		0	GGGAACAGCGAAAACACCTTCACACACGAGATACTATTAATGGAAGAATCATCTTGGAGA	3843	0	UF_Msa_CF_122963	contig16872___0rc	contig16872___0rc	Unknown	
4022	50	4	unmapped	0		0	CACCTTCACTTGTTTTGTCCTTTTGAAGCACTCAATATAAATGTGCCTATTTCATTACTG	3845	0	UF_Msa_AF_101786	LMB_S454.27.C1___1_nrnt	LMB_S454.27.C1___1_nrnt	Unknown	
4023	50	5	unmapped	0		0	ATGTGATGTCTCCTGCACCGGAGTGGATGCCTACGCTGCCCATATTCGTGGGGCTAAACA	3847	0	UF_Msa_AF_100195	contig20077___1_nr1nt0	contig20077___1_nr1nt0	Unknown	
4024	50	6	unmapped	0		0	GTTGTCTGGTCTATCCGTCATCTACAAGAGGCTTCTAGCAGCGATGGCAAAGCTGCCATG	3849	0	UF_Msa_AF_101265	contig19165___1rc_nrnt0	contig19165___1rc_nrnt0	Unknown	
4025	50	7	unmapped	0		0	CTCAGTGAGGGAGGAGGTGTAGTTGGGGAGGTGAATCAACTGAACAACCAATCAGTTGCT	3851	0	UF_Msa_CF_127595	contig23020___0rc	contig23020___0rc	Unknown	
4026	50	8	unmapped	0		0	AGCTGAACACCCTCATCTTTATTTGATCTTCCACCTTCGTCTGCCTCTCCCTGTTTATCT	3853	0	UF_Msa_AF_108974	contig29189___1_nr0nt1	contig29189___1_nr0nt1	Unknown	
4027	50	9	unmapped	0		0	CTCTTTCACCACCCCTATCACCTCTTCTGCTCTCTGCGTGTCCTCTCACACTTCACCATC	3855	0	UF_Msa_CF_119074	contig15499___0rc	contig15499___0rc	Unknown	
4028	50	10	unmapped	0		0	CTGGATGGAGCCACACTGACTCCACTGAGCACTCAAACTGGTACCAGAAACACGGCAGGG	3857	0	UF_Msa_AF_106690	contig10448___1_nr0nt	contig10448___1_nr0nt	Unknown	
4029	50	11	unmapped	0		0	TTGGAATCTTCTTCAGAAGAGGATCCAACAGAGACAAGAGGGACAGTAGGAACATGTGTG	3859	0	UF_Msa_AF_100212	contig29712___1_nr1nt0	contig29712___1_nr1nt0	Unknown	
4030	50	12	unmapped	0		0	AAGGTGATGGAGTTACAAATGTGAAGCAATCAGTGTCGTCTGCTCCAGGAGGATGTGAAA	3861	0	UF_Msa_CF_118357	contig07547___0rc	contig07547___0rc	Unknown	
4031	50	13	unmapped	0		0	CAGAGCAGGAAGCTGCAGCAGATGGACGCTCTGGTGGAAAAGAATTTGGCTTTGGAGTGG	3863	0	UF_Msa_CF_127420	contig17324___0	contig17324___0	Unknown	
4032	50	14	unmapped	0		0	TAGCTGCATGCCCACATTCCAGTTTTACAAGAATGGAGAAGAAGGTGGATGAGTTCTCTG	3865	0	UF_Msa_AF_109075	contig26341___1_nr0nt	contig26341___1_nr0nt	Unknown	
4033	50	15	unmapped	0		0	ATGCAGATATCCAAGTAGTCTGTGCAAAAGGCTCGGTAAGAATCACATGGAGGATCAACG	3867	0	UF_Msa_CF_117787	contig27228___0rc	contig27228___0rc	Unknown	
4034	50	16	unmapped	0		0	TTGACAACTACTGCATCTTCCAGATGGCTGTGGCCTCTACTAACTTCTACCACACCGCCT	3869	0	UF_Msa_AF_104196	contig15538___1rc_nrnt	contig15538___1rc_nrnt	Unknown	
4035	50	17	unmapped	0		0	CACATATGGACCAGAGAATGATACATGATTGTAATTATGAACAGTTTAAACTGACCCACG	3871	0	UF_Msa_AF_100504	LMB_S454.390.C1___1rc_nr0nt1	LMB_S454.390.C1___1rc_nr0nt1	Unknown	
4036	50	18	unmapped	0		0	GTTCTATACTTATTAGCTTAAAACCAGCAACCCGTTCCAGGAAATACCAAACACCTTGGT	3873	0	UF_Msa_AF_103954	LMB_S454.sd.143.C1___1_nr0nt1	LMB_S454.sd.143.C1___1_nr0nt1	Unknown	
4037	50	19	unmapped	0		0	AGCAGCACTTAAAATTTTTTATACACGTTTACCAGAGCAACCCTGTAAGCGTCAAACTCA	3875	0	UF_Msa_AF_109121	contig32812___1_nr0nt	contig32812___1_nr0nt	Unknown	
4038	50	20	unmapped	0		0	AACGCCATTTCTGAAGGTGTGGTTCATGCAGACCTGAAGTTGTTCCTAGAGACAAATCTG	3877	0	UF_Msa_AF_106566	LMB_S454.77.C1___1rc_nrnt	LMB_S454.77.C1___1rc_nrnt	Unknown	
4039	50	21		1028	E1A	0		1348	1	(+)E1A_r60_a20	E1A_r60_a20	E1A_r60_a20		CONTROL
4040	50	22	unmapped	0		0	ATTGTCAAACTAATATTGTGTTACCATTCAGTGTTTTCTATTCTATGCAGACTGCACACG	3880	0	UF_Msa_AF_109302	contig28491___1_nrnt0	contig28491___1_nrnt0	Unknown	
4041	50	23	unmapped	0		0	ACTTCCTTCAGCCACCTCAGACTGGAGTGCTGAGCCAAAAGCATTACACTGAATCCAGCC	3882	0	UF_Msa_CF_120981	contig18956___0rc	contig18956___0rc	Unknown	
4042	50	24	unmapped	0		0	GAGAACATCCATCCAGTAGATCCACATGCAGTGGCTGTTTTTGATGACTCTGGTAAGCAT	3884	0	UF_Msa_CF_127829	contig27753___0	contig27753___0	Unknown	
4043	50	25	unmapped	0		0	AGAGAAGTGACAGTGTTCACACCTGCACGGAGGACAGGGGGCCTCTTGGTAGGAGTATCT	3886	0	UF_Msa_AD_200306	LMB_Add_30	LMB_Add_30	Unknown	
4044	50	26	unmapped	0		0	TTATGGACTAACTGCCACACAGAGTCCAGCATCCAGCACCTCAAAATGATTTGGACTCTT	3888	0	UF_Msa_AF_105536	contig29271___1rc_nrnt-1	contig29271___1rc_nrnt-1	Unknown	
4045	50	27	unmapped	0		0	AAGCCGGAGAGACTCCAGACCCCCGAACCCCACAGGCGCAGTTATCGAGACAACGACAGA	3890	0	UF_Msa_CF_122393	contig23026___0rc	contig23026___0rc	Unknown	
4046	50	28	unmapped	0		0	ACGAGGCCCTGGTGGCTTCAGGTGGCTGCTGTGGCTCCGATCAGAAGACCTATGTTGTGG	3892	0	UF_Msa_AF_104904	contig00975___1_nrnt	contig00975___1_nrnt	Unknown	
4047	50	29	unmapped	0		0	ATCAGAAATAAAAGCAGCTTCTGGTTGATCGATAAACGCGGACATGCCGTCGCTTCTGTT	3894	0	UF_Msa_AF_102242	LMB_S454.419.C1___1_nrnt	LMB_S454.419.C1___1_nrnt	Unknown	
4048	50	30	unmapped	0		0	TTACAGTCGTTAAGTACAATAATGGCTTCGAGTGCGGCTGCAGAGGAAGTACAGAAGACT	3896	0	UF_Msa_AF_106176	LMB_S454.463.C1___1_nr0nt	LMB_S454.463.C1___1_nr0nt	Unknown	
4049	50	31	unmapped	0		0	ATGCCTGGTGGCAGACCTGGTGGTGTTTAACTCCGCCTTCAACATGGACTCCTTCCTGTC	3898	0	UF_Msa_AF_110193	contig08527___1_nrnt	contig08527___1_nrnt	Unknown	
4050	50	32	unmapped	0		0	CGGCGTGCGTGCTCTACGTCATGACGCACAGCTGCTAGGGTTTTCTCACCCTGCCCTTCT	3900	0	UF_Msa_CF_122931	contig14231___0	contig14231___0	Unknown	
4051	50	33	unmapped	0		0	TACTGGGCTTCACAGAGAAGCTGAGCAGCAAGAACGCCCAGCTCCAGTCAGAGAGCAATG	3902	0	UF_Msa_AF_101738	contig10032___1_nr0nt	contig10032___1_nr0nt	Unknown	
4052	50	34	unmapped	0		0	CAGAGAGGGGATGTTTCCCGGAAACTACGTGGAGAAGATTTAGACTTCCTCTCCGGGGGG	3904	0	UF_Msa_AF_103848	contig05043___1_nrnt0	contig05043___1_nrnt0	Unknown	
4053	50	35	unmapped	0		0	TTTACTGTTAAAATCACCGCGCATCGATAGTCTTCTGAATGTGTATTAAAAAACACGCAG	3906	0	UF_Msa_CF_127276	contig16726___0	contig16726___0	Unknown	
4054	50	36	unmapped	0		0	AGTAGAGCGATAAATTGGCATCGTGATGTCTCACAACATAACGCCAAACGTCCACTGACT	3907	0	UF_Msa_CF_125086	contig02392___0	contig02392___0	Unknown	
4055	50	37	unmapped	0		0	CCACTCATATTCTGCATTGCACAATGTTGGACTTTAAATGATGCAGTATAAAAACTGTCA	3909	0	UF_Msa_AF_108879	LMB_S454.3.C1___1_nr1nt0	LMB_S454.3.C1___1_nr1nt0	Unknown	
4056	50	38	unmapped	0		0	TTTAGTGACCTACTTTCTGGACCCAGACACTAGGCAGGGTTCGTGCTCGGCAGGTGAGGT	3911	0	UF_Msa_CF_124630	contig16974___0rc	contig16974___0rc	Unknown	
4057	50	39	unmapped	0		0	GCCGAGGAGAAGAAGAAGTAGAACCATTGGAGGAAGCAGCTACGTGCTCTCCGGCACGTT	3913	0	UF_Msa_CF_119964	contig20028___0	contig20028___0	Unknown	
4058	50	40	unmapped	0		0	AAGAGTCTAGGTCCTTCCTGCAAATAGTGGGCATACGCTAGGGGTGGGTGAGAGGGAGGT	3915	0	UF_Msa_CF_122849	contig17805___0	contig17805___0	Unknown	
4059	50	41	unmapped	0		0	CTTCATTGCAGTGGGACTCTGACTGTCCACTTGTACATCATCTTTTGGATTAACTTTTTT	3917	0	UF_Msa_AF_101587	contig27648___1_nr0nt	contig27648___1_nr0nt	Unknown	
4060	50	42	unmapped	0		0	AATTTCGTAGCCTCTGGACGATTTTGGTTGCAGTAGCCATGTTTGCTGTTGTGAAGGACA	3919	0	UF_Msa_AF_104201	LMB_S454.120.C1___1_nr0nt1	LMB_S454.120.C1___1_nr0nt1	Unknown	
4061	50	43	unmapped	0		0	AATAGGTGTGGTTGAAGGTCTGCATGGAGCTGCCTACAAGAATGCTCTCTGTAACTCCCT	3921	0	UF_Msa_AF_104855	contig08489___1rc_nrnt-1	contig08489___1rc_nrnt-1	Unknown	
4062	50	44	unmapped	0		0	TTCGCCAACAAACAGGACTTACCAGGAGCCCTGTCAAAAGAGGCGATACGAGAGGCGCTG	3923	0	UF_Msa_AF_101522	contig28726___1_nrnt	contig28726___1_nrnt	Unknown	
4063	50	45	unmapped	0		0	ACAATCAATTTCACATGCGGTTGTGCAAATGGAATAGACAACGGGTGGAAATTATAGGCC	3925	0	UF_Msa_AF_107538	contig03071___1rc_nrnt-1	contig03071___1rc_nrnt-1	Unknown	
4064	50	46	unmapped	0		0	AGAATGAGAAGAGGGGACCCCATTGTAAGGGCTCAGATGTACCAGGTTCAGTCACATTTA	3927	0	UF_Msa_CF_127089	contig21003___0	contig21003___0	Unknown	
4065	50	47	unmapped	0		0	CGGCGCCCCATGCCGTGGTCGAAGTGGAGGGAGGCAGCAGTGAAACAGGGCTGCTTCTGT	3929	0	UF_Msa_CF_124569	LMB_S454.860.C1___0rc	LMB_S454.860.C1___0rc	Unknown	
4066	50	48	unmapped	0		0	TTCAGATAAAGACCCAAACCAACACAAGCGTGTATCTGTTCAGTCCAACCCTGGATTCCT	3931	0	UF_Msa_AF_101184	contig04139___1rc_nrnt0	contig04139___1rc_nrnt0	Unknown	
4067	50	49	unmapped	0		0	AATAAGCTACAAGCCCAACTTCAGGCACAGAAAGAAGAGCTAAATGTAGCCAAGGGACAG	3932	0	UF_Msa_AF_109406	LMB_S454.1018.C1___1_nrnt0	LMB_S454.1018.C1___1_nrnt0	Unknown	
4068	50	50	unmapped	0		0	TGGTGCAAGAGTGGATGGGAGAAGCTTCCCTGTAGCTGTTGAAGAATAAAGGAAGAGTTT	3934	0	UF_Msa_CF_127196	contig17613___0rc	contig17613___0rc	Unknown	
4069	50	51	unmapped	0		0	TAAAATCGCTTCAAAAAGGTATCGGACGGTGGACGCGCTGCTGCAGCGGATGTTCGAGGC	3936	0	UF_Msa_AF_106508	contig12105___1_nrnt0	contig12105___1_nrnt0	Unknown	
4070	50	52	unmapped	0		0	AGGTGAAAATATAGAGCTAACACTCGTTCAGACTGAAGAAACAGAAAGACCCGAGGGAGA	3938	0	UF_Msa_CF_127363	contig01150___0rc	contig01150___0rc	Unknown	
4071	50	53	unmapped	0		0	TGGTTGGAGTGGAGCTCAGAATTGAAATAAGAGGCTTAAGGAGACTCGTGGTCATTTCAA	3940	0	UF_Msa_CF_125779	contig20905___0rc	contig20905___0rc	Unknown	
4072	50	54	unmapped	0		0	ATCAGTGGTCAAAGTTTGGTGACGTGACAGCCAAACGGATCAGCTGTCATGCAGTGGCGT	3942	0	UF_Msa_AF_106087	contig09806___1_nrnt	contig09806___1_nrnt	Unknown	
4073	50	55	unmapped	0		0	CTTACAAGACGTGCTGTATGGAGAAATAAATCCAACTGGTGATGGTGGTGCATCTATTAC	3944	0	UF_Msa_CF_119061	contig01863___0	contig01863___0	Unknown	
4074	50	56	unmapped	0		0	ACCTAGCAGCCTAACTACCCTCCAGTATCACCAGCCCTGCTAGATGCTGACTGGGTAAAC	3946	0	UF_Msa_CF_120042	contig06679___0rc	contig06679___0rc	Unknown	
4075	50	57	unmapped	0		0	GACATGTCAGATGACAGTAACACGAGTCAGCACGGTGATCAGAACGACGGCGTGACATTA	3948	0	UF_Msa_CF_125098	contig29698___0	contig29698___0	Unknown	
4076	50	58		0		0		2905	1	ETG09_205211	ETG09_205211	ETG09_205211		CONTROL
4077	50	59	unmapped	0		0	CGCTCAAAACACTGAACATGTTTTAGCAAAATATTGACACCTTCAACATCACAATAGATG	3951	0	UF_Msa_CF_119876	contig15282___0rc	contig15282___0rc	Unknown	
4078	50	60	unmapped	0		0	ACGAGGAGAGAGCCAAGAGGACCCAGGACGAGTGCCAGCAGACGTGGTACCATGAAGGCT	3953	0	UF_Msa_AF_100159	contig05239___1_nrnt	contig05239___1_nrnt	Unknown	
4079	50	61		1028	E1A	0		571	1	(+)E1A_r60_a107	E1A_r60_a107	E1A_r60_a107		CONTROL
4080	50	62	unmapped	0		0	ACAGGCGAGAGCGCCCAATGGAATCCAAGCATGAGACATTTTGTATTGTTCCACATCAAA	3956	0	UF_Msa_CF_121099	contig22391___0	contig22391___0	Unknown	
4081	50	63	unmapped	0		0	AGGACCAGAACCCGGAGCAGCTGAGCCAGGAGGGAGGAGGAGACATGCTGCACCAGATCC	3958	0	UF_Msa_CF_120075	contig00990___0rc	contig00990___0rc	Unknown	
4082	50	64	unmapped	0		0	GGACATCATCCAGCACATCTACCACTGTGTGCACTGCAGTAACAGTTACACCAGTCTCTC	3960	0	UF_Msa_AF_100836	contig07906___1rc_nrnt-1	contig07906___1rc_nrnt-1	Unknown	
4083	50	65	unmapped	0		0	TTGTGTAGAACTCAGCGTCGCCTCGTTCTCCTCATAGATCTGCTTCTTTCCCTTTGTGCC	3962	0	UF_Msa_AF_102638	contig14239___1_nr0nt1	contig14239___1_nr0nt1	Unknown	
4084	50	66	unmapped	0		0	CCTTCTTCAAGAATTCAAACAATCCAGTGTACCGCAGAATCTATGAACACATGGAGAGAA	3964	0	UF_Msa_AF_106518	contig26846___1_nrnt0	contig26846___1_nrnt0	Unknown	
4085	50	67	unmapped	0		0	AGTGTACCTGGCCACGATAGCAGACTCCAATCTAGAACATGCAGTCTCTCCTCCCTGCTC	3966	0	UF_Msa_AF_107145	contig06671___1rc_nrnt	contig06671___1rc_nrnt	Unknown	
4086	50	68	unmapped	0		0	TACTGCATCCAGGCACTGCCTGAGTTTGATGGAAAGCGCTTCCAGAACGTGGCAAAGGAG	3968	0	UF_Msa_AF_107848	contig05735___1_nrnt	contig05735___1_nrnt	Unknown	
4087	50	69	unmapped	0		0	CTCGGTCCTGGCCAACGGGATGAGGATCCTGGGCATCACACCGGTTGATAAAATGTGAAA	3970	0	UF_Msa_AF_102593	contig17480___1rc_nrnt	contig17480___1rc_nrnt	Unknown	
4088	50	70	unmapped	0		0	CGCCGCCAACACAGTTGTTAAAGTGAAACAAGTGCTGGGGAGAAGCTTTGGTGATCCAGA	3972	0	UF_Msa_AF_104152	contig02505___1rc_nrnt	contig02505___1rc_nrnt	Unknown	
4089	50	71	unmapped	0		0	TCTCTGTAGAGACAGCAAAGATGGAGACTGCTCACTGAAAAGAGTGGGAGAGGTAGATTA	3974	0	UF_Msa_CF_119736	contig29017___0rc	contig29017___0rc	Unknown	
4090	50	72	unmapped	0		0	ATATCTGTTGCTGTAGTTTGCATTCAGATGTTGCCACACTGGACTGTTGCTGTCAGCCAT	3976	0	UF_Msa_AD_200169	EU555403_rc	EU555403_rc	Unknown	
4091	50	73	unmapped	0		0	CAAATGTTACATCTGACATGCTCGGAGCTCTCAAATCATTCAAATGAATGATGAAACAAT	3978	0	UF_Msa_CF_123286	contig14212___0	contig14212___0	Unknown	
4092	50	74	unmapped	0		0	CCTTCCTACCCTGGGTGCTGATGGGATTCTCACTTCTTCTGGCAACTCCATCATCGTGGA	3980	0	UF_Msa_AF_102930	contig24635___1_nrnt	contig24635___1_nrnt	Unknown	
4093	50	75	unmapped	0		0	GCATTATGTCAGAATGTGTGTCAACATATTTGTCCCAGATCAGTCAAATGTTAAGCGAAA	3982	0	UF_Msa_CF_120349	contig32831___0rc	contig32831___0rc	Unknown	
4094	50	76	unmapped	0		0	TGTGATGCCTGCCTCACTCCGAGACCTGAGGTCCACAAAGTGATCAGCGCTGATGCATCA	3984	0	UF_Msa_AF_103310	contig24982___1rc_nrnt0	contig24982___1rc_nrnt0	Unknown	
4095	50	77	unmapped	0		0	AAGTTTCTTCTCTCTGCTGAGTGCCACTTTGATCTTGGCAAGGGCAGCTTTCAACAGTTT	3986	0	UF_Msa_CF_118557	contig05931___0	contig05931___0	Unknown	
4096	50	78	unmapped	0		0	ATTTGTTCTATACTCTGCCCCTGCTCACTGTCTTCATCTATGGCCTGAAAACACCTGGAT	3988	0	UF_Msa_AF_104932	contig09077___1rc_nr1nt0	contig09077___1rc_nr1nt0	Unknown	
4097	50	79	unmapped	0		0	GCAGGAGGAAGTTAGTGCGCAACCGTTTCACCATAGACACGGACATTGTTTTTGATGGTG	3990	0	UF_Msa_AF_101539	contig03561___1rc_nrnt0	contig03561___1rc_nrnt0	Unknown	
4098	50	80	unmapped	0		0	CAAAAACAGCAAAGACATGAACCAGGAGGAGGAGCTGCTGCTGTTCCAGGAGAGGAGTCT	3992	0	UF_Msa_CF_119607	contig14041___0	contig14041___0	Unknown	
4099	50	81	unmapped	0		0	TGGTGTTCGCTCAGTTCATCATAGCCAATAAGGACATGGAGCCGGAGCTGGTGTGTATGG	3994	0	UF_Msa_AF_107026	contig14135___1rc_nrnt	contig14135___1rc_nrnt	Unknown	
4100	50	82	unmapped	0		0	CAGCTTTCTTCTTAAACTGACTTTGTGTCTGTGTATTTTACTTCAACTGTTTCCAGACTG	3996	0	UF_Msa_AF_100209	LMB_S454.sd.159.C1___1_nr1nt0	LMB_S454.sd.159.C1___1_nr1nt0	Unknown	
4101	51	1	unmapped	0		0	AACCACCTCTCCTGATTTACAAGAGGACATCCCTTCTGAGGACTGGGAAGCAGCATGAAG	3997	0	UF_Msa_CF_119980	contig05874___0rc	contig05874___0rc	Unknown	
4102	51	2	unmapped	0		0	CGCCAACTGCCATCAGAGGGACTTTGTGCTGATCAGCAATAAAACCACCGAGGATGAGGA	3999	0	UF_Msa_AF_102877	contig16700___1_nrnt	contig16700___1_nrnt	Unknown	
4103	51	3	unmapped	0		0	TTGGGAAGAGTGCTGCGACTGCGTGGGATGTGTAACCCCAAGAACTACAGCGACTCTCCA	4000	0	UF_Msa_AF_102687	contig16185___1rc_nrnt	contig16185___1rc_nrnt	Unknown	
4104	51	4	unmapped	0		0	TGGAGGACGACCCCTGCTCCGACTACATCAACGCCAGCTACGTACCTGGTAATAACTACC	4002	0	UF_Msa_AF_101308	contig21582___1rc_nrnt	contig21582___1rc_nrnt	Unknown	
4105	51	5	unmapped	0		0	ATACAATCAGCTCATGAGGATTGAGGAAGAGTTGGGTGACCAGGCCCGCTTCGCTGGGCA	4004	0	UF_Msa_AF_108215	LMB_S454.sd.466.C1___1_nrnt	LMB_S454.sd.466.C1___1_nrnt	Unknown	
4106	51	6	unmapped	0		0	TAGAAAGCACTTTGACACTAAAGCCCACCCCTCTGTATTCTCTAACCAGGTAGCAACAAA	4006	0	UF_Msa_CF_120768	contig30379___0rc	contig30379___0rc	Unknown	
4107	51	7	unmapped	0		0	TCCATGGAGAAAACGCTCGATTTAAGAGGTGTGAAACTCTGTTTAAACAAAGAGTTTCCT	4008	0	UF_Msa_CF_119866	contig24080___0rc	contig24080___0rc	Unknown	
4108	51	8		0		0		3751	1	ETG08_142674	ETG08_142674	ETG08_142674		CONTROL
4109	51	9	unmapped	0		0	CTGGTGTGTGCCGCCGTGTGGCTGACCATCGTAGGCGGGGGGATATCAGTGACCTTCTTC	4011	0	UF_Msa_AF_101763	contig09764___1rc_nrnt0	contig09764___1rc_nrnt0	Unknown	
4110	51	10	unmapped	0		0	CTGGATCCTTGACAGTGGGGCTGCAACTAACAATTATTTTCATTAAAGATTAATCTGCAG	4013	0	UF_Msa_AF_101240	contig19679___1_nr0nt	contig19679___1_nr0nt	Unknown	
4111	51	11	unmapped	0		0	GGTGAAGGCACATCATGCAATGAAATTCAACCACATATGTGACCAGACACGTTTCAAGAG	4015	0	UF_Msa_AF_100462	contig16952___1_nrnt	contig16952___1_nrnt	Unknown	
4112	51	12		0		0		2515	1	ETG10_234183	ETG10_234183	ETG10_234183		CONTROL
4113	51	13	unmapped	0		0	AACTGGAGAGAGAAAATTCAACAACTGTGGATGAATGGGATGTTGCTAACATAGCCGAGA	4018	0	UF_Msa_CF_119284	contig14550___0	contig14550___0	Unknown	
4114	51	14	unmapped	0		0	GCAGGATGCTTCTGAGGAAGAGGTGGACAACGAAAGCAGTGAAAAGGACTCTGACTGCAT	4020	0	UF_Msa_CF_117800	contig08768___0	contig08768___0	Unknown	
4115	51	15	unmapped	0		0	TATCCTGCATCTGGTCACCATGGCACACATATTGCAGATCCTCCTGTCTTCTACAGATTT	4022	0	UF_Msa_AF_104832	contig18715___1rc_nrnt0	contig18715___1rc_nrnt0	Unknown	
4116	51	16	unmapped	0		0	CTGTCAGACCTTTAAATTCCCTTTTGTGAGTCCTGTATTGTATCATTGCATTATTACGTA	4024	0	UF_Msa_AF_101002	contig28892___1_nrnt	contig28892___1_nrnt	Unknown	
4117	51	17	unmapped	0		0	TTCTTGAAGTACTCTCCAAACTGGGTGTTGGTACCAACTGAAGTGCCATGCTATCTTACC	4025	0	UF_Msa_CF_124070	contig30505___0	contig30505___0	Unknown	
4118	51	18	unmapped	0		0	TGAAGTACTTTCCGGAGAGGCGACTCTTTGGCGTGCGGTCCTAGGCCGATTTCTTGTTGG	4027	0	UF_Msa_CF_118428	contig03541___0	contig03541___0	Unknown	
4119	51	19	unmapped	0		0	AAGTTATGACAGAAGCTCTTATTTCTCAGAGACTCCAAACGGCGGTCTGAAAAGTGACCG	4029	0	UF_Msa_AD_200355	EU367961	EU367961	Unknown	
4120	51	20	unmapped	0		0	AAGTGAAGGCATCACTGACAAAAATCCTTTGCCCAGATCTAACGCTGAAGTACACAGCTG	4031	0	UF_Msa_CF_127086	contig12579___0	contig12579___0	Unknown	
4121	51	21	unmapped	0		0	CTCTGAATGTGAATTAAAGCAAAATTAGTTTCTTCATCCGGTCCTCAGGAGTTCAACCCC	4033	0	UF_Msa_AD_200302	LMB_Add_32	LMB_Add_32	Unknown	
4122	51	22	unmapped	0		0	TTTTAGAGCCTTTTTCCGCCTACCCACAATGCAACAACGGATCAACGAAGTACTTCCTGT	4035	0	UF_Msa_CF_127637	contig05603___0rc	contig05603___0rc	Unknown	
4123	51	23	unmapped	0		0	CTGCACAGATCAGCTAGAGGCAAAATAGATCTCGATCTGGCTCAGTCTTTCTTCCCCGGT	4036	0	UF_Msa_CF_120779	contig17587___0rc	contig17587___0rc	Unknown	
4124	51	24	unmapped	0		0	ACTGCATTGATGGCTACTTCAACGAAGTGAGGAACAACACCTTTTCTCTGTGCACAGAGT	4038	0	UF_Msa_AF_104052	contig28355___1rc_nrnt	contig28355___1rc_nrnt	Unknown	
4125	51	25	unmapped	0		0	TTGGCTGTGTGCTTTACTGCATGATGATGTTGGAAGGGCCGTATGACATGGTATTCAGAA	4040	0	UF_Msa_AF_105773	contig00162___1rc_nrnt0	contig00162___1rc_nrnt0	Unknown	
4126	51	26	unmapped	0		0	GCCGCCAAGAGCAAATAACTCCCACTGAGGTGGTTTTTGCTGTTCTCTAACCTGTGCCCT	4042	0	UF_Msa_CF_125936	contig29748___0rc	contig29748___0rc	Unknown	
4127	51	27	unmapped	0		0	ATTATGTGTAGTGACTAGGCCTGAGGAGTGAACTCCTGGATTGTGATGGATTAGTGAAGC	4044	0	UF_Msa_CF_125467	contig04780___0	contig04780___0	Unknown	
4128	51	28	unmapped	0		0	TCTCCCTGGCCTAGGGGGTTCATCTCTCCTGGGCTTCACTTCAAAGTAGAGACCCTCCAT	4046	0	UF_Msa_CF_119075	contig05487___0	contig05487___0	Unknown	
4129	51	29	unmapped	0		0	GAAGACTGTTGTAAACATCCCTAACAGAAGGATTTTCTGACTCGTTTCAATAAAAACATG	4048	0	UF_Msa_CF_125987	contig27666___0	contig27666___0	Unknown	
4130	51	30	unmapped	0		0	AAGCAGGTGCACAACGCAGGGAAATCACAAATACGAGACGAATGACGGCATAGCATATGG	4050	0	UF_Msa_CF_125443	contig09712___0	contig09712___0	Unknown	
4131	51	31	unmapped	0		0	CGCAAATCCAGACATTGCAATGTGAAATACAGATCAATTGAAGCGCAATATTACAGTAAA	4052	0	UF_Msa_AF_107265	LMB_S454.sd.558.C1___1rc_nrnt-1	LMB_S454.sd.558.C1___1rc_nrnt-1	Unknown	
4132	51	32		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
4133	51	33	unmapped	0		0	AGGTGAACAGCATGGTGGCGTACAAGAGGACTGATTCAGTTTAAATCCCTAAACCATGGT	4055	0	UF_Msa_AF_101904	contig10409___1_nr0nt1	contig10409___1_nr0nt1	Unknown	
4134	51	34	unmapped	0		0	CTCGGAGCTGCTGGAGAAGAACTTGCTGTGTGTGACGGAAAACGCAGATCAGGAGCATCA	4057	0	UF_Msa_CF_126467	contig21595___0rc	contig21595___0rc	Unknown	
4135	51	35	unmapped	0		0	AGATATGAGGCAGTTAAAGACCTTCTCCAGAAACCTGCGACTGTGCTCATTTTCCTTGGA	4059	0	UF_Msa_AF_101567	contig21037___1rc_nrnt0	contig21037___1rc_nrnt0	Unknown	
4136	51	36	unmapped	0		0	TTGTTGTTGCGCACAGCCCCTGCACCCTGGGCAGAGTTGGAGTTTGCCAACATTATCCTT	4061	0	UF_Msa_AF_104431	contig00275___1rc_nrnt0	contig00275___1rc_nrnt0	Unknown	
4137	51	37	unmapped	0		0	AGTAGTGGAAAACAAACCCAAAGACCCCGATAATAAAACCACACCTGCATGCACACGACA	4063	0	UF_Msa_CF_120340	contig08724___0rc	contig08724___0rc	Unknown	
4138	51	38	unmapped	0		0	ACAGTGAGTCGTTTGACACTGAACATACTCCACCAGCACACGAAGAAGACATCAATCGAA	4065	0	UF_Msa_CF_120448	contig14539___0	contig14539___0	Unknown	
4139	51	39	unmapped	0		0	TTTAACACCAATAATATGACACCTGCACGGGCTGAGAGGTTTGTCTTATAACAAACTATG	4067	0	UF_Msa_CF_120542	LMB_S454.sd.292.C1___0	LMB_S454.sd.292.C1___0	Unknown	
4140	51	40	unmapped	0		0	TGGCATCATCCTCAGCCTTCCTGTGGGCATCAGCCTCCTCCTTTCTCTGTCGCTCAGCCT	4069	0	UF_Msa_AF_108497	contig14074___1_nr0nt1	contig14074___1_nr0nt1	Unknown	
4141	51	41	unmapped	0		0	TTTGTAAAGCCAACCTACACTGAACAGCTCCAGATAAAAACGTATGTGAAGCGCTCAGCA	4071	0	UF_Msa_AF_102802	contig01412___1rc_nrnt-1	contig01412___1rc_nrnt-1	Unknown	
4142	51	42	unmapped	0		0	ATGTATGGAGTGGCGTGACACAGCCTGAGTGTTGTACATAATTATGATATCCGCAAAAAA	4073	0	UF_Msa_CF_118150	GP3-1A11.g___0rc	GP3-1A11.g___0rc	Unknown	
4143	51	43	unmapped	0		0	AGGAGCAGTCGGGTCCGTTCATCTGGGTCCAGTCCAAGGAGAAGTTGACTGACTATAGGA	4075	0	UF_Msa_CF_119911	contig16179___0	contig16179___0	Unknown	
4144	51	44	unmapped	0		0	AGATCTTCTCTGCGCTCGCCTTCTCGTTCTCCACCGTCCTCTGGATGTTTTCCGTCAGGC	4077	0	UF_Msa_AF_108020	contig03440___1_nr0nt1	contig03440___1_nr0nt1	Unknown	
4145	51	45	unmapped	0		0	AGCTGCCAGATCAGCGTGTTCAAGGCGGTCATGTACATTGTGGCCCAGATGCTGGGTTCA	4079	0	UF_Msa_AF_101188	contig25804___1_nrnt	contig25804___1_nrnt	Unknown	
4146	51	46	unmapped	0		0	AAGACAAAAACATGTGATGCAAGCCAAACTCACGGCGCTGGAATCTCAAGCTTACAACCT	4081	0	UF_Msa_AF_104425	contig25540___1_nrnt0	contig25540___1_nrnt0	Unknown	
4147	51	47	unmapped	0		0	CAAGGCAGCTGAAACCAAGCCTTTTAAGAGAAACTTAAAAGCAGAGGATAAGAAGATCAA	4083	0	UF_Msa_CF_122807	contig14367___0	contig14367___0	Unknown	
4148	51	48	unmapped	0		0	ATGTACAACCTGGTGCAGTTTCTGGGATTCTCCTGGATCTTTGTCAACATGACTGTTCGA	4085	0	UF_Msa_AF_109741	contig23001___1rc_nrnt	contig23001___1rc_nrnt	Unknown	
4149	51	49	unmapped	0		0	CCTCGTAAATGCCAAAACTCTGGTCAGAGGGGATATTAAGAGACGTTTGAAGTTTGATAG	4087	0	UF_Msa_CF_125355	contig17422___0	contig17422___0	Unknown	
4150	51	50	unmapped	0		0	GAAAACACAAAACTGCTAAAACCGTTGAAACACTTCCAACAAACGTCTTCTTCAGCCTGG	4089	0	UF_Msa_CF_122061	contig20735___0rc	contig20735___0rc	Unknown	
4151	51	51	unmapped	0		0	TATGACATCATGAGGAGGTGAAGGGCCCACCTCTTCCCACTTATGGCATTAAAAACAAGT	4091	0	UF_Msa_CF_117742	contig03919___0	contig03919___0	Unknown	
4152	51	52	unmapped	0		0	TTTTCATAAATTAAAGACAGTCACTTGAACTCTCCTTGCCCCTGTTACGCACACAAGCCA	4093	0	UF_Msa_CF_126657	contig32385___0	contig32385___0	Unknown	
4153	51	53	unmapped	0		0	GACATCTATGGACAATCCTTAAAATGTCGAAATTTATGTAAGAAACGTGTCCCTTGATTG	4095	0	UF_Msa_AF_109728	contig01147___1_nr0nt	contig01147___1_nr0nt	Unknown	
4154	51	54	unmapped	0		0	AATGTTGGCCCAGCTAATGACAGACCTTTACAAGATGCCAGAAGGTGCAGGGCTACTGAA	4097	0	UF_Msa_CF_122238	contig07353___0rc	contig07353___0rc	Unknown	
4155	51	55	unmapped	0		0	CACTAGGAGGTACCACTGGACAAGGCCAGGCAGGTGCTAAAGATCATCGCTGGATATAAA	4099	0	UF_Msa_AF_110140	contig26383___1_nr0nt	contig26383___1_nr0nt	Unknown	
4156	51	56	unmapped	0		0	GCCTTAGCAGCATCACAGCAGACATGGCATACACAGTGTCGGTGCTCACAGACTCTGTTA	4101	0	UF_Msa_AF_108561	contig29521___1_nr0nt	contig29521___1_nr0nt	Unknown	
4157	51	57	unmapped	0		0	TGAAGTGTGTATCAGCAGCCACGTGGGAAGATGAAGAGGCTAATTCACAGGTGGAAAAAA	4103	0	UF_Msa_CF_123619	contig05262___0	contig05262___0	Unknown	
4158	51	58	unmapped	0		0	CACCTCTCATTGTTGAGAGGTCCTAAAGTAATTACAATGTGATCTTTTAATAGCTTCTGT	4105	0	UF_Msa_AF_105023	contig32099___1rc_nrnt-1	contig32099___1rc_nrnt-1	Unknown	
4159	51	59	unmapped	0		0	TAATGTCAGGATGAGTCTCAGGTCAAGTCTATGTCAAGTCACTGTGTGTGTAGACTCAAG	4107	0	UF_Msa_CF_119203	contig19785___0	contig19785___0	Unknown	
4160	51	60	unmapped	0		0	TAAAAAGGAGTTTGACAAGAAATATATCCGACCTGGCACTGCAAAGGGGAAGAAAAGCCT	4109	0	UF_Msa_AF_103728	contig29601___1rc_nr0nt	contig29601___1rc_nr0nt	Unknown	
4161	51	61	unmapped	0		0	TATAGCCACTGTTGAAGACTTAGTGGCTATAGTGCTGGTTGGAGTTGAGTCCTACAGTTG	4111	0	UF_Msa_CF_126202	contig12871___0	contig12871___0	Unknown	
4162	51	62	unmapped	0		0	CAGCACTTTGTGTAAATGTCATTGACCTGATTGATTATCCAACCTGTGTTCTTGGAACGA	4113	0	UF_Msa_AF_110107	LMB_S454.sd.620.C1___1rc_nrnt	LMB_S454.sd.620.C1___1rc_nrnt	Unknown	
4163	51	63		0		0		490	1	RC12	RC12	RC12		CONTROL
4164	51	64	unmapped	0		0	TCAAATCTAAAGGCCAGAAAGGCAAGTCGGGTTTTAAGAAGAAAGGTGCAGGAGCAAAGC	4116	0	UF_Msa_AF_105584	contig30937___1_nr0nt	contig30937___1_nr0nt	Unknown	
4165	51	65	unmapped	0		0	AGTAGTGTACTGTACCGCATGTCACGTGTACAACCCATCACTTGTTTTGTTGCCTTTTTT	4118	0	UF_Msa_AF_106551	contig20246___1_nr0nt1	contig20246___1_nr0nt1	Unknown	
4166	51	66	unmapped	0		0	GAATAAACTCGAGAAGGAAGAAATAAACTCGAATCTGCAGAGAAACAGAAGCCTGTGCAA	4120	0	UF_Msa_CF_127688	contig31557___0rc	contig31557___0rc	Unknown	
4167	51	67	unmapped	0		0	AGAAACTCAGTGTGGCAAGCTCCGTCTCATCTCATCAGAAAGTCTAGGATTTGTGAGTGA	4122	0	UF_Msa_CF_124102	contig12046___0rc	contig12046___0rc	Unknown	
4168	51	68	unmapped	0		0	TCAGAAAGTCAGATAAGTCTTGCACTGCAGAGAGCTCACGTTTTATACTTTCCCAGCTCC	4124	0	UF_Msa_CF_122993	contig19490___0rc	contig19490___0rc	Unknown	
4169	51	69	unmapped	0		0	CCCCTTGACCAATGTTACAAAGCTTCCTCTCATGGCGGCCGCCATCGTCACAAGCACGCC	4126	0	UF_Msa_AF_102086	LMB_S454.429.C1___1_nr0nt	LMB_S454.429.C1___1_nr0nt	Unknown	
4170	51	70	unmapped	0		0	TGAACAGGACATGGCTGACACCTACATTAACAGCAAAGGAGAGTTGATTGTTCGTCACCT	4128	0	UF_Msa_AF_100060	contig16292___1_nr0nt1	contig16292___1_nr0nt1	Unknown	
4171	51	71	unmapped	0		0	AGCCACATGACTGGCCCGGTGGTGGACAATGAGAAGTGTTACCCTCCTCCAAGCGTCCAG	4130	0	UF_Msa_AF_100555	contig22727___1_nrnt0	contig22727___1_nrnt0	Unknown	
4172	51	72	unmapped	0		0	ATAAAATAACAGTAGCCGCAGCCAACATGCTTGTGTTATTTGAGACCGCCGCTGGATATG	4132	0	UF_Msa_CF_127542	contig29774___0rc	contig29774___0rc	Unknown	
4173	51	73	unmapped	0		0	AAGAAGACTACTGAGCATGAAAAAGTGACGAAAGATCCCACTGTCAACAGTCTGGAGCTG	4134	0	UF_Msa_CF_118169	contig05710___0rc	contig05710___0rc	Unknown	
4174	51	74	unmapped	0		0	AAGACCAACCAATGTGAAAAAGGAGGGTCCACTGTTCGTCTAGATGCGATGGTATCAGTT	4136	0	UF_Msa_AF_105389	contig29810___1rc_nrnt	contig29810___1rc_nrnt	Unknown	
4175	51	75	unmapped	0		0	CAGATTGTCCTATACAGTATGATTTGTAATTGAACAAGACCATGGAAAGTGAAGGGTTAA	4138	0	UF_Msa_AF_107016	contig07411___1_nr0nt	contig07411___1_nr0nt	Unknown	
4176	51	76		1028	E1A	0		853	1	(+)E1A_r60_a97	E1A_r60_a97	E1A_r60_a97		CONTROL
4177	51	77	unmapped	0		0	AACATTCAGATTGTTGTTCAGAGCTGGATGCCTTTCTTCAAACCCTTGATGAGCTGACCA	4140	0	UF_Msa_CF_122607	contig03175___0	contig03175___0	Unknown	
4178	51	78	unmapped	0		0	GTCATCTGGTGGAGTGTACGCTCTGGTCTCAGCACATTTGGCCAATGTAGTAATGAATTG	4142	0	UF_Msa_AF_109208	contig09066___1rc_nrnt0	contig09066___1rc_nrnt0	Unknown	
4179	51	79	unmapped	0		0	TCCTCCGAGCTCTCCTCTGGCCAGAGGAGCTGACAAACGCCAAAGGCAAACCCATGCTGG	4144	0	UF_Msa_CF_124446	contig16740___0rc	contig16740___0rc	Unknown	
4180	51	80	unmapped	0		0	GTACCTGATCAGAGGGACGTTCGTGTTTCTGATGAATCAGTTTAATAATAAAACTAAATC	4146	0	UF_Msa_CF_121925	contig20363___0rc	contig20363___0rc	Unknown	
4181	51	81	unmapped	0		0	TTCCCAAAACCTGATCCCTGGGTACAGTGGGCCAGTGAACTGGGTCTGGTGACAGTAGAT	4148	0	UF_Msa_CF_125323	contig07250___0	contig07250___0	Unknown	
4182	51	82	unmapped	0		0	TAGCATTCGGGAGAACCCAGTGCATGAAAAGAAGCCTCCCAAAGAAGTCAAAAAGAAGAG	4150	0	UF_Msa_AF_104603	LMB_S454.sd.88.C1___1_nrnt	LMB_S454.sd.88.C1___1_nrnt	Unknown	
4183	52	1	unmapped	0		0	TCGTTTCAGATTTCAAGCAGAGGAGCAATGACTCAGGAAATTATGAACTCTATTTCCGCC	3998	0	UF_Msa_CF_118727	contig08095___0rc	contig08095___0rc	Unknown	
4184	52	2		1028	E1A	0		42	1	(+)E1A_r60_n11	E1A_r60_n11	E1A_r60_n11		CONTROL
4185	52	3	unmapped	0		0	TTGTATGGGAGGGTAAGGCCAAAGAAAAGAGCCTCTTTTCTTTTTCCTTTTTATTTGTTT	4001	0	UF_Msa_AF_103676	contig12041___1_nr0nt1	contig12041___1_nr0nt1	Unknown	
4186	52	4	unmapped	0		0	GCCTTCCGCATCATCCGAGAAGCGTACCGTAAATACGTGGCTGCTCATGGATTTCCAAAC	4003	0	UF_Msa_AF_106926	contig05339___1_nrnt	contig05339___1_nrnt	Unknown	
4187	52	5	unmapped	0		0	TCCAAAACTCCGGGTCACACAAAGAAGATGAATTTCTTCAGAGTGGGCAAAGTTTTCACC	4005	0	UF_Msa_AF_104345	contig13749___1_nrnt	contig13749___1_nrnt	Unknown	
4188	52	6	unmapped	0		0	AAGTGAGGCACCTCCTTCAACTGTACCCACTTTATCACTTCAGCAAACACTAGAAGCAGA	4007	0	UF_Msa_CF_127727	contig03343___0	contig03343___0	Unknown	
4189	52	7	unmapped	0		0	CTGGAGCAGCTGAAGCAAAGAAGACAGAAGTGTCTCTTGACCTGGAGGTTGTTATGAAGT	4009	0	UF_Msa_CF_123974	contig19146___0	contig19146___0	Unknown	
4190	52	8	unmapped	0		0	TAAAAAGACAAACAAATGTGGCTCTGCCCGGATGTGGAAAGGGAGGACTTTTGGTGTCAA	4010	0	UF_Msa_CF_127217	contig21399___0	contig21399___0	Unknown	
4191	52	9	unmapped	0		0	AAAGAATGAAGAGACGCTGAAAGCTTGTGCTCAGGACTATCTGGCACGGATCAAAAAGGA	4012	0	UF_Msa_AF_107923	contig10421___1_nrnt	contig10421___1_nrnt	Unknown	
4192	52	10	unmapped	0		0	TCTATCTGGACTTCTTGTTCGAAATTCCTTGTCCCTGGATGTTTGGCGCCTCTTATTCTC	4014	0	UF_Msa_CF_122660	contig31135___0	contig31135___0	Unknown	
4193	52	11	unmapped	0		0	AGACTCTGTTTGTAAAGCATCTAATCGGAGGCCCTCTGTGTACCTTCCAACTCGTGAATA	4016	0	UF_Msa_AF_108778	contig32196___1rc_nrnt	contig32196___1rc_nrnt	Unknown	
4194	52	12	unmapped	0		0	AAGAATGTGTGACGGCTCACAGAGAAGGGCAGGGTGAGAAAACCCTAGCAGCTGTGCGTC	4017	0	UF_Msa_CF_120782	contig21147___0rc	contig21147___0rc	Unknown	
4195	52	13	unmapped	0		0	CTTGACACTGCACTTAACAGTTTATACTCCACTCTGGACTATTTGTAATATATTTGACTG	4019	0	UF_Msa_AF_105392	contig27373___1rc_nrnt-1	contig27373___1rc_nrnt-1	Unknown	
4196	52	14	unmapped	0		0	CACACTCGACCCAAAAATTGCAATGTCTATTTTCTTAATGATCTTGTTGTAGACCAGATT	4021	0	UF_Msa_AF_110227	LMB_S454.sd.82.C1___1_nrnt	LMB_S454.sd.82.C1___1_nrnt	Unknown	
4197	52	15	unmapped	0		0	TGAAGCATACTTCTGAGTCTTTTTTATTGCGCAGAGAGTTGGTCCAGGTCATCATGGCTG	4023	0	UF_Msa_CF_122637	contig32662___0rc	contig32662___0rc	Unknown	
4198	52	16		0		0		1893	1	RC11	RC11	RC11		CONTROL
4199	52	17	unmapped	0		0	TACCCACAGCAGGAGGTAGAGGGTGTTTAAGTGGGGCGCTCCCTGGGGCGGGTGACGTAC	4026	0	UF_Msa_CF_120723	contig08232___0rc	contig08232___0rc	Unknown	
4200	52	18	unmapped	0		0	ACAAATCCTGCCACAACATCACAAGCGAGTGTCTGCCTAATCAGCGCTGTTCCAGCTCCA	4028	0	UF_Msa_CF_124789	contig19838___0	contig19838___0	Unknown	
4201	52	19	unmapped	0		0	ACCTTCATCCGTACATCCTGTCATGATTGCATACTGATGAGTTCTGATGTAGAATCAGGG	4030	0	UF_Msa_AF_107942	contig31285___1_nrnt0	contig31285___1_nrnt0	Unknown	
4202	52	20	unmapped	0		0	AGTGTCACTGTCCCCGGACGTCAGGAACCATAGTGTCCCGGCTCTGACTGACTGATCCCC	4032	0	UF_Msa_CF_120876	contig15285___0	contig15285___0	Unknown	
4203	52	21	unmapped	0		0	GTGCCGCACAGCTCACCGCTGAGTGTGCTGTTGTCACATTGGTAAGTGTGTCTATTTCAG	4034	0	UF_Msa_AF_100588	contig02273___1_nrnt	contig02273___1_nrnt	Unknown	
4204	52	22		130	HybridizationNegative	0		3178	1	(+)eQC-42	EQC	EQC		CONTROL
4205	52	23	unmapped	0		0	ATCTACCAAAAAATTGACCACAGTATGTCGGAGTTTCTGCAGTACCAGGACCAGACCTCA	4037	0	UF_Msa_CF_124611	contig05857___0rc	contig05857___0rc	Unknown	
4206	52	24	unmapped	0		0	TACCTGAGGAAAGACTTGTATCTTATTCCACTATCAAAGTGTGTGTACAGAGAAGCACAG	4039	0	UF_Msa_CF_126316	contig01228___0rc	contig01228___0rc	Unknown	
4207	52	25	unmapped	0		0	GAGATGAACCAAAATAAGTGTGGATGAGTTGTGATATAACAGGACACTTGCAATAATTGA	4041	0	UF_Msa_CF_117763	contig02466___0	contig02466___0	Unknown	
4208	52	26	unmapped	0		0	TTCAAAGAGCTGTATGAGAACCCGTGGACAATCCCCAACTTTTTGTGTGTGTGTCGGATT	4043	0	UF_Msa_AF_108961	contig10139___1rc_nrnt-1	contig10139___1rc_nrnt-1	Unknown	
4209	52	27	unmapped	0		0	GACAGCTTTGCACCATGCAGCACGAGTCAACATGGTGGACATGATCGAGCTGTTGGTGGA	4045	0	UF_Msa_CF_123583	contig01091___0	contig01091___0	Unknown	
4210	52	28	unmapped	0		0	TCCTTATGTAGCCGGTGTCCAATATCTGCGGTGTGGTCTGGAAGAAGCCTGTTGGTATGG	4047	0	UF_Msa_CF_122888	contig25577___0	contig25577___0	Unknown	
4211	52	29	unmapped	0		0	GTATGGAGCAACAGTTAATCCTCCACTGTTTACCTTCTCACCTCTTCATGAGGCTTGCAT	4049	0	UF_Msa_AF_109413	contig28309___1rc_nrnt	contig28309___1rc_nrnt	Unknown	
4212	52	30	unmapped	0		0	AGTGATGCTGCCTCTGAAATGTCTTGTAACTGGTGACCTGGTCGACTGTGGCCAATAGAT	4051	0	UF_Msa_AF_107030	contig27397___1_nr1nt0	contig27397___1_nr1nt0	Unknown	
4213	52	31	unmapped	0		0	ACACCAGAGACATGGACTCTGACAAGCAGGCGGGCATTGTCACCCTGGCCATCCTTATAG	4053	0	UF_Msa_AF_105659	contig29174___1_nrnt	contig29174___1_nrnt	Unknown	
4214	52	32	unmapped	0		0	GGAATTATACTAACGGCAGCAATCATTGGCTGGTGCAGTTTGTCAGCCTCAAAGATCTTC	4054	0	UF_Msa_AF_105563	contig01974___1_nr0nt	contig01974___1_nr0nt	Unknown	
4215	52	33	unmapped	0		0	AGACATCTGTAGGAGAACTTTCCACGTTTGATAATTCGTCTCCTGACCTGTTGCACTGGT	4056	0	UF_Msa_CF_125137	contig28470___0	contig28470___0	Unknown	
4216	52	34	unmapped	0		0	AACTGCAGAGCGTGCCTGCCGGACCATGAATGGCTATCGGCTGAATGGACGAGAGATTGA	4058	0	UF_Msa_AF_102355	contig25760___1_nrnt	contig25760___1_nrnt	Unknown	
4217	52	35	unmapped	0		0	AGTGGGGACAAAGAGTGAGGCATCGCTGCTGGTGTTGGATGAGCGCCGTGTGGTTGTCTC	4060	0	UF_Msa_CF_122390	contig23277___0rc	contig23277___0rc	Unknown	
4218	52	36	unmapped	0		0	CCTCACCCCTATTCTCCTGAACCAGGTCCTCTGTGCTAATGTGGTGTGAAGCAGTTGACA	4062	0	UF_Msa_CF_120353	contig30322___0rc	contig30322___0rc	Unknown	
4219	52	37	unmapped	0		0	AGAGTTTAAACCAATCAGTGCTCAGTCTAAAGGGAAAATGTATGGGCCAAGATATGATTA	4064	0	UF_Msa_CF_123785	contig03194___0	contig03194___0	Unknown	
4220	52	38	unmapped	0		0	ATTCGGGATTCCTCAGAGGGAAACAAAGCAGCAGGTGAGAAAGAAGAAGAATCAGATGGG	4066	0	UF_Msa_CF_120958	contig26026___0rc	contig26026___0rc	Unknown	
4221	52	39	unmapped	0		0	TACACCTGCAGCTTTCAAAAGGGTAAACAGTGTGACTTTTTCCAGTGGGCAGAGAATGGA	4068	0	UF_Msa_AF_106485	contig11638___1_nr1nt0	contig11638___1_nr1nt0	Unknown	
4222	52	40	unmapped	0		0	TGATGGAGGACGGGACAATATGACACAGAAACAGTAAAATGTTCAGTCAGACACTGGGAG	4070	0	UF_Msa_AF_101434	contig13406___1_nr0nt	contig13406___1_nr0nt	Unknown	
4223	52	41	unmapped	0		0	GTTGATTAAATCCATACTGTCCTATTGTGTACAAAATGGTGGACCTAATAAAGAGAACCA	4072	0	UF_Msa_AF_105919	LMB_S454.786.C1___1_nr0nt	LMB_S454.786.C1___1_nr0nt	Unknown	
4224	52	42	unmapped	0		0	GAGGTAGAAAGAAACATTTCGAATGGGTTCCCATGTTTTAAATTCGCCCCAATTTTGTTG	4074	0	UF_Msa_AF_102237	LMB_S454.1017.C1___1rc_nrnt	LMB_S454.1017.C1___1rc_nrnt	Unknown	
4225	52	43	unmapped	0		0	ACCTGGGAGGGAAACAGACAGAGAGACAGGGTTAGAGATAACAGAGACAAGGCATGGGGT	4076	0	UF_Msa_CF_120894	contig05939___0	contig05939___0	Unknown	
4226	52	44	unmapped	0		0	GTCTGTCTTCAGCAAAACTATGAATTTAAGTTCTGGGGTGCAATCCTGAGCCAACACCTG	4078	0	UF_Msa_AD_200391	AF169287_rc	AF169287_rc	Unknown	
4227	52	45	unmapped	0		0	GTGGAAGTGCTCTGTGTACATGCGAGATGCAGTACTACCAATAAACAATACCTGTTACTG	4080	0	UF_Msa_CF_122471	contig27790___0	contig27790___0	Unknown	
4228	52	46	unmapped	0		0	CTTGTAAAAAAGGGAAGACATTTTCGCAATGTACCCATACTTTTTGGAATTTTGCACATG	4082	0	UF_Msa_CF_121165	contig19056___0rc	contig19056___0rc	Unknown	
4229	52	47	unmapped	0		0	ATATGAACTTGAACTTCTCCGACTCATATCGGAACTCAAACTTCAAGTCACAGCACCTGC	4084	0	UF_Msa_AF_106674	contig09779___1rc_nrnt	contig09779___1rc_nrnt	Unknown	
4230	52	48	unmapped	0		0	AAAGAACAGCTGGGCTACATTGTGTTCAGTGGGCCCCGCCGGGCTAACGGAGTGCAAGGC	4086	0	UF_Msa_AF_107871	contig09332___1_nrnt	contig09332___1_nrnt	Unknown	
4231	52	49	unmapped	0		0	AGCCCGCATTTGCATCTCAGGAGAAGATTTTTCATGACCTGGGGTCTGATGTCCTGAAAG	4088	0	UF_Msa_CF_120265	contig10500___0	contig10500___0	Unknown	
4232	52	50	unmapped	0		0	TAAAGGTCTCGGTCGCAACCAGCAGGGCATCACTACACCGATTGAGGCCCAGTTGAGAAC	4090	0	UF_Msa_AF_109843	contig09948___1_nrnt	contig09948___1_nrnt	Unknown	
4233	52	51	unmapped	0		0	TTTGAAGCCGTCGCTGTTAACAACAAAACTTAACTTATGGGCTGAAATTACAGAAATGAA	4092	0	UF_Msa_AF_101485	contig07890___1_nr0nt	contig07890___1_nr0nt	Unknown	
4234	52	52	unmapped	0		0	CACACATAATGCTGAATGTCCACCCTCATCTCATTCCAGGAACAGTCACAAAGTCGACTA	4094	0	UF_Msa_CF_126410	contig28296___0	contig28296___0	Unknown	
4235	52	53	unmapped	0		0	GTACATTTGGGGACAACCGCGCAATCTTAGACGTAAAGAATGAATCAGAGCTCAACACAA	4096	0	UF_Msa_CF_127694	contig16769___0	contig16769___0	Unknown	
4236	52	54	unmapped	0		0	GTCGCCTACCAGCTGGCTGTGGAGGCAGAGTCAGAGCAGAAATGGAAGCAGTTAGCGGAG	4098	0	UF_Msa_AF_109231	contig10235___1_nr0nt	contig10235___1_nr0nt	Unknown	
4237	52	55	unmapped	0		0	AACCTGAAAGAACAAGGACTTTATCAGAATCCTGTGTTACTGGTACACACTACTGGTGGG	4100	0	UF_Msa_CF_126242	contig09760___0	contig09760___0	Unknown	
4238	52	56	unmapped	0		0	TTGATGGACAGGTCGGCCAAGCGGCGTATTCGGCGTCTAAAGGTGGCATCGTAGGAATGA	4102	0	UF_Msa_AF_102217	contig28679___1_nrnt	contig28679___1_nrnt	Unknown	
4239	52	57	unmapped	0		0	ATTCACAGAGAACACCTGGGGCAGAGGAACACCTGCAAGACTTCACCTCCAGACACACCC	4104	0	UF_Msa_CF_122600	LMB_S454.85.C1___0	LMB_S454.85.C1___0	Unknown	
4240	52	58	unmapped	0		0	AAGGTGGACAGAGAGGCCAGGATGGAGCCTCCGATCCAGACAGAGTATTTACGCTCAGGT	4106	0	UF_Msa_AD_200186	AF253319_rc	AF253319_rc	Unknown	
4241	52	59	unmapped	0		0	GCCGGCTCCAAGTTGTTTCATCTTATTTCTTCTTGCTCATCAATGAAAACAATGCTTTTT	4108	0	UF_Msa_AF_108500	LMB_S454.sd.236.C1___1rc_nrnt	LMB_S454.sd.236.C1___1rc_nrnt	Unknown	
4242	52	60	unmapped	0		0	TATTATTACAGAGACCATGATGGCTCAGGTCCACCTCCCCACAAGAAAAAGCACAAGTCT	4110	0	UF_Msa_AF_105849	contig28781___1_nr1nt0	contig28781___1_nr1nt0	Unknown	
4243	52	61	unmapped	0		0	CTCTCCCACCCTAACGTCACCAACCGCCAACATGGCCGCCGCCGTCTCCAGCGAAGATTT	4112	0	UF_Msa_CF_118979	contig06282___0	contig06282___0	Unknown	
4244	52	62	unmapped	0		0	GCGTCCTTATGAGGGCGAGAGGGACAGATACGGCGTGGTAGATTACTATGAGAAGTACAG	4114	0	UF_Msa_CF_122209	contig25894___0	contig25894___0	Unknown	
4245	52	63	unmapped	0		0	CGGACGGGAGCTCGTTCGGACTCAGGTGACAGCGGCGTCATTAACTACTTGTTCCGTAAC	4115	0	UF_Msa_CF_127112	contig17650___0rc	contig17650___0rc	Unknown	
4246	52	64	unmapped	0		0	AAGTTCGTGTTCCTGTTTATCCTTCTGTCTCCAGCAGCTTCTGATGTGGTACGAGTGAAA	4117	0	UF_Msa_CF_121883	contig32601___0rc	contig32601___0rc	Unknown	
4247	52	65	unmapped	0		0	GCGGCCAAAGCTCCTCAACCTTATTGTAAAAGTTCCTCCCAAGATATATGACATTTCCTC	4119	0	UF_Msa_AF_103550	contig07165___1rc_nrnt0	contig07165___1rc_nrnt0	Unknown	
4248	52	66	unmapped	0		0	CTCACTCAGCAACCTCTTCGCTAAAATTTACAACAAGTTTAGCATCTAAACCGGACTTAC	4121	0	UF_Msa_CF_120601	contig16343___0	contig16343___0	Unknown	
4249	52	67	unmapped	0		0	CAATCATTTGCATCTGTAACGACCTTTATGTTCCAAGCTCGTCAGGTTATTATCAGCACC	4123	0	UF_Msa_CF_118031	contig04836___0	contig04836___0	Unknown	
4250	52	68	unmapped	0		0	AAAGGAAAAAACAGGAAGACATTGAGAAACAGGCGATGACCACTTCAGTGTCCAGTGGTG	4125	0	UF_Msa_CF_123444	contig18631___0rc	contig18631___0rc	Unknown	
4251	52	69	unmapped	0		0	GTGCCGAGCTTCGGTATTAACAGACATGGTGAAGCTGACAAAGGCCAAGACATTCCAGGC	4127	0	UF_Msa_AF_109810	contig17525___1rc_nr0nt	contig17525___1rc_nr0nt	Unknown	
4252	52	70	unmapped	0		0	ATGTGTGGCCGTGCAGCCGCTGATAATCCTTCAAGCACTTCTACCGCATCGGAAGAGGAG	4129	0	UF_Msa_CF_118548	contig17545___0	contig17545___0	Unknown	
4253	52	71	unmapped	0		0	TCTACAGATGCGGCTTCTCTGTATATGCTGAGTAGTGATGATGTACAGCTGTTTGAGGTC	4131	0	UF_Msa_AF_108545	contig29094___1_nr1nt0	contig29094___1_nr1nt0	Unknown	
4254	52	72	unmapped	0		0	GAGGAGCAGCCCCTCCTGCAGTTTATTTGTGACATGACGGAGCTGAAAAAAGTTCGGGCC	4133	0	UF_Msa_CF_122177	contig05665___0rc	contig05665___0rc	Unknown	
4255	52	73	unmapped	0		0	ACAAGCTGTTCTTTGACAAGAGAGGCAACTCTGACTTTGATTTGCTTACCGTGAGCGAGA	4135	0	UF_Msa_AF_106865	LMB_S454.1020.C1___1rc_nrnt	LMB_S454.1020.C1___1rc_nrnt	Unknown	
4256	52	74	unmapped	0		0	ATTATGGATGTGACTCCAATACCCCCAAAGCAATTTTGGCCATTTGCCCCAGAGCCAAAA	4137	0	UF_Msa_CF_126822	contig09835___0rc	contig09835___0rc	Unknown	
4257	52	75		1028	E1A	0		42	1	(+)E1A_r60_n11	E1A_r60_n11	E1A_r60_n11		CONTROL
4258	52	76	unmapped	0		0	AACTGGCAACAACCACAGACCAGTTTTACCATGATGACAAACTGAATGATCAATACGTGG	4139	0	UF_Msa_AF_105556	LMB_S454.556.C1___1rc_nrnt0	LMB_S454.556.C1___1rc_nrnt0	Unknown	
4259	52	77	unmapped	0		0	TGGATCGCCGCAGCTGTGACTGCTTTCCTGTCACACGCGGGGCGTGATCTGTGCACGGCC	4141	0	UF_Msa_CF_122538	contig11474___0rc	contig11474___0rc	Unknown	
4260	52	78	unmapped	0		0	AGAAACCTCGGACTGTTGTTGTTTTTAGGCATTGTTGCTGGCAATTTGTGGAAAGAAAGA	4143	0	UF_Msa_AF_102159	contig24118___1_nr1nt0	contig24118___1_nr1nt0	Unknown	
4261	52	79	unmapped	0		0	TAATCGTCTGGATGGAAACATCTCCTCCGATCTGCATTCCACAAACTCTCTCCATAGGTA	4145	0	UF_Msa_CF_126614	contig10596___0rc	contig10596___0rc	Unknown	
4262	52	80	unmapped	0		0	CAGGGCGGCCACATTTGAATCACTGACTGCCTGTAAATTAAAACAAATAAAAGCCTTAAA	4147	0	UF_Msa_AF_101253	contig29434___1rc_nr1nt0	contig29434___1rc_nr1nt0	Unknown	
4263	52	81	unmapped	0		0	GTAGTCCCACCTGATAACAGGACTGAACAACAATATGAAGCACCATAGTACACGTAGTGA	4149	0	UF_Msa_CF_123381	contig23349___0rc	contig23349___0rc	Unknown	
4264	52	82	unmapped	0		0	ATGAGAGTAATATCTTTGCTGCCGGAAGATGAGGAGGAGCTGCTGGAGCTCCTGTCCCCG	4151	0	UF_Msa_CF_123551	LMB_S454.502.C1___0rc	LMB_S454.502.C1___0rc	Unknown	
4265	53	1	unmapped	0		0	TACATCAATGGAGCGGATATCCACAGTGTCATGGACTGAAATGCCGTACGAACACAACTA	4152	0	UF_Msa_CF_119617	contig06517___0	contig06517___0	Unknown	
4266	53	2	unmapped	0		0	AAACTGTGTGAAACTCTGATCGGGCAGATCCTGGACCACCTGAAGGGACTAGGTCGGGAC	4154	0	UF_Msa_AF_104801	contig04861___1_nrnt0	contig04861___1_nrnt0	Unknown	
4267	53	3	unmapped	0		0	ACTCAGTGAATCTACAGACTCATCCAGCATCAAGAAACGTCCTCTGCGCTACTTTGAGGA	4156	0	UF_Msa_CF_124159	contig16499___0	contig16499___0	Unknown	
4268	53	4	unmapped	0		0	TCATGAAATTGCCGGGACATGTAAACACTTCTTTCTACAATAAAAGGTTATTGTTTGTCC	4158	0	UF_Msa_AF_102126	LMB_S454.sd.479.C1___1_nrnt	LMB_S454.sd.479.C1___1_nrnt	Unknown	
4269	53	5	unmapped	0		0	AACTTTAAAACTTCATTTCAGCACCTGCACTCCATGCTGTCAGAGACTGATCCCCAGTTG	4160	0	UF_Msa_CF_124731	contig02617___0	contig02617___0	Unknown	
4270	53	6	unmapped	0		0	GACCAGAGAAATTAGTCACGCAGGAGAACTACATCAACCTCCCGGGCCTGCTGTTCTCCT	4162	0	UF_Msa_AF_109951	contig05314___1rc_nrnt-1	contig05314___1rc_nrnt-1	Unknown	
4271	53	7	unmapped	0		0	CATGCAGAGGAGGGCCATCAGAGATGCCAAGACTCCAGAGAAGATGAAGCAGGTCAAACC	4164	0	UF_Msa_AF_105595	contig05664___1_nrnt0	contig05664___1_nrnt0	Unknown	
4272	53	8	unmapped	0		0	TAGTATTTCCAGCAAAGACATGCAGGACTTTTCAAACCTTTGCAGCAGCGAGTCAATGCG	4166	0	UF_Msa_CF_118190	contig17638___0rc	contig17638___0rc	Unknown	
4273	53	9	unmapped	0		0	ACAGAAGGGCAGTACACTAGTCATCTATTTAGGAAAATGCCCTCCAAACACAAACTCTAC	4168	0	UF_Msa_CF_124953	contig22749___0	contig22749___0	Unknown	
4274	53	10	unmapped	0		0	CTGGTTTCTCCCTGCTGCGATGGGTCGACAGTGATCTCATACAGGTGTACCGTATGCATC	4170	0	UF_Msa_CF_127068	contig20071___0	contig20071___0	Unknown	
4275	53	11	unmapped	0		0	ATCACGCGATACGACGCTCAGCTAATCCTGGAGAACAACACGGGCATCCCCAAACTGACG	4172	0	UF_Msa_AF_105891	contig00075___1_nrnt0	contig00075___1_nrnt0	Unknown	
4276	53	12	unmapped	0		0	AAGTCCTCTGGCGTAGGAAGGTCTTGCCTTGCATAGCATGCTGTTCTGACAGCAAAACTG	4174	0	UF_Msa_CF_120067	contig01201___0rc	contig01201___0rc	Unknown	
4277	53	13	unmapped	0		0	TAAGGAGGGTTTGGAGAAGAGGCTGAGGGAAGCCACCAAGGAGGTAGACCGCCAGGCCCT	4176	0	UF_Msa_AF_102379	contig17298___1_nrnt0	contig17298___1_nrnt0	Unknown	
4278	53	14	unmapped	0		0	CGCTCTGTCCCGGATCTTCCTCTTCCCTGCGCGGCCTCAGAGGTATCTGAAAATGGTCCG	4178	0	UF_Msa_AF_106263	contig11024___1_nr0nt	contig11024___1_nr0nt	Unknown	
4279	53	15	unmapped	0		0	TTGGCGTTAACTGCACAGCGCCCTCTTTCGGACCGGAGAATGACTGTACTACACCAGTCT	4180	0	UF_Msa_CF_118602	contig05410___0rc	contig05410___0rc	Unknown	
4280	53	16	unmapped	0		0	CTGTGAGAGCCTGGAGTCACGGATAAACCATTTTGTCAAAAGAGGCAGGCTGGAGCGGGA	4182	0	UF_Msa_AF_108964	contig02030___1rc_nr1nt0	contig02030___1rc_nr1nt0	Unknown	
4281	53	17	unmapped	0		0	CATGATAGTGTGCACAGTTCTTGTTTGTCTTGACTTTGGTGACACTGTTGGTGAGAAGTC	4184	0	UF_Msa_CF_118363	contig22285___0	contig22285___0	Unknown	
4282	53	18	unmapped	0		0	GAGCCCAACACCCCTGCACCTCCCTCTCCAACAAGCACGCCTTACTATTTCAGACCCATG	4186	0	UF_Msa_CF_123856	contig08259___0rc	contig08259___0rc	Unknown	
4283	53	19	unmapped	0		0	AACGACCTGATCCCGAGTGTTGTCTTCTCCTCCAAGTTGGGTGGCTGCAGGGGGCTTCCG	4188	0	UF_Msa_AF_107413	contig16186___1_nrnt	contig16186___1_nrnt	Unknown	
4284	53	20	unmapped	0		0	TTCTGTCAAATAATCCAAAACACGCTGGGATACAGCGTCCATGGCAGCTGTGTTGCTATC	4190	0	UF_Msa_CF_123875	contig09972___0rc	contig09972___0rc	Unknown	
4285	53	21	unmapped	0		0	TATGACATGGCAGTTAACCGCACAGTCAACAATATATGTCACATCCAGAAACGGAGGGCA	4192	0	UF_Msa_AF_105184	contig00713___1rc_nrnt-1	contig00713___1rc_nrnt-1	Unknown	
4286	53	22	unmapped	0		0	TCACCAACTACTGCCGCACCACTGAGCGCAGTAAGCCAGTCTGTGGAAAGTGGTTTGCCA	4194	0	UF_Msa_CF_124006	contig18067___0	contig18067___0	Unknown	
4287	53	23	unmapped	0		0	GCAGCAAAGGTTTACACTGACTGGAGGACATTCATTGAGGAGAATTCCAATAAGCCGGTT	4196	0	UF_Msa_AF_109045	contig11817___1rc_nrnt-1	contig11817___1rc_nrnt-1	Unknown	
4288	53	24	unmapped	0		0	ATCAGTAGTCAGTGGTGCTTTGACATCCAGTGGTGCCCCAGGAGCCCTGCGGTGCTGTCG	4198	0	UF_Msa_AF_105635	contig25299___1rc_nr1nt0	contig25299___1rc_nr1nt0	Unknown	
4289	53	25	unmapped	0		0	GCTCAAAAAATTTTCCACATATTCTTGGCTGCGGAATTCCATATCTGCATGGGTGATGGA	4200	0	UF_Msa_CF_120710	contig06617___0	contig06617___0	Unknown	
4290	53	26	unmapped	0		0	TCCAGACTCCACAGCTCCAGAGCCAGAAAACCTGCAGGAAGTGATAGGAGGAGAAAGGAG	4202	0	UF_Msa_CF_120114	contig09429___0rc	contig09429___0rc	Unknown	
4291	53	27	unmapped	0		0	AGATGGTTCCTGACTGACTTTAAGTGACAACAACATATCGTGCTGTCACCCATCAGAGCT	4204	0	UF_Msa_CF_119657	contig15962___0	contig15962___0	Unknown	
4292	53	28	unmapped	0		0	TACAAGAAGGACTGCCTGCCCACACGCCGGGGCTTTGACTCTTACTTTGGCTACCTGACA	4206	0	UF_Msa_AF_106271	contig09049___1_nrnt	contig09049___1_nrnt	Unknown	
4293	53	29	unmapped	0		0	AACCAGTAGCAGAGACCGCTGCTGAACCTGTCGTCGAGGCAGTGTCTGAAGAAGAAGCAG	4208	0	UF_Msa_CF_121407	contig02382___0rc	contig02382___0rc	Unknown	
4294	53	30	unmapped	0		0	CCAGTTTATCATTTAATCCTGAAGATGAAGGGGAAGATGAAGAGGACAATGAAGAGGAAG	4210	0	UF_Msa_AF_103682	contig10816___1_nr0nt	contig10816___1_nr0nt	Unknown	
4295	53	31	unmapped	0		0	TTTGTTTTCTTACTATCCTAGCGACCGCTGTGTGGTATATACCCTTTGAACTCCTGCCCA	4212	0	UF_Msa_CF_125008	contig10740___0rc	contig10740___0rc	Unknown	
4296	53	32	unmapped	0		0	CTTAAATGAAGTGGAAGCTTCCTCTTGTGTAATCCAATCAAGAATTGAATAGTACGGAAA	4214	0	UF_Msa_CF_125989	contig17936___0	contig17936___0	Unknown	
4297	53	33	unmapped	0		0	AGAAGAAATGGGAATATTGAATGACCTGCTTGCCTTCTGCCTGAAGTGTCGCTGCAATGT	4216	0	UF_Msa_AF_102692	contig29922___1_nrnt0	contig29922___1_nrnt0	Unknown	
4298	53	34	unmapped	0		0	CCTCCTGCAGTGGTAAGTTTAAAAGAGGCACACGAGGTATGGATTTAGATTTCTTTTTAT	4218	0	UF_Msa_CF_122522	contig00868___0rc	contig00868___0rc	Unknown	
4299	53	35	unmapped	0		0	TTGAGTCCCAGAATGCACCAGGCACCCCTTTGATGTATCCTCCCCCTCGACCTGCTCTCA	4220	0	UF_Msa_AF_102149	contig25263___1rc_nrnt0	contig25263___1rc_nrnt0	Unknown	
4300	53	36	unmapped	0		0	TAAATACCACACCTTCTTACAGTGCAAGAAAGAGACCAACACCATTGAGCAGGCAGCTGA	4222	0	UF_Msa_AF_102967	contig04341___1rc_nrnt	contig04341___1rc_nrnt	Unknown	
4301	53	37	unmapped	0		0	AAGATGCGACTTGACCCTCCAGCGTCGTCGGTGTCCAAACACAACGAGAGAAGTTTATCC	4224	0	UF_Msa_CF_125754	contig10077___0	contig10077___0	Unknown	
4302	53	38	unmapped	0		0	CAACTCATGACATGACCATCCGAGGAGCACGCAAATGCAACATTATTCTATGACTCCCAG	4226	0	UF_Msa_CF_119423	contig14043___0	contig14043___0	Unknown	
4303	53	39	unmapped	0		0	AAGAAGTTTGCTGATAAGCCAGAGGCAGGTGAAGAGTTCATCCAGAAAGTCCTGCAGAAT	4228	0	UF_Msa_AF_101926	contig30731___1rc_nrnt-1	contig30731___1rc_nrnt-1	Unknown	
4304	53	40	unmapped	0		0	ATGTTTTCTGCGATCAGCACGGGTCTGGTGAGTTCAGCCGTTCCCCCGCCATCTGCCCAG	4230	0	UF_Msa_AF_106134	contig05005___1rc_nrnt	contig05005___1rc_nrnt	Unknown	
4305	53	41	unmapped	0		0	GAAAAGGAGGAAAGGAAAAGGAAGCCAACTTTCGTTCGGGGCCGGCAGTCCCGCCGCTCC	4232	0	UF_Msa_CF_119110	contig26330___0	contig26330___0	Unknown	
4306	53	42	unmapped	0		0	AACTTACAAAAATGGGTTGCTTTGAATGCTGCATCAAATGTTTAGGCGGGGTGCCGTACG	4234	0	UF_Msa_AF_104294	contig03528___1rc_nrnt0	contig03528___1rc_nrnt0	Unknown	
4307	53	43	unmapped	0		0	GTTAGCCACCATGTTCTTCGATGAGGTTGTAAAGCAGAATGTCGCTGCGTTTGAGCGGCC	4236	0	UF_Msa_AF_101924	contig03340___1rc_nrnt	contig03340___1rc_nrnt	Unknown	
4308	53	44	unmapped	0		0	ATTTCCCAGGTTCTAACATTCGCTTTGAACCGAAAGACAATGCAGACGCATCTCAGAAGG	4238	0	UF_Msa_AF_101207	LMB_S454.sd.376.C1___1_nrnt0	LMB_S454.sd.376.C1___1_nrnt0	Unknown	
4309	53	45	unmapped	0		0	GTTGAGGCTCAAGTGTAGCTGCATTTCCTAGCAGAAGTCAGAGGTAATGGGTTTTCACAA	4240	0	UF_Msa_AF_107048	contig27862___1_nr0nt1	contig27862___1_nr0nt1	Unknown	
4310	53	46	unmapped	0		0	TCGAGGCCACCACAGTGGATGTGCCCCACTACGAGGATGGCACCACCAAGAGGACTTTTG	4242	0	UF_Msa_AF_102378	contig24640___1_nr0nt1	contig24640___1_nr0nt1	Unknown	
4311	53	47		0		0		3409	1	RC9	RC9	RC9		CONTROL
4312	53	48	unmapped	0		0	CAAAATAGCGGAGATCCCGTTCAACTCTACAAACAAGTACCAGCTTTCCATTCACAAAAA	4245	0	UF_Msa_AF_102284	contig23061___1_nrnt	contig23061___1_nrnt	Unknown	
4313	53	49		1028	E1A	0		418	1	(+)E1A_r60_a135	E1A_r60_a135	E1A_r60_a135		CONTROL
4314	53	50	unmapped	0		0	AGTAGCTCATCAGCTGTCAGGAAAGAAAACAGGCAAGATGAACCAAATGGTCGACCAAAA	4248	0	UF_Msa_CF_122082	contig05727___0	contig05727___0	Unknown	
4315	53	51	unmapped	0		0	AATGCCCACACTGTACCAAAGATATGAAGAAGAGAGCTACCAGCGGCTACAGAAACTCAT	4250	0	UF_Msa_AF_105122	contig29237___1_nr1nt0	contig29237___1_nr1nt0	Unknown	
4316	53	52	unmapped	0		0	AAACATCCCATAGTTGTGCTGTTGTGCAGTAGATTCGAGCGGTGATACGTTTGTGTGTTC	4252	0	UF_Msa_AF_104250	contig14945___1rc_nrnt-1	contig14945___1rc_nrnt-1	Unknown	
4317	53	53	unmapped	0		0	CGGGCCTCAGAGCACCAGCCAACACAAAAGCTGTTCTGACATTAGCCAACAGTAAAGCCA	4254	0	UF_Msa_CF_117962	contig08192___0rc	contig08192___0rc	Unknown	
4318	53	54	unmapped	0		0	ACAAGTGACCAATAAAGAGCTGGCACTGTTCCAGCAGAAGCTAGAAGAGGAAGTGAAGAA	4256	0	UF_Msa_CF_127520	contig21952___0rc	contig21952___0rc	Unknown	
4319	53	55	unmapped	0		0	ATGCTTTTGAGTCTGTTCAGCTTCACCTGCCCTACTTTTGTCTGCTTCAGCTTTGGATTA	4258	0	UF_Msa_CF_120799	contig13882___0rc	contig13882___0rc	Unknown	
4320	53	56	unmapped	0		0	TCATTTTATCAAGATAAAAATCTGTTGGTTCCCTTTAATCCTCTCATGGACCCCAGCACC	4260	0	UF_Msa_CF_122555	contig00877___0	contig00877___0	Unknown	
4321	53	57	unmapped	0		0	CATCTTTGTTACATATTTATTGAATTAAAATGATTAAAACATTTGAAAGAAGGCACAGTG	4262	0	UF_Msa_AF_110096	contig13147___1_nr0nt	contig13147___1_nr0nt	Unknown	
4322	53	58	unmapped	0		0	GAAACACATCACCTCCTGCTTGCTATCCTCTTGGATCTCCTAAGACCAGCGTTTTGCGCC	4264	0	UF_Msa_CF_120515	contig30844___0rc	contig30844___0rc	Unknown	
4323	53	59	unmapped	0		0	AAGATTGAGTTTAAGACTCGTCTCGGTAGAAACATCTACCGAGTGGTGTTCAGGACAGGT	4266	0	UF_Msa_AF_100909	contig29492___1_nrnt	contig29492___1_nrnt	Unknown	
4324	53	60	unmapped	0		0	ATTATGGTTGGAAGGGCCCCCTGTGTGACCAGTGTGTGACGTTCCCTGGCTGTGTGTATG	4268	0	UF_Msa_AF_108715	contig24739___1rc_nrnt	contig24739___1rc_nrnt	Unknown	
4325	53	61	unmapped	0		0	TCCAAACAGAAGCATCTAAGTTGTCGCTCTTGTGACATGGTTTTCAGGAGCACCTCTAAG	4270	0	UF_Msa_CF_119878	contig01993___0	contig01993___0	Unknown	
4326	53	62	unmapped	0		0	TTCATGCTGTCCATCTCCGCAGTTGTGATGTCCTACCTCCAGAACCCACAGCCGATGTCG	4272	0	UF_Msa_AF_104978	contig19883___1_nrnt	contig19883___1_nrnt	Unknown	
4327	53	63	unmapped	0		0	CGTGTAGGAGCTTTGAATTTTCTGGGTATTTTGTCAAAAACTGAAATAAAGAGGACTACA	4274	0	UF_Msa_AF_106200	contig11995___1rc_nr0nt1	contig11995___1rc_nr0nt1	Unknown	
4328	53	64	unmapped	0		0	GCTTTTGGTAAGGTGTGCTCCTTCGAGCAGTTGGAGCATGTGCGCGAGATGCAGGAGAAG	4276	0	UF_Msa_AF_100999	contig02052___1_nr0nt1	contig02052___1_nr0nt1	Unknown	
4329	53	65	unmapped	0		0	TTCTTCTTCAAACTGGGGTTTTCACCTACCAGACCTTTTCACGTGTCTTTGCTGATCCTG	4278	0	UF_Msa_AF_100429	contig27536___1rc_nr1nt0	contig27536___1rc_nr1nt0	Unknown	
4330	53	66	unmapped	0		0	AGGATGCGGAGACCGCAGGAGCCCTGATGACGTTCTTCTTGGCCCTGGGTCTGTCCATAG	4280	0	UF_Msa_CF_126169	contig20187___0	contig20187___0	Unknown	
4331	53	67	unmapped	0		0	CGGAAACACACAGGAGGCAAAATCCTTGGATTCTTTTTCTAAAATGTAAACTGCAAATAA	4282	0	UF_Msa_AF_104471	LMB_S454.sd.48.C1___1_nrnt	LMB_S454.sd.48.C1___1_nrnt	Unknown	
4332	53	68	unmapped	0		0	ACCATTCAACTACGAAGTCAACGCGACGCCTTCCACATGGTTACAACCGTGTGTCACACC	4284	0	UF_Msa_CF_126947	contig15345___0rc	contig15345___0rc	Unknown	
4333	53	69	unmapped	0		0	TACACAAGGGCACAGAGAGCTGAAAATAGCGCTGCTGTCCTCGTGATGCAAAATTAAAAG	4286	0	UF_Msa_CF_117751	contig23942___0	contig23942___0	Unknown	
4334	53	70	unmapped	0		0	TATTAAGATCTCTACAGTCATCCCTGTCATTGTGGGAGGGCAGAATGTCAAGCTCACAGA	4288	0	UF_Msa_CF_118635	contig23274___0rc	contig23274___0rc	Unknown	
4335	53	71		0		0		2824	1	RC2	RC2	RC2		CONTROL
4336	53	72	unmapped	0		0	TCGTCTACAGCTGGTGTGAGCTCAATATGTTCATATTCGGCCTTACAGTCAGAGTGATTG	4291	0	UF_Msa_AD_200033	LMB_Add_76	LMB_Add_76	Unknown	
4337	53	73	unmapped	0		0	TTGTACTGGGCACGCTCAGTTGTTGGACCTGGTCCAAGCCGTGGTACAGAACAATGACAG	4293	0	UF_Msa_AF_100726	LMB_S454.1120.C1___1rc_nrnt	LMB_S454.1120.C1___1rc_nrnt	Unknown	
4338	53	74	unmapped	0		0	CTGGATCAACAAGACTATGCAGGAGAACTGAAACTTTCAGTTACAAATTGATTTGAAGAT	4295	0	UF_Msa_AF_108522	contig26899___1_nrnt	contig26899___1_nrnt	Unknown	
4339	53	75	unmapped	0		0	TTCATCTGGCATCGCAGCTCATGACCTCAGCACCAAGCTGAAGCAAGTGGAGAGCTGGCT	4297	0	UF_Msa_CF_122200	contig04322___0	contig04322___0	Unknown	
4340	53	76	unmapped	0		0	CGGCCACGGCAGCCGAGGACCGCATCCTGGTGGTGGGCGCCACCAACCGGCCTCAAGAGA	4299	0	UF_Msa_AF_110242	contig19477___1_nrnt0	contig19477___1_nrnt0	Unknown	
4341	53	77	unmapped	0		0	ATGAGTGGATCTTCGTTTTAGCAAAGCTGCTTTCTTCAGTTTTACATCCGGGGCAACTCC	4300	0	UF_Msa_CF_121668	contig18906___0rc	contig18906___0rc	Unknown	
4342	53	78	unmapped	0		0	CCAATCAGGAGATCTGACCAATCGGGAGAGTCTCCACTGCATCCAGACCGTCTTCACCAT	4302	0	UF_Msa_CF_125603	contig25282___0rc	contig25282___0rc	Unknown	
4343	53	79	unmapped	0		0	AAGACAGAGATCAGTGACCTGCGGCGTACACTGCAAGGCCTGGAGATTGAGCTGCAGTCT	4304	0	UF_Msa_AF_107788	contig09089___1_nrnt	contig09089___1_nrnt	Unknown	
4344	53	80	unmapped	0		0	CGCAGCCAAGAAGGAGATGCTGAAGTCCAAGCTGCCCAACACGGTCCTGGGAAAGATCTG	4306	0	UF_Msa_AF_103794	contig16890___1rc_nrnt	contig16890___1rc_nrnt	Unknown	
4345	53	81	unmapped	0		0	AAGAAGATGTTTGGGACGCTTCACATGCACCCTGTAATTTATCCATTCTTTAGTGCAGCC	4308	0	UF_Msa_CF_119521	contig11097___0	contig11097___0	Unknown	
4346	53	82	unmapped	0		0	AGATCTGGAAGAGACAAGAGAGTGACAGTGACACAAACAACCACACAGGGGTGTAAGCGA	4310	0	UF_Msa_AF_100989	contig12315___1rc_nrnt0	contig12315___1rc_nrnt0	Unknown	
4347	54	1	unmapped	0		0	GTCTTTACACTTGTTAAAGCACTTTGTAACTTCGTTTTTGAAAAGTGCTCTACAAATAAA	4153	0	UF_Msa_AF_104966	contig30751___1_nr0nt	contig30751___1_nr0nt	Unknown	
4348	54	2	unmapped	0		0	ATCAATGCAGACGGTTACGTTAATCCAGGTGTTGCAATAGAGTTGCCCGGAAACCTCAAT	4155	0	UF_Msa_CF_125877	contig26981___0rc	contig26981___0rc	Unknown	
4349	54	3	unmapped	0		0	TGCTAGCACTGTTTATTCTGCAAATCATCATCTGAAAGGTATGGAGGTCAAGAAAATGGA	4157	0	UF_Msa_CF_119459	contig02932___0	contig02932___0	Unknown	
4350	54	4	unmapped	0		0	ATCCTGCTACTTTCGCTCTGGATGACGAGTTCTTGATCGCCACTTTTCCTGGTACCAACC	4159	0	UF_Msa_CF_122035	contig17159___0rc	contig17159___0rc	Unknown	
4351	54	5	unmapped	0		0	TCTACTGCACTGAAGGAACTATTCTGCATTTTGACTCCTGGAAAATAAATGCTTTTGCAA	4161	0	UF_Msa_AF_101666	LMB_S454.187.C1___1_nrnt	LMB_S454.187.C1___1_nrnt	Unknown	
4352	54	6	unmapped	0		0	ATTTAAAGCAAGTGACTATGGACAGGAAACTGACTGACTTGTGGAACTGGCTTAGGAAAA	4163	0	UF_Msa_CF_126456	contig30635___0rc	contig30635___0rc	Unknown	
4353	54	7	unmapped	0		0	AGATACGTATGGAAAACAGTCATCCTGTTACGCCACTCTTTATTTACCTGGTTACACAAC	4165	0	UF_Msa_CF_122383	contig22638___0rc	contig22638___0rc	Unknown	
4354	54	8	unmapped	0		0	AACACCCCCAGCATCTCTAATAAGCAGGATGCCCAGCCACGAGGCCAGGAACTACATCAG	4167	0	UF_Msa_AF_104728	contig01355___1rc_nrnt	contig01355___1rc_nrnt	Unknown	
4355	54	9		0		0		4169	1	ETG09_48764	ETG09_48764	ETG09_48764		CONTROL
4356	54	10	unmapped	0		0	ATTTGCCAACAATGCGGAGCAGCAGCTGCAGAAGAAGAGTAAAGGCCAGCCCGGAGAGAT	4171	0	UF_Msa_AF_106158	contig12206___1_nrnt	contig12206___1_nrnt	Unknown	
4357	54	11	unmapped	0		0	ATTGCTGCTGCTGTGTTTTTCATGGCTCGGCTGGTGAAGAGATATGGCTGTCTGAATAAT	4173	0	UF_Msa_AF_106994	contig28406___1_nr1nt0	contig28406___1_nr1nt0	Unknown	
4358	54	12	unmapped	0		0	CAGCAATGGCGAGTGGCAAAAAGAGTGTCCTGCTTTCCTCTTTGGCAGATTATGGAGACG	4175	0	UF_Msa_CF_126963	LMB_S454.271.C1___0	LMB_S454.271.C1___0	Unknown	
4359	54	13	unmapped	0		0	AAGACCACCAGGACGAGGACGGCTTCCTCTATATGACCTACGCCTCACAAGAGACCTTCG	4177	0	UF_Msa_AF_103854	contig11607___1_nrnt	contig11607___1_nrnt	Unknown	
4360	54	14	unmapped	0		0	AACTCACGTGATCAAAGAAGAGGTTTCACTGAGGCGGCCTGAGATTAAGGAACTGTTCAA	4179	0	UF_Msa_AF_110149	contig24216___1_nrnt	contig24216___1_nrnt	Unknown	
4361	54	15	unmapped	0		0	ATGAAGACATGACAATGGCGGAGTCAGTGCCGCTCGGTCAAGTGGAGATCGTGGCAAACA	4181	0	UF_Msa_CF_120348	contig24929___0rc	contig24929___0rc	Unknown	
4362	54	16	unmapped	0		0	GGACGAGCCGTTATTACAAAGCACAGAATCATGTGTCAGGACCAAGAGCAAACTGTTACT	4183	0	UF_Msa_AF_107553	contig29153___1rc_nr1nt0	contig29153___1rc_nr1nt0	Unknown	
4363	54	17	unmapped	0		0	CATAGAATGCAAGAAGTGATTTAACAGCTGAATAGCAAATGCTACAGAATGTAATTGAGG	4185	0	UF_Msa_AF_110154	LMB_S454.283.C1___1rc_nrnt	LMB_S454.283.C1___1rc_nrnt	Unknown	
4364	54	18	unmapped	0		0	AATCTTCTGTTGAATTACACCACGGTCGCCACAAATATTGCAGGAGACCTAATAGAGCCC	4187	0	UF_Msa_AF_102719	contig23709___1_nr0nt1	contig23709___1_nr0nt1	Unknown	
4365	54	19	unmapped	0		0	TGGTGAAAGAGGATGTGTCAGAGTTACGTAATGAGCTACAGAGGAAAGAAACCCTGGTTC	4189	0	UF_Msa_AF_109610	contig02396___1rc_nrnt	contig02396___1rc_nrnt	Unknown	
4366	54	20	unmapped	0		0	TCCTCTCATGGGTGTCCTTCTGGATCAAAAAAGATGCCACGCCAGCCAGAACGGCTTTAG	4191	0	UF_Msa_AF_107887	contig01267___1_nrnt	contig01267___1_nrnt	Unknown	
4367	54	21	unmapped	0		0	GACTCAGTGGAGTTGGATCCTCCAGCTGTGCTGCTGCATCGAAACCCACCTTAAAGAAAA	4193	0	UF_Msa_AF_102959	contig27927___1_nrnt	contig27927___1_nrnt	Unknown	
4368	54	22	unmapped	0		0	CTGCACTTTACTACAGCGGAGTTTAAGATTTGAATATGGCATTAATCAAGTTCATGTCTT	4195	0	UF_Msa_CF_126848	contig31146___0rc	contig31146___0rc	Unknown	
4369	54	23	unmapped	0		0	AGTTCAAATGCATGCCACAAAAATGGACTTAGGATGTGGCTTCCGCGTTGGACTTTTTCC	4197	0	UF_Msa_CF_122367	LMB_S454.799.C1___0rc	LMB_S454.799.C1___0rc	Unknown	
4370	54	24	unmapped	0		0	TGACGAGGCTTCAGAGGCTGGAGGAGCTTGATGCCTCGATCCTTTATAGCTGCCAGAAGG	4199	0	UF_Msa_CF_124489	LMB_S454.937.C1___0	LMB_S454.937.C1___0	Unknown	
4371	54	25	unmapped	0		0	TACTTTTGGCTGTAACGACGAAGGGGCCCTTGGTCGGGACACAACAGAAGAGGGGTCTGA	4201	0	UF_Msa_AF_101410	contig28275___1rc_nr1nt0	contig28275___1rc_nr1nt0	Unknown	
4372	54	26	unmapped	0		0	TATGGGCCCTCCTCCTCTGGTTCACCACTCCATCCTGCACCACCAGCCCCCATCAGCCGG	4203	0	UF_Msa_CF_122217	contig10782___0	contig10782___0	Unknown	
4373	54	27	unmapped	0		0	AAGACTGCTTCGAAAGAGGAGGCAACAAAAGGTCCTGGCATGACCAGACGCCACATTGGG	4205	0	UF_Msa_CF_126429	contig25230___0	contig25230___0	Unknown	
4374	54	28	unmapped	0		0	AAGTGGACATGTGGACAAGAACAAACCAAAGGCCAGCTCCCGCCAGCAACACCCGAAGCA	4207	0	UF_Msa_CF_117699	contig15959___0	contig15959___0	Unknown	
4375	54	29	unmapped	0		0	AGAACAGAAAGGAGACTGAAAACATTTTGATGATTGGGGGTTGTCGAACAGCTCAGAAGT	4209	0	UF_Msa_AF_101336	contig05970___1rc_nrnt	contig05970___1rc_nrnt	Unknown	
4376	54	30	unmapped	0		0	CCCCTTTGGCAGCTCCATTTGGTCAACAAGCGCAGATTCAGCCTTGCACCCTTTTCCTCC	4211	0	UF_Msa_AF_100261	contig26000___1rc_nrnt0	contig26000___1rc_nrnt0	Unknown	
4377	54	31	unmapped	0		0	TGAAACTTTTCCACATTCAAGTGCTCTTCAAGTATGGGGTCATGACTATTTCCACTGTCA	4213	0	UF_Msa_CF_117746	contig19170___0	contig19170___0	Unknown	
4378	54	32	unmapped	0		0	TGAACCTTAACCCAGAGGTGGACGGGACGATCGTCAAGGTGCCTGTTCCCAAAGTAACGC	4215	0	UF_Msa_CF_119262	contig09349___0	contig09349___0	Unknown	
4379	54	33	unmapped	0		0	GCATGTTTTGATTGGAATGTAGCTGTTTTGCTAAGGACGGATGCATATTATATTTATCAG	4217	0	UF_Msa_AF_104283	contig11525___1_nrnt0	contig11525___1_nrnt0	Unknown	
4380	54	34	unmapped	0		0	ATCAATTGATGCCTTCAACAAGTCTCTACCCAAAAGAGGCCTGGTGGTGGGAATCACATT	4219	0	UF_Msa_AF_100673	contig12408___1rc_nrnt-1	contig12408___1rc_nrnt-1	Unknown	
4381	54	35	unmapped	0		0	AGGGCACCAAAGACTCCAAGGACAAAAAGTGCTGAAGTATCATAACTGCAGAAACTCTGA	4221	0	UF_Msa_CF_121344	contig16222___0rc	contig16222___0rc	Unknown	
4382	54	36	unmapped	0		0	GACTGCAAACCAGAAATATACACCTGTATGTAATGCAACAGGCTTGAAATAAATACCATT	4223	0	UF_Msa_AF_109263	LMB_S454.sd.43.C2___1_nrnt0	LMB_S454.sd.43.C2___1_nrnt0	Unknown	
4383	54	37	unmapped	0		0	AGGACACGGGCTGTCCTGCTTTATGGTGCTTCCCCCTGGTGTCTACATGTATGTAGCACA	4225	0	UF_Msa_CF_123414	contig23348___0rc	contig23348___0rc	Unknown	
4384	54	38	unmapped	0		0	AAGGTTGGTGGAGTGGATCATCACCCAGTGCGGCTCTGGAGCTGGCCGGCCTAAGCCAGG	4227	0	UF_Msa_CF_120507	contig23259___0	contig23259___0	Unknown	
4385	54	39	unmapped	0		0	TGTGAAACTCTAGATCCCCTTCACCATATGTATTAAACTCTGGGTAATACATCATAGGGT	4229	0	UF_Msa_AD_200327	LMB_Add_25	LMB_Add_25	Unknown	
4386	54	40	unmapped	0		0	GTTGAGCCAGTCCATGAGTGGGCCCAAATGTGTCCAGTTTCTTTGAATTTCTGGTTAATA	4231	0	UF_Msa_CF_118445	contig14235___0	contig14235___0	Unknown	
4387	54	41	unmapped	0		0	CCATCATACACGTGGAGCTGATTGACTATTGTGTGCTTCTGGGATTGAAAGAAGAAAAAA	4233	0	UF_Msa_AF_106952	contig17217___1_nr0nt	contig17217___1_nr0nt	Unknown	
4388	54	42	unmapped	0		0	GGGCCTTTGTTTGTTCGCGTCTCGGCTGGCAGGAACAAAGGGTCCTGCAATAGTAGTAGA	4235	0	UF_Msa_CF_124946	contig02756___0	contig02756___0	Unknown	
4389	54	43	unmapped	0		0	GAGTCGCCCACTTTCCTTTGTAGTAGATGTAGCTGATAAGATACATGACTGTGTTTGGAG	4237	0	UF_Msa_AD_200361	LMB_Add_58_rc	LMB_Add_58_rc	Unknown	
4390	54	44	unmapped	0		0	AAAGTTGCCAAACAACAAGCATCATTCAGTGTCAGCCAGATAGCAGCTACAGCTTAGTCG	4239	0	UF_Msa_CF_121432	contig05690___0rc	contig05690___0rc	Unknown	
4391	54	45	unmapped	0		0	AAATGGCTGCTGGTGGAAACACAGTGGAGAGGGAGGACAGTTTGCTAACAGATAAATAGT	4241	0	UF_Msa_CF_121835	contig21744___0rc	contig21744___0rc	Unknown	
4392	54	46	unmapped	0		0	TCGCATCAAGAAGACGGACGTGATGCACATCGAGTATCTGTACCGGCGAGGACAGAGGCA	4243	0	UF_Msa_AF_106515	contig01087___1_nrnt	contig01087___1_nrnt	Unknown	
4393	54	47	unmapped	0		0	TTGTCAAATTCAATATGGGAGCACTCCCTTCTGGACCCTGCATCTGTGATGAGTGGAAAA	4244	0	UF_Msa_AF_100758	contig19200___1_nrnt0	contig19200___1_nrnt0	Unknown	
4394	54	48	unmapped	0		0	GAGGAGGGGTCTGGCGTGGACGCAGCCCTTCTAACTTTATTTGTCAAAATAATAAAACAC	4246	0	UF_Msa_AF_108919	contig29449___1_nr0nt	contig29449___1_nr0nt	Unknown	
4395	54	49	unmapped	0		0	TGGAAAAAAGGAGATCAAGCCCTTCAAACGCTTCCTGCGCAAGAAATCCAAGCCAAAGAA	4247	0	UF_Msa_AF_104775	contig19921___1_nrnt	contig19921___1_nrnt	Unknown	
4396	54	50	unmapped	0		0	TATAATGCAACGTTTTTCGGCGAGGTTTTGTCTGTGTATTCTCGTGCCGTGGAGGAAGAT	4249	0	UF_Msa_CF_118232	LMB_S454.1025.C1___0	LMB_S454.1025.C1___0	Unknown	
4397	54	51	unmapped	0		0	TAAGTTTGGCATTGCTCCAGAAACCACAGGAGTCCTGAAGGAGAGAAGAATCTGATGTGT	4251	0	UF_Msa_AF_102683	contig01708___1_nrnt	contig01708___1_nrnt	Unknown	
4398	54	52	unmapped	0		0	TGTGGTACATGTGACAACTATCTCCTGTATTCTTCATATGAATGGGGGTAGGGTGGCAAG	4253	0	UF_Msa_AF_103384	contig06480___1_nr0nt1	contig06480___1_nr0nt1	Unknown	
4399	54	53	unmapped	0		0	GCATACCTTCAGCCCACCTCGGCCCCTCATCTATCACACCAAACTGAGAGCCACCAAACC	4255	0	UF_Msa_CF_123507	contig26630___0rc	contig26630___0rc	Unknown	
4400	54	54	unmapped	0		0	AATGCGTGTCAGTGTTTGTGGGAAGGAAATCGACGAGCCACAACGACACCACTTCCGCTC	4257	0	UF_Msa_CF_125262	contig19033___0rc	contig19033___0rc	Unknown	
4401	54	55	unmapped	0		0	ATGAGGGTAAATCAAAACAAAAACAACACAGGGCAGCTACAGTCGCCAAAGACTGTCAGC	4259	0	UF_Msa_CF_120286	contig04183___0	contig04183___0	Unknown	
4402	54	56	unmapped	0		0	TTTCTATGATCCACATGTGGCGGCCCCACACAAGCGTGAGCTTGGCCCTGCCCTTTACAT	4261	0	UF_Msa_AF_106898	contig28640___1_nrnt	contig28640___1_nrnt	Unknown	
4403	54	57	unmapped	0		0	AGAGTCAGCCAAGGCTGCTGCTGGAGCTGCTGGAGCTTCTGTTTGACAAGTTCAAGGCAG	4263	0	UF_Msa_AF_109435	contig10929___1_nr0nt	contig10929___1_nr0nt	Unknown	
4404	54	58	unmapped	0		0	ACAGACCTATCGCTGGGGGCCCTGTCCTACTCCGAAGGTGCAGCCCAACTTCAACCTCCA	4265	0	UF_Msa_AF_106467	contig19044___1rc_nrnt0	contig19044___1rc_nrnt0	Unknown	
4405	54	59	unmapped	0		0	ACTTTCTTCTGATCGGGGACTTCATTTTCCTCGTCATCAGTGGATGTTCTCAAGTCCCTT	4267	0	UF_Msa_AF_104476	contig10860___1_nr0nt	contig10860___1_nr0nt	Unknown	
4406	54	60	unmapped	0		0	ATGAAGGGACCAAGTGCGCATCTCCAGCTGACAAAAACGTGGAGATGGGGGCGTTGAGGT	4269	0	UF_Msa_CF_117811	contig21653___0rc	contig21653___0rc	Unknown	
4407	54	61	unmapped	0		0	TTGAGCTTGTAGGTGTTCAGGGTCGAAACTCAGTCACTGTGACTCCTTCGGACTCAAAAG	4271	0	UF_Msa_CF_124441	contig17394___0rc	contig17394___0rc	Unknown	
4408	54	62	unmapped	0		0	CAGGACAGCTTTCAACCTTCCTGACTTTGAAATAGAGGAGCTGGAGAAGGCCCTGTCAGA	4273	0	UF_Msa_AF_105012	contig05527___1rc_nrnt	contig05527___1rc_nrnt	Unknown	
4409	54	63	unmapped	0		0	ATATGATTCCCTTCGAACAGATGACCATTGAAGACCTAAACGAGACTTTCCAGAAACCAA	4275	0	UF_Msa_AF_106153	contig09222___1_nrnt	contig09222___1_nrnt	Unknown	
4410	54	64	unmapped	0		0	TATCATCTATTACAGGCTGCTGAGAGGTGGGTGGTCCAGTTGGTTTTCTTTATTGAGTGG	4277	0	UF_Msa_AD_200196	LMB_Add_117_rc	LMB_Add_117_rc	Unknown	
4411	54	65	unmapped	0		0	TGTGGGACGTCTCCCCTACCGCAGATGGTCACGTGTTAAGACTCAAAGCTGCTGTCGTTT	4279	0	UF_Msa_AF_103934	LMB_S454.1034.C1___1rc_nrnt	LMB_S454.1034.C1___1rc_nrnt	Unknown	
4412	54	66	unmapped	0		0	CTCCTTTCTCTGCTATGTTTGAGAACTATGTGACAAATAATAAAACGTCAGAAGTTGCAT	4281	0	UF_Msa_AF_105742	contig23175___1_nrnt	contig23175___1_nrnt	Unknown	
4413	54	67	unmapped	0		0	TTGACCGCATGGTGGAAGATGTTGAGAAACAGATCGAGAAGCGGGCCAAGTACAGACGAC	4283	0	UF_Msa_AF_103678	contig07389___1_nr0nt	contig07389___1_nr0nt	Unknown	
4414	54	68	unmapped	0		0	AATGAGGCCTGGAATCTCGTAGCCCACGAGTGTCCAAAATACTTCCGCTAAAGAGCCAAA	4285	0	UF_Msa_AF_108013	contig03690___1_nrnt	contig03690___1_nrnt	Unknown	
4415	54	69	unmapped	0		0	GGCCAAAACCAAGTTTATGATAACTCTCTCTTGTTCTTCAGAGAATATTCGGCCCCTTCC	4287	0	UF_Msa_AF_107345	contig12953___1_nr0nt	contig12953___1_nr0nt	Unknown	
4416	54	70	unmapped	0		0	TCAAAAACTAGCATCATCCTGACTTTAACCAGTAAGCTGGCCAGTGGAGAGTACACTGTG	4289	0	UF_Msa_AF_107407	contig16038___1rc_nrnt0	contig16038___1rc_nrnt0	Unknown	
4417	54	71	unmapped	0		0	TTAGGTCGATGACAAAGCCGGATAATGGTGAACCACAAACATTCATGCATTTTTAAAAAA	4290	0	UF_Msa_AF_100672	contig14022___1_nr0nt1	contig14022___1_nr0nt1	Unknown	
4418	54	72	unmapped	0		0	AGGGCAGGGAGAAAGAGAAGACTGGAGGAAAGAAAGACCAGAGTGTAGAGAAGGCTGAGT	4292	0	UF_Msa_CF_120613	contig02824___0rc	contig02824___0rc	Unknown	
4419	54	73	unmapped	0		0	AACAAATCAACCACTCTGGCAATCAATAAAGTCATATTCCTCAGGGAAATTGCATTTGAG	4294	0	UF_Msa_CF_118943	contig14432___0	contig14432___0	Unknown	
4420	54	74	unmapped	0		0	AATGCACGTCCGCGCACACGACTTTCAAACACAGCAGTAACAACCTCTGATCCAGAGGAT	4296	0	UF_Msa_AF_106130	contig09520___1_nr0nt	contig09520___1_nr0nt	Unknown	
4421	54	75	unmapped	0		0	AGTTTTGTTATCAGTGGAGTCCCAGTTCTTCCACAACATCAGCCCCTTCTACCAGAAGAA	4298	0	UF_Msa_CF_126351	contig02428___0	contig02428___0	Unknown	
4422	54	76		1028	E1A	0		799	1	(+)E1A_r60_n9	E1A_r60_n9	E1A_r60_n9		CONTROL
4423	54	77	unmapped	0		0	TTCAGTTTGACAGCGTGAAGTCTCGAAGGTGTCTCGTGTTGGCAAAGTTTTCATCAAAGC	4301	0	UF_Msa_AD_200055	LMB_Add_165_rc	LMB_Add_165_rc	Unknown	
4424	54	78	unmapped	0		0	AGTATGGAGGGAGGAGTTGAGGATGGAGAAAAGAGAGAACACTCATCCCTCCCTCCTGCT	4303	0	UF_Msa_CF_121058	contig07401___0rc	contig07401___0rc	Unknown	
4425	54	79	unmapped	0		0	AGCGGTCCACTACTGCAACATCTTTAGAAAAGTTCATTCTGAAATAAATTTGGAGTCTTG	4305	0	UF_Msa_CF_123648	contig07728___0rc	contig07728___0rc	Unknown	
4426	54	80	unmapped	0		0	ATCTCTGGGCCTGAAACCAAGTCCAGAACAGCTGCCAACAGTGGAGCCCCTGGAGAAACT	4307	0	UF_Msa_CF_121347	contig26093___0rc	contig26093___0rc	Unknown	
4427	54	81	unmapped	0		0	TCTGACTTTCCTCGGAGACGATCCAGCTCACCCTGGACTGTTTTCGCGCATTGTTCGTGG	4309	0	UF_Msa_AF_104056	contig25864___1rc_nrnt-1	contig25864___1rc_nrnt-1	Unknown	
4428	54	82	unmapped	0		0	TCAACAGGAAGGAGCAGCAGGTCTGAGCTCCTCACCCCGCCATGCTGAGTCTTCTTCAAT	4311	0	UF_Msa_CF_125813	contig20668___0	contig20668___0	Unknown	
4429	55	1	unmapped	0		0	AATGGACGCTGTGTCCTGGAGGCTGAGATGTGCTCCCTGATGGAGGGCCTGGGTCTCAAC	4312	0	UF_Msa_AF_102362	contig24518___1rc_nrnt-1	contig24518___1rc_nrnt-1	Unknown	
4430	55	2	unmapped	0		0	TTCGCTCAGAACGTCATTGCCTTCAGCGTACTACTAACATCGTCAGCCCGCTCAGCTACG	4314	0	UF_Msa_AF_103028	contig09667___1rc_nr0nt	contig09667___1rc_nr0nt	Unknown	
4431	55	3	unmapped	0		0	AGGGCTCCTGCCTGAGGTACTATCACGTATTCAGGGAGGGAGAACTGGCAGACCTGATAG	4316	0	UF_Msa_AF_107213	contig11635___1rc_nrnt0	contig11635___1rc_nrnt0	Unknown	
4432	55	4	unmapped	0		0	AGACAGAAGCACCTGCGCCGAAACCGGTGAAGAAGAACAAACACAAAGCGTTCAAAAGAC	4318	0	UF_Msa_AF_104239	contig06903___1rc_nrnt0	contig06903___1rc_nrnt0	Unknown	
4433	55	5	unmapped	0		0	CAAAGAGCTGAGTGAAGTCAGCGAGGCAACAGAAAGCACAGACGTTAAAGATTCTTCTTC	4320	0	UF_Msa_AF_108021	contig31443___1_nr0nt1	contig31443___1_nr0nt1	Unknown	
4434	55	6	unmapped	0		0	AAAGAAAACACCACAGAGTGGTGAAGAGAATGAAAGTGACACGGATGGCAAGTCAGAAAG	4322	0	UF_Msa_CF_127604	contig09217___0	contig09217___0	Unknown	
4435	55	7	unmapped	0		0	CTCCAACAAAACTGGAAGACTTATTGTTGAAGAAGTCCCAGGGGACTTCACTCAGTCAGA	4324	0	UF_Msa_AF_102388	contig11267___1_nrnt	contig11267___1_nrnt	Unknown	
4436	55	8	unmapped	0		0	ACTCCTTACAAAACTTTTGGCTACATTAACATCAACATTTCAGACGCAGATCTGAAGAAA	4326	0	UF_Msa_CF_119706	contig12102___0	contig12102___0	Unknown	
4437	55	9	unmapped	0		0	TGATATGTGCAGCTTGCAGCTCAGTGACTGCTGCTAAAGAGCCGTTTCTGTTCAATGCAG	4328	0	UF_Msa_CF_117893	contig25464___0rc	contig25464___0rc	Unknown	
4438	55	10	unmapped	0		0	ACTTCAGAGCGACAAGTAACAATGGGTCAAAGCCAGAGTGGAGGCCACGGTCCAGGTGGA	4330	0	UF_Msa_AF_100364	LMB_S454.649.C1___1rc_nr0nt1	LMB_S454.649.C1___1rc_nr0nt1	Unknown	
4439	55	11	unmapped	0		0	TCCAGACCACCGCTGACACCCGTGGATAAGTAGCTGCAGCGGCCGGCACGGGAACTCTGT	4332	0	UF_Msa_AF_103191	LMB_S454.14.C1___1_nr0nt1	LMB_S454.14.C1___1_nr0nt1	Unknown	
4440	55	12	unmapped	0		0	ATGCAAATGTTTTGTGTCCCAGTGATGAAGACCAGGACACAGACACTGAGATCTGCACTA	4334	0	UF_Msa_CF_126877	contig30764___0	contig30764___0	Unknown	
4441	55	13	unmapped	0		0	GCGTATTGGACGTATAATCACAGCCGAGAGGCACCCGGATGCTGACAGTCTCTATGTGGA	4336	0	UF_Msa_CF_117808	contig03088___0rc	contig03088___0rc	Unknown	
4442	55	14	unmapped	0		0	AGCCATACACAGAGCTGCCCACTCAGACATCGGCACCGACGGAGCAGGTGTCTGTCACTA	4338	0	UF_Msa_CF_127585	contig11122___0	contig11122___0	Unknown	
4443	55	15	unmapped	0		0	AATGTGATGGAGAGCACCATCAAGCAGTCGGAGAATGACCTGAATAAGCTTCTAGAAACA	4340	0	UF_Msa_AF_104103	contig32436___1rc_nrnt	contig32436___1rc_nrnt	Unknown	
4444	55	16	unmapped	0		0	TATTTACCTACCTGTACAGCTGGATTATGCTGGGGTATTTAGCAGTCAAAGTCGGAGGTG	4342	0	UF_Msa_AF_109724	contig10982___1rc_nrnt0	contig10982___1rc_nrnt0	Unknown	
4445	55	17	unmapped	0		0	AGCAGATCTACAACTACATCAGCATGTAGTCGGTATTCTGAACAACTACTGCCCAATCTG	4344	0	UF_Msa_CF_119072	contig05628___0rc	contig05628___0rc	Unknown	
4446	55	18	unmapped	0		0	TCTGGACAAATGAAGGAAAACTCTGTCCTCAACCAGTCATGGTGCTACTCTTCCAACAGA	4346	0	UF_Msa_CF_126723	contig10441___0rc	contig10441___0rc	Unknown	
4447	55	19	unmapped	0		0	TCAAGAACGTGTCCGTCAAGGAAATCCGTCGTGGATACGTGGCTGGCGACAGCAAGAACG	4348	0	UF_Msa_AF_107066	contig18043___1_nrnt	contig18043___1_nrnt	Unknown	
4448	55	20	unmapped	0		0	TGCGCCTCAGCATGTGTGGTCAGAAAGTACCACTTGGTCTCAGGGGGTGTTGGTACGACA	4350	0	UF_Msa_AF_104303	contig08512___1_nrnt	contig08512___1_nrnt	Unknown	
4449	55	21	unmapped	0		0	ACACATTAGCTGTTGATTAAATGATCGGAGCCACTTCTCCTCTAACAGTCAGGAGGAGGA	4352	0	UF_Msa_CF_121785	contig18696___0rc	contig18696___0rc	Unknown	
4450	55	22	unmapped	0		0	GCGAGGTGACCGACAGATTCCTGCCTGTGGTAGCACAGTTGCTCTCCAGTAAAGGGTTTA	4354	0	UF_Msa_AF_108299	LMB_S454.1012.C1___1rc_nrnt-1	LMB_S454.1012.C1___1rc_nrnt-1	Unknown	
4451	55	23	unmapped	0		0	CAGCATGTTTACTTGTTAGCCAAGTTAGCAAGTTGCAATCATTAGCATTATTGAGCTAAC	4356	0	UF_Msa_CF_118622	contig13176___0rc	contig13176___0rc	Unknown	
4452	55	24	unmapped	0		0	ACTCTACATCCTCAAGGGCGGATACAAAGACTTCTTCCCTCATTACCAGTCTCAATGTGA	4358	0	UF_Msa_AF_103237	contig00811___1rc_nrnt	contig00811___1rc_nrnt	Unknown	
4453	55	25	unmapped	0		0	ATGGAGAGAACACATGAATATAAATTAATATTTGGTTGTGAAGAACCTGAAGCCACCACA	4360	0	UF_Msa_CF_126696	contig03072___0rc	contig03072___0rc	Unknown	
4454	55	26	unmapped	0		0	TGACGCAGCTGGCTCCTCTATTGCATATTCTAGTGTAGACAAATCTTCTTCAGGCTGTGT	4362	0	UF_Msa_AD_200244	LMB_Add_164_rc	LMB_Add_164_rc	Unknown	
4455	55	27	unmapped	0		0	TAGGGGGTTTTGACACATTTGTTCACCCATGTTTCTCCAGTGGAAATGTTTAACGTGGAC	4363	0	UF_Msa_AF_108449	contig09328___1_nr0nt1	contig09328___1_nr0nt1	Unknown	
4456	55	28	unmapped	0		0	TACAAAGATGATCACGAGTAAGGGAGAGGGGAAATAAATGCTGATTTTGATGGTAATTTG	4365	0	UF_Msa_AF_106114	contig10229___1_nr0nt	contig10229___1_nr0nt	Unknown	
4457	55	29	unmapped	0		0	CAGCCATGGCAAAGGATGAGCGCGTGGATCTGGTAGTCGTTTACTGGCAGCACCCATGTT	4367	0	UF_Msa_AF_109092	contig09647___1rc_nr0nt1	contig09647___1rc_nr0nt1	Unknown	
4458	55	30	unmapped	0		0	AGAGACAAAACAAGAACAACCCTACATCAAACCCTGAACCCCAGAGTCTGAGTCGACAAA	4369	0	UF_Msa_CF_121127	contig27887___0rc	contig27887___0rc	Unknown	
4459	55	31	unmapped	0		0	ATGTGAGGCAGCACTGAGATGCCCCTATCACTCTAAAAGTGCCCTGGCAAGTTCAGGGTG	4371	0	UF_Msa_CF_120753	contig00114___0rc	contig00114___0rc	Unknown	
4460	55	32	unmapped	0		0	GTTCAAGTGGCTCATCAAGTATTCTCCTCTCCACAATCTGCCTCAACCTCCTTACTCTGG	4373	0	UF_Msa_AF_101512	contig01081___1_nrnt	contig01081___1_nrnt	Unknown	
4461	55	33	unmapped	0		0	TATTTACAAGATGGTTCCTCTGTGATGAAGATGCCTGAGGATGAGGCCACACCTGAGAAA	4375	0	UF_Msa_AF_105020	contig03651___1_nr0nt1	contig03651___1_nr0nt1	Unknown	
4462	55	34	unmapped	0		0	CTCTGAAAAAGGAATCACGCGAGAAAACTAGACAAGAAGCTCCCAGGAAAGGAGAAAGAT	4377	0	UF_Msa_CF_124364	contig08092___0rc	contig08092___0rc	Unknown	
4463	55	35	unmapped	0		0	ACTATGGCCTGGCTGCTCTGGCCATCAATACCAGCATCCTGAGCCGCTTGCCCTCTGACC	4379	0	UF_Msa_AF_106713	contig12308___1_nrnt	contig12308___1_nrnt	Unknown	
4464	55	36	unmapped	0		0	CGACTTAAAATGCAATCTGTCATTCATGACTAAAACTGTATTTCCCATGCTCTTTTGTGT	4381	0	UF_Msa_AD_200115	LMB_Add_46	LMB_Add_46	Unknown	
4465	55	37	unmapped	0		0	ATCTGGCTGGTGGATTATGGTACCGAGTGTTTCAGCAATAAAGCCGGGGTGAAAGGAGAT	4383	0	UF_Msa_CF_126030	contig11746___0	contig11746___0	Unknown	
4466	55	38	unmapped	0		0	ACTTCTCCAACAGCTGCCTCTGCTCTTGCTTGTCGTCTTTCTTCACAGAGACAGAAATCT	4385	0	UF_Msa_AF_108864	contig23865___1_nr0nt1	contig23865___1_nr0nt1	Unknown	
4467	55	39	unmapped	0		0	CTGAAGGAAGCCACTGTTCACTGAGTGACTTGACTAATCGTGTTAAATCCATCCAAATAA	4387	0	UF_Msa_CF_125458	contig19860___0	contig19860___0	Unknown	
4468	55	40	unmapped	0		0	CAAAACAGGTGAAAACAATCCACAACTCCAAATGCTGGTCACCAGTCATGAACAATAAAC	4389	0	UF_Msa_CF_121411	contig24190___0rc	contig24190___0rc	Unknown	
4469	55	41	unmapped	0		0	CTCACAAGAGATCACGACAAGAGAAGTTATCAAAACTGTCCTTTAAGACATGATGCTACA	4391	0	UF_Msa_AF_105029	LMB_S454.272.C1___1_nrnt	LMB_S454.272.C1___1_nrnt	Unknown	
4470	55	42	unmapped	0		0	AATCACACTGTGGAGGAAAGGGGACGTGGTGAGGAAGAGCATGTCTCATCAGGCCGCCAT	4393	0	UF_Msa_AF_103960	contig20157___1_nrnt	contig20157___1_nrnt	Unknown	
4471	55	43	unmapped	0		0	GAAAAAAGAGAAGCTTCCTGTTGACGTGACTCCATCCTCTGAAGAAACCACACTTGACAA	4395	0	UF_Msa_CF_120841	contig03505___0	contig03505___0	Unknown	
4472	55	44	unmapped	0		0	TACCTGAAGATATGGCATCTTTACTGAAAGCCTCACTGGGACTGTAATGGCAAACACACC	4397	0	UF_Msa_CF_125364	contig30119___0	contig30119___0	Unknown	
4473	55	45	unmapped	0		0	CCATCGTCAGCCTGAAGGCCCCCAGGAAGCTCAAAGCCTGTCACTTCAAGAAGGGAACTG	4399	0	UF_Msa_AF_104741	contig17500___1rc_nrnt	contig17500___1rc_nrnt	Unknown	
4474	55	46	unmapped	0		0	ATGTTTCTGAAGAGAGGAAGGGAAGATAGCCCATAGCTCTCTCTTGCTTGAACAAATTGT	4401	0	UF_Msa_AD_200228	DQ786407_rc	DQ786407_rc	Unknown	
4475	55	47	unmapped	0		0	TCTGTGTTCCTGTCCAGTGTCTGAAATGTAATGTCACAGAACTGCGTAAGTCAGGATGCA	4402	0	UF_Msa_CF_117756	contig06212___0rc	contig06212___0rc	Unknown	
4476	55	48	unmapped	0		0	TCCCACAGAGATGGCCTGTGTGGAGCACATCTTCACTCCCTCTTTGCCGCACTCCTGTTT	4404	0	UF_Msa_CF_125928	contig19712___0rc	contig19712___0rc	Unknown	
4477	55	49	unmapped	0		0	ACATTCCCAAGATGTTGGAGTTGTTTAAAACCGGTCATGAGTACATGGTGGAGAGCGACT	4406	0	UF_Msa_AF_101391	contig16799___1rc_nrnt-1	contig16799___1rc_nrnt-1	Unknown	
4478	55	50	unmapped	0		0	GAATGCCCTGGCTCCCTCCAAGCTGATAGAGAGGAGAATACTTCCAGTTCCACCACCACC	4408	0	UF_Msa_CF_126159	contig29367___0	contig29367___0	Unknown	
4479	55	51	unmapped	0		0	TCCACCTTTAACCCAGCTGAGGTCTATGTGCGCTCCACTAACATTGTGAGGACCATTGAA	4410	0	UF_Msa_CF_126356	contig09498___0	contig09498___0	Unknown	
4480	55	52	unmapped	0		0	ACCCGCTTCACCATTAACAATCCGTCTCCACGCTACTAATAAATCCCTGGGAAAATAGCA	4412	0	UF_Msa_CF_124359	LMB_S454.427.C1___0	LMB_S454.427.C1___0	Unknown	
4481	55	53	unmapped	0		0	CTAAAGATGAATCTGAACACAGAGTAGAAAACAAAGAGCACTGGGAGGGATGAGTATGTG	4414	0	UF_Msa_CF_126879	contig02363___0rc	contig02363___0rc	Unknown	
4482	55	54	unmapped	0		0	TTACAGTCCACCTGGAAAAGATAAATAAAATGGAGTGGTGGAGCAGGATTGTTACCACAG	4416	0	UF_Msa_AF_106856	contig15129___1_nrnt	contig15129___1_nrnt	Unknown	
4483	55	55	unmapped	0		0	AAAGAGACGGAGAAGTTCATGCAGCGGCTCAGTGAGTTTGCAGGGGAACATGGGATGAGT	4418	0	UF_Msa_AF_103831	contig06487___1rc_nrnt0	contig06487___1rc_nrnt0	Unknown	
4484	55	56	unmapped	0		0	TTACACAGCTCAGGGCAAAACTCTGCTGGAAGTTGTTGCCTTTAAAGAGCTTCCAGACTT	4419	0	UF_Msa_CF_127367	contig26737___0	contig26737___0	Unknown	
4485	55	57	unmapped	0		0	GCATACAATCATTTGGAAACGTCTTTTCAACAGCTACTTAGACATTTAAGCAGGTTTAGA	4421	0	UF_Msa_CF_117801	contig21431___0	contig21431___0	Unknown	
4486	55	58	unmapped	0		0	AGAAGAAGAAGAAGAAGTAAGGCACGTCTGACTGAAGAAACTTGGTCCACCAACACCTGA	4423	0	UF_Msa_CF_124041	contig29233___0rc	contig29233___0rc	Unknown	
4487	55	59	unmapped	0		0	CCTGAAGATGACTGCTGAAACTCTGGTAGACCTCGATGTGAATTTGTCTGAAGATGATGT	4425	0	UF_Msa_AF_108410	LMB_S454.sd.248.C1___1rc_nr1nt0	LMB_S454.sd.248.C1___1rc_nr1nt0	Unknown	
4488	55	60	unmapped	0		0	TCAATATCAAAGCACATATTGGAACACAGACAGGAAATGAGAAGGCTCCCAGCACACTGG	4427	0	UF_Msa_CF_125488	contig17245___0rc	contig17245___0rc	Unknown	
4489	55	61	unmapped	0		0	GTATGAAAACTACCCTAATCCTGCTTACACTACCTTCTCTTAAGTATCCTGTCAGTATAA	4429	0	UF_Msa_CF_126383	contig01934___0rc	contig01934___0rc	Unknown	
4490	55	62	unmapped	0		0	TTGTTTATTTGTTCTCAATATGCTATCATCTTATCCTAATACTGTCTTTGTCTTCAATGG	4431	0	UF_Msa_AF_108808	contig22001___1_nr0nt	contig22001___1_nr0nt	Unknown	
4491	55	63	unmapped	0		0	CCCCCTCACGACGTTACACGTGTCACAAAAGCCATGGAGGAATACTTCCAGGTGTCAGAT	4433	0	UF_Msa_AF_108525	contig25944___1_nrnt0	contig25944___1_nrnt0	Unknown	
4492	55	64	unmapped	0		0	GACCAGGTCCACACTCCTGTTTTCGTCACAGAAGACGAACATGGATAATAATTTCTGCCA	4435	0	UF_Msa_CF_122755	contig06466___0	contig06466___0	Unknown	
4493	55	65	unmapped	0		0	AATCGGTTAACACTCCTTGATAAGACCACAGCTGTAACAAAGAGACAGACAGACTCTACA	4437	0	UF_Msa_CF_118736	contig10250___0	contig10250___0	Unknown	
4494	55	66	unmapped	0		0	GATTCTTCAACGTCGGCAAGAAGGAGAAAAACAGTCAGAAAATGCGTGAGTGTATTTCAA	4439	0	UF_Msa_CF_125045	LMB_S454.633.C1___0	LMB_S454.633.C1___0	Unknown	
4495	55	67	unmapped	0		0	TGGGACTGAACTTGACAATTCAGACAACTCCCTCAGTTAGAGCTGGAGACTCTTTAAGGA	4441	0	UF_Msa_AF_105663	contig29760___1_nr1nt0	contig29760___1_nr1nt0	Unknown	
4496	55	68	unmapped	0		0	TTCATGCTGTGGATAAAGAGTGCAGCTCTGGGGTGGAGGTGACGACCACAGCCAAGCCCA	4442	0	UF_Msa_CF_125360	contig07709___0	contig07709___0	Unknown	
4497	55	69	unmapped	0		0	TGTGAAAGTACGACCTGATAATCCCTCATCCAATGGACTTGCAGCAGAAGGAGATGCAAA	4444	0	UF_Msa_CF_126120	contig02200___0	contig02200___0	Unknown	
4498	55	70	unmapped	0		0	CACTCCCTCCCGAATGACAGACAACAGTAATGAAACCACAGGTCTGCTGTTCTCTGAAAG	4446	0	UF_Msa_CF_118227	contig17079___0	contig17079___0	Unknown	
4499	55	71	unmapped	0		0	CCTAAGCCAGACCCCAACCATTGCCTGTCACTGATCGGAACACAAGCTCTCTCTGTCTCT	4448	0	UF_Msa_CF_120112	contig08186___0	contig08186___0	Unknown	
4500	55	72	unmapped	0		0	GACACGATCACATGTTTAGGATCAGTAACGACCGATCGCAAGCATTCCTTTTGTACACCT	4450	0	UF_Msa_CF_119418	contig09194___0	contig09194___0	Unknown	
4501	55	73	unmapped	0		0	AATCACGTCATGTCGGTGACGCTGTATTGTGCTTTAAGTAAATGCAGTCATGTTGATTTG	4452	0	UF_Msa_CF_121914	contig02585___0	contig02585___0	Unknown	
4502	55	74	unmapped	0		0	ATCAGACAGTCAAAGTCTGGGAGTGCCGCTGAGACTGCCTCCATTCTCTTGCCCTGTCCT	4454	0	UF_Msa_AF_103469	contig10584___1_nr0nt	contig10584___1_nr0nt	Unknown	
4503	55	75	unmapped	0		0	AAAGTCTGGCCGTAATGGAGAAAGTTCCACCATTCACTTCAGCTTCGACATGTTTCGCTT	4456	0	UF_Msa_AF_101046	contig30004___1rc_nr1nt0	contig30004___1rc_nr1nt0	Unknown	
4504	55	76	unmapped	0		0	ATCGCTGAACTTATATTACTTCTGTTTACAAGCCTCATGACGGCCGCCATAATGGTCAGC	4458	0	UF_Msa_CF_123171	contig10180___0rc	contig10180___0rc	Unknown	
4505	55	77	unmapped	0		0	GCCCGTCACTATAAAATCACCTCCAAATATTCTATACAGAATACTCTGCAGGTATTTTGA	4460	0	UF_Msa_CF_121211	contig00158___0	contig00158___0	Unknown	
4506	55	78	unmapped	0		0	AAACATCTGCGCTCTTGGCAGCACCATGTTCCTGATCGGTCCGCTAAGGCAGCTGAAGAC	4462	0	UF_Msa_AF_101865	contig13059___1rc_nr1nt0	contig13059___1rc_nr1nt0	Unknown	
4507	55	79	unmapped	0		0	GCAAGTCCTACTTTGTGTAGCTCTTATGAATCACTATTTTTGCACTTGTTTTGTACACTT	4464	0	UF_Msa_AF_108292	contig01019___1_nr0nt1	contig01019___1_nr0nt1	Unknown	
4508	55	80	unmapped	0		0	TACAGTGCATCTGAGCACACAGACACAGCAGGCCTAAACACTAAAACACACACTCTGTTA	4466	0	UF_Msa_CF_117903	contig19805___0rc	contig19805___0rc	Unknown	
4509	55	81	unmapped	0		0	TCTGTCCTAAAACTGTTTAACTTATTGGGATTGTATGTTTGCGAGTGTTGAAGCACAAAC	4468	0	UF_Msa_AF_109552	contig32046___1_nr0nt1	contig32046___1_nr0nt1	Unknown	
4510	55	82	unmapped	0		0	ACAACATGTCAAATCTCCGACCCAGACTGTGTGTGCTGGAGAAAGGTCCCAGCGGCTACG	4470	0	UF_Msa_AF_103632	contig21873___1rc_nrnt	contig21873___1rc_nrnt	Unknown	
4511	56	1	unmapped	0		0	GAGGCCAGAAACTTCATGATGGACAAGAACAGGTGTGTAATCCAGAGGTTGTTGCCCTTC	4313	0	UF_Msa_AF_100575	contig10940___1_nrnt	contig10940___1_nrnt	Unknown	
4512	56	2	unmapped	0		0	AAAGGTAACAGTACGCCCAACTCCAAAAACAAACTGAAGAAGCGCTTTTCTCTGCGGAGT	4315	0	UF_Msa_AF_100710	contig11463___1_nrnt0	contig11463___1_nrnt0	Unknown	
4513	56	3	unmapped	0		0	TTGGACAGGTACTGGCATGAGGACTGTCTGAAATGTGCTTGCTGTGACTGTCGCCTGGGC	4317	0	UF_Msa_AF_108664	contig16290___1rc_nrnt	contig16290___1rc_nrnt	Unknown	
4514	56	4	unmapped	0		0	AGGCAGTGTTCTTCCAGTCCCACAGTATGAAGGCTGAGGATGCAATGAGACTGTACTACG	4319	0	UF_Msa_AF_104650	contig24868___1rc_nrnt	contig24868___1rc_nrnt	Unknown	
4515	56	5	unmapped	0		0	TACTGATGAGGCCGCCACAACCTCTCACTGCTCCAGATCATTCCCTACTGTTATCTTTTC	4321	0	UF_Msa_AF_105944	contig25870___1_nr0nt1	contig25870___1_nr0nt1	Unknown	
4516	56	6	unmapped	0		0	ACAGGCAATATCAAGAAGAGGAGAAGCTAGCCTTCAACCGGACAAGGGAATTCTGCAAAA	4323	0	UF_Msa_CF_118714	contig06952___0	contig06952___0	Unknown	
4517	56	7	unmapped	0		0	TATTCTGGTACCGTGATGCATATGTACACCTTCCTGGATATGCCCCCAATACAACACTTG	4325	0	UF_Msa_CF_125870	contig18074___0	contig18074___0	Unknown	
4518	56	8	unmapped	0		0	ACATGACTGATTTAAGCTGAAAAGAGAAAGATGGTCCCTTCATGTGGAGTTTTTTGTTTG	4327	0	UF_Msa_AF_100964	contig04437___1rc_nr1nt0	contig04437___1rc_nr1nt0	Unknown	
4519	56	9	unmapped	0		0	AAGGTGTTTTGCACAATGGATGGCCATGGATCAATGGTTCACATCCATCCATCATCATCG	4329	0	UF_Msa_AF_105250	contig20558___1_nrnt0	contig20558___1_nrnt0	Unknown	
4520	56	10	unmapped	0		0	TAGCAAAGCAAAGACCCACATATCCAGATTACCACCTGGGACTATTCCTGGACAGTGTTT	4331	0	UF_Msa_AF_107490	LMB_S454.sd.308.C1___1_nrnt	LMB_S454.sd.308.C1___1_nrnt	Unknown	
4521	56	11	unmapped	0		0	AGATTGCCCGGGACAAAGTGGTGGGGAAAGACTATCTGCTCTGCGATTACAACCGAGACG	4333	0	UF_Msa_AF_100358	contig24681___1rc_nrnt	contig24681___1rc_nrnt	Unknown	
4522	56	12	unmapped	0		0	ACCTGTTTGTCTGTGGGCTCAGGCTCCATGTACGCCTACGGTGTGATGGACAGCGGCCTG	4335	0	UF_Msa_AF_108349	contig14085___1_nrnt	contig14085___1_nrnt	Unknown	
4523	56	13	unmapped	0		0	ACATCGTGTCCAGTCTACCGAGAGGCACAGGACTGACAGACACTAGCGACTCAGCTGCTT	4337	0	UF_Msa_AF_110143	contig09662___1_nr0nt	contig09662___1_nr0nt	Unknown	
4524	56	14	unmapped	0		0	TTTGATGCCTCTGCCGCCTACATACCTCCGCCTCCTTATTCTGCTCCTCTGGGCCAGCAG	4339	0	UF_Msa_CF_125962	contig30815___0rc	contig30815___0rc	Unknown	
4525	56	15	unmapped	0		0	ACCGACAAAAGAGTGAAGAGAGTCAAATCTCGAAGTTGAGGGCCATGGCTCGCGGGCAGA	4341	0	UF_Msa_AF_101909	contig30615___1_nr0nt	contig30615___1_nr0nt	Unknown	
4526	56	16	unmapped	0		0	TTCTGTCCCATGGCTGCTGTTAGTGGTGTCAACATGGTGTCCCAGCTCGGAAACGTGGCA	4343	0	UF_Msa_CF_122889	contig09191___0	contig09191___0	Unknown	
4527	56	17	unmapped	0		0	CCTGTAGAGGAGCAGCTGAGGTTTCAGGGAGTCAGAATCAGGAAGCTGTGAGGGATCAAC	4345	0	UF_Msa_CF_123060	contig11358___0	contig11358___0	Unknown	
4528	56	18	unmapped	0		0	ATGCTGCCAGAATAGAGACCGCGATCAAAACCAAAGGAGTGGATGAACAGACCATCATTG	4347	0	UF_Msa_AF_108723	contig03225___1rc_nrnt	contig03225___1rc_nrnt	Unknown	
4529	56	19	unmapped	0		0	AGATGTTCAGAGCTTTTCTAACGGAGTGGGCCGTCAGTGGAAGCATGTAGGGAGGGCCCT	4349	0	UF_Msa_AF_102342	contig09603___1rc_nrnt0	contig09603___1rc_nrnt0	Unknown	
4530	56	20	unmapped	0		0	TGTTCCAGAGTTCATCTTTGGAGAGCCTTCCCCACCCTGTCACTGTGTGGAGGTGGCAGT	4351	0	UF_Msa_CF_124228	contig13352___0rc	contig13352___0rc	Unknown	
4531	56	21	unmapped	0		0	ATTCAGACTCTGGTTGAGATCCTTAGCACTGGCTAAGAGAGAATACACGAGTAACTCAGG	4353	0	UF_Msa_AF_104396	contig21346___1_nr0nt	contig21346___1_nr0nt	Unknown	
4532	56	22	unmapped	0		0	GGTGGAATCACGATGGACATTTGTTTTAGATTTATAGAATAAAGTTTTGGCAGGCAGTTA	4355	0	UF_Msa_AF_106587	contig29923___1_nrnt	contig29923___1_nrnt	Unknown	
4533	56	23	unmapped	0		0	ACAACAACCATATCCGGCTCAAGAGTTCAGAGAAAGATGAGAATTCAACTTCACCACCAG	4357	0	UF_Msa_CF_123839	contig08631___0rc	contig08631___0rc	Unknown	
4534	56	24	unmapped	0		0	GCCAAGCAGATAAAGGCTTCTTAGGACTAGATTGTTGATGAATGGTAGACAAAATATTAT	4359	0	UF_Msa_AF_108265	contig28559___1rc_nr1nt0	contig28559___1rc_nr1nt0	Unknown	
4535	56	25	unmapped	0		0	GAAAATTGGAAAAACTTTTAAGTGTTTGGTCCTCATAATCCATCCACTCTCTTTCCCTAA	4361	0	UF_Msa_AF_107952	contig29167___1rc_nrnt-1	contig29167___1rc_nrnt-1	Unknown	
4536	56	26		1028	E1A	0		853	1	(+)E1A_r60_a97	E1A_r60_a97	E1A_r60_a97		CONTROL
4537	56	27	unmapped	0		0	TCTGTGTTCTTCACCAGAGTCAGCACTCTTCCTGCAACCAGCACTCGCCAGTGTCATCTA	4364	0	UF_Msa_AF_102769	contig15584___1_nrnt	contig15584___1_nrnt	Unknown	
4538	56	28	unmapped	0		0	GTGTTTGTAGCAGAGCCTGGATACTGATGTTGGTAGAAGAGCAGACCTGAGGACTCTTGG	4366	0	UF_Msa_CF_122261	contig25055___0rc	contig25055___0rc	Unknown	
4539	56	29	unmapped	0		0	TGTAAGGAATAACGGACTGAACTGTCTGATCAATAACGCTGCCATCGGACTCCTTACAGA	4368	0	UF_Msa_CF_125765	contig10367___0	contig10367___0	Unknown	
4540	56	30	unmapped	0		0	ATCTGAAACTTAAAATCTCCAACACAACCCTGACTACTTAGTTTTTTCCCACGGCATGGT	4370	0	UF_Msa_AF_107641	LMB_S454.sd.235.C1___1rc_nrnt	LMB_S454.sd.235.C1___1rc_nrnt	Unknown	
4541	56	31	unmapped	0		0	TTCAACAATTCTGCGGCGTTAAGGAGACATTTCCGGTTAAACCGACAAATCCTGACAGTG	4372	0	UF_Msa_AF_101038	contig16609___1rc_nrnt0	contig16609___1rc_nrnt0	Unknown	
4542	56	32	unmapped	0		0	GATGAACTGGGGATTTCCTACCTGTGGGGCATTGTCAGCTGGGGAGAGAGATGTGGTCAG	4374	0	UF_Msa_AF_108673	contig19735___1_nrnt	contig19735___1_nrnt	Unknown	
4543	56	33	unmapped	0		0	TTGGCATAACACATCTCATTCCGACACTGGCTGGGCTGGCTCTTCCCTGGTGGGCCCTGG	4376	0	UF_Msa_CF_124631	contig19328___0	contig19328___0	Unknown	
4544	56	34	unmapped	0		0	GTCTGGAGCAGCTTTCTACTACCAACAGTCTGATGTCAGAGACCAACCCTGGGCTGAAAA	4378	0	UF_Msa_AF_100961	contig13460___1rc_nrnt0	contig13460___1rc_nrnt0	Unknown	
4545	56	35	unmapped	0		0	ATCAACGCTGAGGAGGTGGTGGTTGGCGATTTAGTGGAGGTGAAAGGTGGTGACAGGATC	4380	0	UF_Msa_AF_106905	contig22148___1rc_nr0nt1	contig22148___1rc_nr0nt1	Unknown	
4546	56	36	unmapped	0		0	TTCTGGAGGATTCTCAATGATGGAGCGGAGATCGTAGCACGTAGACGGTAGCATTGCTGG	4382	0	UF_Msa_CF_118697	contig23436___0rc	contig23436___0rc	Unknown	
4547	56	37	unmapped	0		0	GATATGGAATTCCAATGCCAAGAATATGGGGAAAAGTTTGTGAGCCTGTAATCTTCCTGT	4384	0	UF_Msa_CF_123742	contig21746___0rc	contig21746___0rc	Unknown	
4548	56	38	unmapped	0		0	ACATCATCAAGAGGTTTGAGACGAAAGGCTTCAAGCTTGTGGGCATGAAAATGCTCCATG	4386	0	UF_Msa_AF_107177	LMB_S454.sd.256.C1___1rc_nrnt	LMB_S454.sd.256.C1___1rc_nrnt	Unknown	
4549	56	39	unmapped	0		0	AGACAAACTGAACATGTCTCCCGAGGAAGCTGAGAGATGGATTGTAAACCTTATCCGCAA	4388	0	UF_Msa_AF_108995	LMB_S454.277.C1___1_nrnt	LMB_S454.277.C1___1_nrnt	Unknown	
4550	56	40	unmapped	0		0	AGGATAACACGATGCAGGGCATCACATTTTCCCAACAAAAGGCAAACCGCCATAAATGTC	4390	0	UF_Msa_CF_122464	contig24039___0	contig24039___0	Unknown	
4551	56	41	unmapped	0		0	ATCTGGGAATTCAACTTCAAGATGAGTTTGAACACCGGGAACACAAAACACCCTTTTCCT	4392	0	UF_Msa_CF_125213	LMB_S454.648.C1___0	LMB_S454.648.C1___0	Unknown	
4552	56	42	unmapped	0		0	AAGGAGGTGAGCGCTGTGAGCTGTCAGGAGAGACTGCAGCCGATAGATGGCCAGCACCAC	4394	0	UF_Msa_AF_107221	contig00410___1_nrnt0	contig00410___1_nrnt0	Unknown	
4553	56	43	unmapped	0		0	ATCCAAACGTCCCGCTGACTTCCTGCGGCTGACTTCCTGCTGCACTGATCGTGTTTTCAC	4396	0	UF_Msa_CF_122163	contig10000___0rc	contig10000___0rc	Unknown	
4554	56	44	unmapped	0		0	AATCAATTACGACGACTTCTTTGAAAAGTGCTGCCTCCCCGACACACTCAACTCTTGGTT	4398	0	UF_Msa_AF_103337	contig14332___1rc_nrnt	contig14332___1rc_nrnt	Unknown	
4555	56	45	unmapped	0		0	TGTCACAAGGACTCCCCTCAACAATGTTGCAGTTCAGAGGAAGAGCAAAAGTAAGAGCTA	4400	0	UF_Msa_CF_120018	contig29262___0rc	contig29262___0rc	Unknown	
4556	56	46		0		0		4169	1	ETG09_48764	ETG09_48764	ETG09_48764		CONTROL
4557	56	47	unmapped	0		0	ATCCTCCTCAAGCTCATACAGGAAGGAGTTCCTCTGCAGACGTACCTGCCTGACGTCAAA	4403	0	UF_Msa_AF_104873	contig16249___1_nrnt	contig16249___1_nrnt	Unknown	
4558	56	48	unmapped	0		0	AGGACATCTGCTTCTCTAAAGCTTCTGACCGCTCACTGCACGCACGCAGAGAGACCACCT	4405	0	UF_Msa_CF_123172	contig06230___0	contig06230___0	Unknown	
4559	56	49	unmapped	0		0	TGACCTGGAGAAGCTCACCTCTAGCGCCAAGTGACCGCTCACTGCTTAACTATCAACCCT	4407	0	UF_Msa_CF_122206	contig00762___0	contig00762___0	Unknown	
4560	56	50	unmapped	0		0	AGCAGAAGCTGATGGCCCGAGAGTAAAGACTAATAAAGTCCAGCTGTTGTTCAAAAAACG	4409	0	UF_Msa_AF_100275	contig31453___1rc_nrnt	contig31453___1rc_nrnt	Unknown	
4561	56	51	unmapped	0		0	AGCGGACGGCGAGTTGGGATATTTGAGAGTGACTCGGACTACGTCAAGCTTGCAAAGGGG	4411	0	UF_Msa_AF_100525	contig23159___1_nrnt	contig23159___1_nrnt	Unknown	
4562	56	52	unmapped	0		0	ACTCGCAGGCAGGTCGCTAGTGGTGGAGGACAGGTCATTAGCAACCCGAGAAAATGTTAT	4413	0	UF_Msa_AF_100372	contig02769___1_nr0nt	contig02769___1_nr0nt	Unknown	
4563	56	53	unmapped	0		0	ATGGCGGGAGGTCAGCAGCAGACTGACCGGGCATCGTGGAAAATCTCACCCCGGAGTATG	4415	0	UF_Msa_CF_122176	contig24009___0	contig24009___0	Unknown	
4564	56	54	unmapped	0		0	AAGACTGTGGTGCAGCTGAAGACCAGACAGCCCAGTGCACTCTCCCTACACCCCCACCCA	4417	0	UF_Msa_CF_124020	contig31222___0rc	contig31222___0rc	Unknown	
4565	56	55		130	HybridizationNegative	0		2244	1	(+)eQC-39	EQC	EQC		CONTROL
4566	56	56	unmapped	0		0	TACAATAAGAGCGTTAACAGTCTTTTTAGGCACTGAAGTCTCTGGAGTCCCACGTCAGGA	4420	0	UF_Msa_CF_119383	contig25495___0rc	contig25495___0rc	Unknown	
4567	56	57	unmapped	0		0	GAGTAGCAACAGATACCACATAGATAATCACCACATTTCTCTTCACTCATTAGTAAAGAT	4422	0	UF_Msa_AD_200364	LMB_Add_125_rc	LMB_Add_125_rc	Unknown	
4568	56	58	unmapped	0		0	AAAGAGAATCTGCCAAGCACAGACACACCATGGACCTCTGAAAATTGAATGGGTCATCCT	4424	0	UF_Msa_CF_126501	contig20092___0	contig20092___0	Unknown	
4569	56	59	unmapped	0		0	ATGTGGAGTGGCCCTCAGACCACTGCCTGGCCATGCTGACCCTTAGCCGTTAAAAACTTC	4426	0	UF_Msa_CF_118745	contig22848___0rc	contig22848___0rc	Unknown	
4570	56	60	unmapped	0		0	CAGCCACAGCGAGGCAGGTGAAATCAGTCTGGAGGGCATGGTGGTGCACAGAGCTGAATG	4428	0	UF_Msa_CF_126656	contig16682___0rc	contig16682___0rc	Unknown	
4571	56	61	unmapped	0		0	TCACTCTGATTTACATTAAAGGTTCAGTTTTGTTTCTGGACAACGAGCCACTAATTCAGG	4430	0	UF_Msa_CF_120962	contig22195___0	contig22195___0	Unknown	
4572	56	62	unmapped	0		0	TTATCAAGATGAAAAGCAGAAAGAGGAGAGATAGAAGAAGAAACAAACAACAGAACGGGA	4432	0	UF_Msa_CF_118394	contig25404___0	contig25404___0	Unknown	
4573	56	63	unmapped	0		0	CCATCTCTCAATGTGGACCACAGGGATGAGGATACATGAGGATAAAAACCTTGAAAACTA	4434	0	UF_Msa_CF_122664	contig32699___0	contig32699___0	Unknown	
4574	56	64	unmapped	0		0	TCAATGTGGCGACTTCCCACACTTGTTGGTGTATGGTCCATCAGGCGCGGGGAAGAAGAC	4436	0	UF_Msa_AF_110008	contig00872___1rc_nrnt-1	contig00872___1rc_nrnt-1	Unknown	
4575	56	65	unmapped	0		0	TTGACCTTTAACTGTACAAAATAATATTTACTGTTCTCATACGGATCAGCATCAGGACGA	4438	0	UF_Msa_CF_124322	contig25496___0	contig25496___0	Unknown	
4576	56	66	unmapped	0		0	ACAAATGCCACTGGTAACCCAGCCATCACCATCAGCCAGCCCTCTCCCTGTGTGGACTCT	4440	0	UF_Msa_CF_118068	contig21566___0rc	contig21566___0rc	Unknown	
4577	56	67		1028	E1A	0		390	1	(+)E1A_r60_3	E1A_r60_3	E1A_r60_3		CONTROL
4578	56	68	unmapped	0		0	AACTGTTAAGTAACGCAATGGATAACTTTGACAATTTCAGCGCGTCGGACAAAGCCGAGG	4443	0	UF_Msa_AF_105451	contig31193___1_nrnt	contig31193___1_nrnt	Unknown	
4579	56	69	unmapped	0		0	GGAGTTATAGATAACAACTGTGAAAGCACTGATTTGAGTGTACTTCTTACCACATGGTAG	4445	0	UF_Msa_CF_119130	contig26652___0	contig26652___0	Unknown	
4580	56	70	unmapped	0		0	CAAAATCAAACTTCCCTGGGTCAGCCAATCAGAGAGCGACAAGACTTACGCCAAGTAAAT	4447	0	UF_Msa_AF_101055	contig20775___1rc_nrnt0	contig20775___1rc_nrnt0	Unknown	
4581	56	71	unmapped	0		0	AATATATTGCACTTTGAAGACAAACTGAAAAAATAATCTCACAGGTAACGACAGCAACAA	4449	0	UF_Msa_AF_105607	contig08029___1_nr0nt	contig08029___1_nr0nt	Unknown	
4582	56	72	unmapped	0		0	TGTATCTCTTTCACCTGGCATGCTGGAGCTCCTGGCTTACCTGCAAGACTCGGAGCTCGT	4451	0	UF_Msa_CF_124551	contig25600___0rc	contig25600___0rc	Unknown	
4583	56	73	unmapped	0		0	AAACATCTGGACAACTGTGGGCATGTTGAACACAGAAAATCCATTCCCCTGCTCCATGAA	4453	0	UF_Msa_CF_122942	contig31371___0rc	contig31371___0rc	Unknown	
4584	56	74	unmapped	0		0	AGAAAACCGACGATGACGATTGATGCGTTTTCCCCCCTCGCGCCATCCTGCTGAACCACT	4455	0	UF_Msa_CF_119100	contig30554___0	contig30554___0	Unknown	
4585	56	75	unmapped	0		0	ACACACTTTCAACCCTTTCCACTTCCTGAATGAGGAGGGTAAATTTGTTTGTTTGAGTTT	4457	0	UF_Msa_AF_101060	contig27965___1_nrnt0	contig27965___1_nrnt0	Unknown	
4586	56	76	unmapped	0		0	TCAAAGGTGGTGAAAAGCGGATCTTCGGAGACTCGTGTGGAAAAGAGAATCGTCATAACT	4459	0	UF_Msa_AF_103300	contig02835___1_nr0nt	contig02835___1_nr0nt	Unknown	
4587	56	77	unmapped	0		0	TTCAGACATGGAGGAGTTTCACGGCCGTACGGTCCACGATGACGACAGCTGTCAGACCAT	4461	0	UF_Msa_AF_100514	contig11420___1rc_nrnt	contig11420___1rc_nrnt	Unknown	
4588	56	78	unmapped	0		0	CGAGCAGCTGTCTTCAGAAGCTCTGGAGGCTGCCCGTATCTGTGCTAACAAGTACATGGT	4463	0	UF_Msa_AF_107607	LMB_S454.1076.C1___1_nrnt	LMB_S454.1076.C1___1_nrnt	Unknown	
4589	56	79	unmapped	0		0	GCTGGACAGAAGTTTCTCTAGTCAGAAATTTGTGTTCAGTCATTATATTCTCTGTTTTGA	4465	0	UF_Msa_CF_124429	contig09315___0	contig09315___0	Unknown	
4590	56	80	unmapped	0		0	TCACCGCCTCGCCTTCCCAACTGTCACCTTTGACCTCAAACTAGTGCTGAGCAAAGTTAG	4467	0	UF_Msa_CF_127207	contig21549___0	contig21549___0	Unknown	
4591	56	81	unmapped	0		0	GGCCAGCAGCAGAGCTATAGTCAGTTCCGCTGTGGCGTCAGTCAGGACATCTGGAGTGTA	4469	0	UF_Msa_AF_108321	contig11044___1_nr0nt1	contig11044___1_nr0nt1	Unknown	
4592	56	82	unmapped	0		0	AGGTTCACCTCCACTCATCGGTTTACTTCTTCACAATGGCAGCTCCGAAGAAAGTCTGCA	4471	0	UF_Msa_AF_103166	contig07951___1_nr0nt	contig07951___1_nr0nt	Unknown	
4593	57	1	unmapped	0		0	GTACGAAAAGACGGAGGTCAACTCTGGGTTCTTCTACAAGAGTGCAGGTGAGAGGGAGAA	4472	0	UF_Msa_AF_100872	contig24266___1rc_nrnt	contig24266___1rc_nrnt	Unknown	
4594	57	2	unmapped	0		0	GGTGAGCTTCTGTTTACCACACAAAATCCATAGGCAACAAATGAGAACATTAAGAAAAAT	4474	0	UF_Msa_AF_100388	contig13576___1_nrnt	contig13576___1_nrnt	Unknown	
4595	57	3	unmapped	0		0	ATAAATACTTCGCTGTTGGTGGTAAACTGGAGCTGAGGCCTCAACCATCAGCAGCCATCA	4476	0	UF_Msa_CF_118599	contig03760___0	contig03760___0	Unknown	
4596	57	4	unmapped	0		0	GGGTTTAGTTCTTATCAAATGTGCTAATAAGAGTAACAGTTGTGCTTTGGTTCTGAAAGT	4478	0	UF_Msa_AF_106963	LMB_S454.917.C1___1_nr1nt0	LMB_S454.917.C1___1_nr1nt0	Unknown	
4597	57	5	unmapped	0		0	CTCACTGTCCTTCTCTTTATACTGTTGTTCCTTACTGTAAGAAACACTGAATAAATTCCA	4480	0	UF_Msa_CF_123842	contig31452___0	contig31452___0	Unknown	
4598	57	6	unmapped	0		0	AACTTGCTCCAGTGATCAAAGTGTCAAGGTTTGGGACAAAAGTGAGAATGGAGAGTGGCA	4482	0	UF_Msa_AF_108653	contig29920___1_nrnt	contig29920___1_nrnt	Unknown	
4599	57	7	unmapped	0		0	TGCTAACGGTGAAGCACCAAGGAGCCAAAGCGGTGTGCAGTCATGTGGCCTCTAGTTTGG	4484	0	UF_Msa_CF_127447	contig15596___0	contig15596___0	Unknown	
4600	57	8	unmapped	0		0	TTTGTGGAGACCAAGAGGCAAGCTGATTTTATTGCCACTTACTTGTGCCAGGAGAAGGTT	4486	0	UF_Msa_AF_103155	contig06407___1_nrnt	contig06407___1_nrnt	Unknown	
4601	57	9	unmapped	0		0	GTTTAGGCACAGTCATACCACACTACACCCTGCATGCTAACAGAGAAAAGCACTACACAA	4488	0	UF_Msa_CF_127541	contig28547___0	contig28547___0	Unknown	
4602	57	10	unmapped	0		0	AGTCTGTAGGCCTGGAGAACATGATTCTGTTGGGACACAGTCTGGGGGGATACCTGGCTG	4490	0	UF_Msa_AF_107713	contig16628___1rc_nrnt0	contig16628___1rc_nrnt0	Unknown	
4603	57	11		130	HybridizationNegative	0		578	1	(+)eQC-40	EQC	EQC		CONTROL
4604	57	12	unmapped	0		0	TCCTGGAAATGGTGCCGCATGAGCAGATCCCAGTAGTTTGTGGCTCTCTTCCTGACATCT	4493	0	UF_Msa_CF_121850	contig15561___0	contig15561___0	Unknown	
4605	57	13	unmapped	0		0	TGGAAAATCTCATATCAACTTCTGGACTATTGAGGGCAACACTCTCAGCAAGAGACAGGG	4495	0	UF_Msa_AF_110224	contig26060___1_nrnt0	contig26060___1_nrnt0	Unknown	
4606	57	14	unmapped	0		0	ATAGAGACGGAGCAGCGGACCAATCAGATGAACCTGAGAGCAAGCCCCTGGTTTCTGCTC	4497	0	UF_Msa_CF_119217	contig01259___0	contig01259___0	Unknown	
4607	57	15	unmapped	0		0	CTGCTCCACCCTTTCTCACGTCCATCACTCATCTCTCTAGTGTCCGGCCAGCTGGCCAAG	4499	0	UF_Msa_CF_124425	contig31302___0rc	contig31302___0rc	Unknown	
4608	57	16	unmapped	0		0	TTTCGTGGTCTGGGTTCATTTGCGGGAGTCAAAAGGAGATAATAGCGAGGATGATGCAAA	4501	0	UF_Msa_AF_100599	contig07267___1_nr0nt1	contig07267___1_nr0nt1	Unknown	
4609	57	17	unmapped	0		0	TTCGTAACAACCTCAGTGAAAACATGCATTTATCGAGCACTCTTACGCAGGCAGCCATGA	4503	0	UF_Msa_CF_117734	contig12700___0rc	contig12700___0rc	Unknown	
4610	57	18	unmapped	0		0	AGTGTGTACACCAGTAAGATCATTCGCAGTCACAGGGACCTGATGGCTTTGGTTTTCTAT	4505	0	UF_Msa_AF_107287	contig00302___1_nrnt	contig00302___1_nrnt	Unknown	
4611	57	19	unmapped	0		0	CAAAAAAGAATTACTACAAGAGGATAGAGCCCGCAGATGCCCATGTGTTGCAGAAGAGTC	4507	0	UF_Msa_AF_105524	contig06312___1_nrnt	contig06312___1_nrnt	Unknown	
4612	57	20	unmapped	0		0	GTCCAAGCTCTCGACAGACCCCAACACAAACATCCCAGATTATGAATATACTGGTGTGAA	4509	0	UF_Msa_CF_123900	contig04146___0	contig04146___0	Unknown	
4613	57	21	unmapped	0		0	AAGTTTGGTGTATGGTTGCTTTAGCTTGTTGTATCACTTGTTGTATGTACCTGCCGCGGG	4511	0	UF_Msa_AF_107343	LMB_S454.sd.253.C1___1rc_nr1nt0	LMB_S454.sd.253.C1___1rc_nr1nt0	Unknown	
4614	57	22	unmapped	0		0	TGGAACAGCAAGCACTACAAACATGGTGATCCTGGACATCAAAATGCTCTCTGGCTTTGT	4513	0	UF_Msa_AF_103019	LMB_S454.sd.428.C1___1rc_nrnt	LMB_S454.sd.428.C1___1rc_nrnt	Unknown	
4615	57	23	unmapped	0		0	AGTCTCAAGAGTTTCGTCTGGGTGTGGCTGAGGCACTAATGTCCCGAGATGACTGCGTGG	4514	0	UF_Msa_AF_107316	contig29803___1rc_nr1nt0	contig29803___1rc_nr1nt0	Unknown	
4616	57	24	unmapped	0		0	GCAATGGTGCAAAAAGAAAATCAAACCCAGTTGCATGAATTTTGAACACTAACAAACTGA	4516	0	UF_Msa_CF_119830	contig26655___0rc	contig26655___0rc	Unknown	
4617	57	25	unmapped	0		0	TTTGGCTGAGGTGGGTCAAGGAGGCGAGGACACAGAGCCGAGTGCAGAGGAGCAGCTGAA	4518	0	UF_Msa_CF_126831	contig00996___0rc	contig00996___0rc	Unknown	
4618	57	26	unmapped	0		0	GAAACTCCATGTGGACTGGTGTGAAAAACAGGAACTCTTCCTGCCTACATCTACCATCAT	4520	0	UF_Msa_CF_126726	contig24079___0rc	contig24079___0rc	Unknown	
4619	57	27	unmapped	0		0	TACAGATATGCCTTTGACTTCGCCAGAGTATAAGGACCAGAGAAGTTTGGACATGGACAC	4522	0	UF_Msa_AF_105145	contig31269___1rc_nrnt	contig31269___1rc_nrnt	Unknown	
4620	57	28	unmapped	0		0	CTTTGTGTTCTTGGTTGTAATCAACACTCCTTGTTTAAATTTAGAGTTACCAGGCACAGT	4524	0	UF_Msa_CF_120547	contig17719___0rc	contig17719___0rc	Unknown	
4621	57	29	unmapped	0		0	ATTCCTCCTCCTCGACCACCCATTCAGAGGACAGAGCAAAACCACTTCACTGTCTGGATC	4526	0	UF_Msa_CF_120116	contig24966___0rc	contig24966___0rc	Unknown	
4622	57	30	unmapped	0		0	GGCTGCGCCAAGTGAGCGTGCAGTTGAGTGTTGTTTGAGGCATGTTGAGTTTGGAATTGG	4528	0	UF_Msa_CF_127813	contig23085___0	contig23085___0	Unknown	
4623	57	31	unmapped	0		0	CTGAAGCAGAGAGTGGATCCAATCTTGCCCTCAACACCATCAGCGCCATCTTCTCCTTTA	4530	0	UF_Msa_CF_127328	contig31397___0	contig31397___0	Unknown	
4624	57	32	unmapped	0		0	CTTGATTGGTCAGTTAAAACATAACTAAGACCATGGCGACGCATGTTATATTTAAAATCG	4532	0	UF_Msa_AD_200151	LMB_Add_141_rc	LMB_Add_141_rc	Unknown	
4625	57	33	unmapped	0		0	TTGGTGGTTGCAGAGCATAACAATGACAAGCTGACCCCTATTACACTCAATGCCATCACT	4534	0	UF_Msa_AF_104386	contig31358___1rc_nrnt-1	contig31358___1rc_nrnt-1	Unknown	
4626	57	34	unmapped	0		0	CATCATCTTTTCCCTCTTTGTTTGTGTTGGACAGGTAATATTTGCTACTGGAGCTTTGGT	4536	0	UF_Msa_AF_102232	contig03766___1_nrnt0	contig03766___1_nrnt0	Unknown	
4627	57	35	unmapped	0		0	ACTTACATCACAGGCCAGCCTATCGTGTTTGTGGGCACGGGGCAGACTTACAACGACCTG	4538	0	UF_Msa_AF_106600	contig16743___1rc_nrnt	contig16743___1rc_nrnt	Unknown	
4628	57	36	unmapped	0		0	TCGTCCTTCAGTGTATCTGGATAGCTTTCACCCCAGCTCATAATAGGCGGAACGTTAATA	4540	0	UF_Msa_CF_121577	contig16857___0	contig16857___0	Unknown	
4629	57	37	unmapped	0		0	GTACGATCGTGTGTTCCTGCTGCAGAAATTTGATCCAGTTCAGCCTCGTCTCAGCGGTGT	4542	0	UF_Msa_CF_126617	contig26326___0rc	contig26326___0rc	Unknown	
4630	57	38	unmapped	0		0	ACCAGGAGGACAAGTCTTCCTTTGACATTTAGTTAACTGCAACATGCCCTGCACTGCTTT	4543	0	UF_Msa_CF_118434	contig15735___0	contig15735___0	Unknown	
4631	57	39	unmapped	0		0	TCTGTGAGCTCAGAAGGGACGCCTGCTGAGAAAGACGAATGTGACGTACAGGAGGAAAAG	4545	0	UF_Msa_CF_126112	contig03717___0	contig03717___0	Unknown	
4632	57	40	unmapped	0		0	ACATTGTTGATTTCTACAACAGAGCATGCTGTAGGGCTGCCGGCAGCCGGCCAGAACCAG	4547	0	UF_Msa_AF_100309	contig02537___1rc_nrnt0	contig02537___1rc_nrnt0	Unknown	
4633	57	41	unmapped	0		0	GGAGTCTAAAGACTGCAAGATCTCGTCATTCAACTATGATGAATAAAAGCTGTCTAAGAG	4549	0	UF_Msa_CF_120707	contig08247___0rc	contig08247___0rc	Unknown	
4634	57	42	unmapped	0		0	AAGACCATCACCTATTCTCCATCGAGGCAGCAGCACAGACCGTGGTGCACTGTCTGTTGG	4551	0	UF_Msa_CF_118479	contig02703___0rc	contig02703___0rc	Unknown	
4635	57	43	unmapped	0		0	CAGGAAAGAGGACTAGTAAAGAAAGCGTAAAAGGTCCTCCTGCTAAAAAAGCTAAGTCAG	4553	0	UF_Msa_CF_121203	contig07422___0	contig07422___0	Unknown	
4636	57	44	unmapped	0		0	CAGAAAGGGGGAGGAGAGATGAATAGCAACTCTATAGGAAATAATGCAGAACAGGAGTCA	4555	0	UF_Msa_CF_126613	contig00580___0	contig00580___0	Unknown	
4637	57	45	unmapped	0		0	AGTATGTCCTACATGGTGGGAATGATTGCTAGCTTCCATGACACTGAAACGGTTGTCATG	4557	0	UF_Msa_AF_103521	contig13616___1_nrnt	contig13616___1_nrnt	Unknown	
4638	57	46	unmapped	0		0	ACATCGGCAAGACGGTCTCCAGTGCAAGTAGGCTGTTTTCCAACCAGGAAAACGGTAATA	4559	0	UF_Msa_AF_106157	contig20924___1_nrnt	contig20924___1_nrnt	Unknown	
4639	57	47	unmapped	0		0	CCGAGAAGAGTGGAGCTCTCAGCAAGTACGCTAAGAAACTGTTCCTCGCCCTCAAACCTG	4561	0	UF_Msa_AF_103311	contig19136___1rc_nrnt	contig19136___1rc_nrnt	Unknown	
4640	57	48	unmapped	0		0	TCCAGCTGCCCTCATCCTTCACACAAGTTCAACGCAAATGAGCCTCTACATCCACCTGTC	4563	0	UF_Msa_AF_106656	contig31242___1_nrnt0	contig31242___1_nrnt0	Unknown	
4641	57	49	unmapped	0		0	ATGCACCTTTTAAACTGCAATATGGACCAAATTACCACCCAACGTTTGAGATCCGCCTGC	4565	0	UF_Msa_CF_124333	contig20003___0rc	contig20003___0rc	Unknown	
4642	57	50	unmapped	0		0	TCACGTGATGAGTCATCAGCCCTGCGGTGGCGGGTTCGATTCCCGGCCGGTTACATACAG	4567	0	UF_Msa_CF_123105	contig01784___0	contig01784___0	Unknown	
4643	57	51	unmapped	0		0	TTGAGGAACCTGGACGTTTCTCCTCCTCTTCTGACTCACTCAGCTCACTCTCACTGTCAG	4569	0	UF_Msa_CF_119644	contig12722___0rc	contig12722___0rc	Unknown	
4644	57	52	unmapped	0		0	TGAAATATTTGCCCTGTCTCTATGCATTAAAGTAAAATGAAAAGTTACCTTGAAGGGGGG	4571	0	UF_Msa_AD_200024	LMB_Add_151	LMB_Add_151	Unknown	
4645	57	53	unmapped	0		0	ACAAAGACGCACTCATCAACACCCTGAGGTCGCAGACAGCAGAGAGTTCAGCGGGAGGAT	4573	0	UF_Msa_CF_121684	contig23246___0	contig23246___0	Unknown	
4646	57	54	unmapped	0		0	CTGCTTTCAGTGGTGAGACTATTATGTTGACTGCTTCTATGATTACTGTTGTTATTATTG	4575	0	UF_Msa_AF_107698	contig32389___1_nr0nt	contig32389___1_nr0nt	Unknown	
4647	57	55	unmapped	0		0	TCTAGAGCTGTTCTACCTTCTCTCTCTCATCAGTCCATTATTATTAGTCCACACCAGGAA	4577	0	UF_Msa_CF_125196	contig08026___0rc	contig08026___0rc	Unknown	
4648	57	56	unmapped	0		0	TACAACTAAACATGGCTCCCAGGAAAAGGACCACCAAACAACGGAAAAACAACCCCAAGA	4579	0	UF_Msa_AF_101466	contig27533___1_nr0nt	contig27533___1_nr0nt	Unknown	
4649	57	57	unmapped	0		0	GGACCATGACAACATGCTCCACAGTTGGTGATAAGGCGGTTGTTGAGTCACCGTCAGGTC	4581	0	UF_Msa_CF_120076	contig25198___0	contig25198___0	Unknown	
4650	57	58	unmapped	0		0	CAGAAGCAGAAAAACAAGGTAACTTAATGAGGACAATTCAGCTGCGGTTGGTGATGAGAT	4583	0	UF_Msa_AF_107637	contig27541___1rc_nrnt	contig27541___1rc_nrnt	Unknown	
4651	57	59	unmapped	0		0	TCTTTTCAAGTTACCAGTCCCTGGGGAGTTGCTGCAAGGAGTCGCTGGCTGACAAAAGAC	4585	0	UF_Msa_CF_125212	contig27129___0rc	contig27129___0rc	Unknown	
4652	57	60	unmapped	0		0	AGTACCATCTCAAAGTCCTGAGAAAGATGGTGGCACTTCTGCAGGAAAACATTGGGAAGA	4587	0	UF_Msa_CF_122994	contig20572___0rc	contig20572___0rc	Unknown	
4653	57	61	unmapped	0		0	GAAGGTCTTTACCCAAAACTTCCCATCAACAAGAAGCCAGAGAGGCCAGCTCCCCCAAAC	4589	0	UF_Msa_CF_119873	contig31030___0rc	contig31030___0rc	Unknown	
4654	57	62	unmapped	0		0	TTTGGATGCTATTCCCTGGGGATGGTGGGATACAGAGTGGCCACCTTCAATGACTGTGAC	4591	0	UF_Msa_AF_101562	contig16109___1_nrnt0	contig16109___1_nrnt0	Unknown	
4655	57	63	unmapped	0		0	ACGGGATTTATTTTGTTTTTATTCCCCCTCACGATGCACTGTTAAATGCCAGCGAAGATC	4593	0	UF_Msa_CF_126577	contig28103___0	contig28103___0	Unknown	
4656	57	64	unmapped	0		0	TGAGAGAGGGAATTTGAAAATAAGAGAAAGAGGGAAAAAAGCAAATCAGAAGATGTGGAG	4595	0	UF_Msa_CF_119467	contig04160___0rc	contig04160___0rc	Unknown	
4657	57	65	unmapped	0		0	TACTGCCTCTACACCTTCACTCAACAGTCAGAAATCAGAAGTGAAGTTAGACATGCTATC	4597	0	UF_Msa_CF_122650	contig20893___0rc	contig20893___0rc	Unknown	
4658	57	66	unmapped	0		0	TACCGATTGGTCGAGGTGTTTAACCACCAACCTGCAGACTTCAAACACATGTCTGTGATA	4599	0	UF_Msa_CF_118289	contig09974___0	contig09974___0	Unknown	
4659	57	67	unmapped	0		0	AAACTTCTGCTTCTGAGTAAGGGGTCGCGGCAGCCCAACGTGCGTGGTGATTCCCTTCAA	4601	0	UF_Msa_CF_123779	LMB_S454.808.C1___0	LMB_S454.808.C1___0	Unknown	
4660	57	68	unmapped	0		0	TTATATATTGACAACACAACCACCAGGCAGAAATGGGAGGACATGGTGCGCTACTACAAG	4603	0	UF_Msa_AD_200056	AF462345	AF462345	Unknown	
4661	57	69	unmapped	0		0	GAAGGCGAAATGCATTAGTTATGGTTTGGAAGGAATCAAAATAACATGTGTCACAGCAGG	4605	0	UF_Msa_CF_123028	contig01724___0	contig01724___0	Unknown	
4662	57	70	unmapped	0		0	AGGTTCCACCTCCCTCTGCTGATGAGTCGGTTCTCCTACAGCACCTACAGAGGAAGCTGA	4606	0	UF_Msa_AF_108892	contig09431___1_nrnt0	contig09431___1_nrnt0	Unknown	
4663	57	71	unmapped	0		0	AAGGTTGATGGAAGAGTTGTTGAGCCTAAGCGAGCAGTATCAAGAGAAGACTCAAACCGT	4608	0	UF_Msa_AF_103142	contig08156___1rc_nrnt-1	contig08156___1rc_nrnt-1	Unknown	
4664	57	72	unmapped	0		0	CACGCGCACACACTTTCTGTCTGAGTTTGTATTTAATGAACTAATAAAATAAAAACCACC	4610	0	UF_Msa_AF_103799	LMB_S454.979.C1___1_nrnt	LMB_S454.979.C1___1_nrnt	Unknown	
4665	57	73	unmapped	0		0	TGTGTTTTTTGGTTTTTACACAGACACTACGTGGCACCTCTAGCAACTCAGACGTGACGA	4612	0	UF_Msa_CF_120369	contig13507___0	contig13507___0	Unknown	
4666	57	74	unmapped	0		0	TATTGGTTCTGTCCAACTCGATGGATCTGCATACAGAGAGTTAAAGACTGGTGATGGCCT	4614	0	UF_Msa_AF_105354	LMB_S454.sd.300.C1___1rc_nr1nt0	LMB_S454.sd.300.C1___1rc_nr1nt0	Unknown	
4667	57	75	unmapped	0		0	CCCAAAACAGAGGAGTCCTCTTGGAAGGTGGACCTCTCGACTTTGATAACGGTACAGTCA	4616	0	UF_Msa_CF_120929	contig24182___0	contig24182___0	Unknown	
4668	57	76	unmapped	0		0	ACCCCATGATCATGTTAAAGCAGACGCAGACTAAGAGAGGTACATCCATTTGGAGAACCT	4618	0	UF_Msa_AF_104659	contig20652___1rc_nr0nt	contig20652___1rc_nr0nt	Unknown	
4669	57	77	unmapped	0		0	CTACCGCTCTGACGCACAATACAGCCACATGGTATCATCAGTACAAGTGGAGGGGCCAGA	4620	0	UF_Msa_AF_104240	contig10823___1rc_nrnt0	contig10823___1rc_nrnt0	Unknown	
4670	57	78	unmapped	0		0	TACGATTTTTTGGCCATCGGAAGGAAGGTCAGACTATGTACCTCTTCTTGGAGTACTGCA	4622	0	UF_Msa_AF_100996	contig01531___1_nrnt	contig01531___1_nrnt	Unknown	
4671	57	79	unmapped	0		0	AAACAGCTGCTCCCATTGGGCAAAGACATTCTTAATAACAATAAAGCACCTATCAAGTTC	4624	0	UF_Msa_AF_103098	contig28803___1_nr0nt	contig28803___1_nr0nt	Unknown	
4672	57	80	unmapped	0		0	AAGACATCCCTCTCTCTCACAGGCAGTTTGTGGAGAACCAGGGCTACGGATACAGTGACG	4626	0	UF_Msa_AF_107897	contig20528___1_nr1nt0	contig20528___1_nr1nt0	Unknown	
4673	57	81	unmapped	0		0	AAAGGAGCAGCAGAAGTGACTTGTCCAGTACCTCGTCTGTCTCGACCCTCAGTCCTCAGC	4628	0	UF_Msa_CF_117807	contig19069___0rc	contig19069___0rc	Unknown	
4674	57	82	unmapped	0		0	TCCTGGCTCGCTATCAGGAGTCTGTGCGCGACTTACTGTACATGTCCCAACCAAGTTTAA	4630	0	UF_Msa_CF_121710	contig23405___0rc	contig23405___0rc	Unknown	
4675	58	1	unmapped	0		0	TGACACAAGGCTACTGACTGACAGCCAGAGGTGGCACAGAGTAAAATGATCCCAGAGATG	4473	0	UF_Msa_CF_121885	contig21197___0	contig21197___0	Unknown	
4676	58	2	unmapped	0		0	AGAATAACCATCTTGCCAGGAGGGGGTATTACAGAGAGGAACCTGCAGAGAATTTTAGAG	4475	0	UF_Msa_AF_109581	contig19589___1_nrnt0	contig19589___1_nrnt0	Unknown	
4677	58	3	unmapped	0		0	GAAGATGGTGCAAGCATCACAGAGCAGGATCGAGATGATACAGATGAACATGACAGTGAA	4477	0	UF_Msa_CF_119978	contig21622___0rc	contig21622___0rc	Unknown	
4678	58	4	unmapped	0		0	CTGGAAGAACAAAGTTTTGAAACCACCCCAGTGGAGATCTCACAGTGAATGTTATCCAGG	4479	0	UF_Msa_CF_118685	contig24630___0rc	contig24630___0rc	Unknown	
4679	58	5	unmapped	0		0	CAGAAGACTGAACTGTTTTAGGACTATTTAATGAAATACCAAGTCGGGTGTTTTCAACAT	4481	0	UF_Msa_AF_106943	contig26717___1_nr0nt	contig26717___1_nr0nt	Unknown	
4680	58	6	unmapped	0		0	CTGGAAAAGCTTTCCACGGAATTTGCTTTGGGGCTTCTGGAAAAGGCAAGAGGTGATCTA	4483	0	UF_Msa_CF_127535	contig20867___0	contig20867___0	Unknown	
4681	58	7	unmapped	0		0	CTCACAGATAGGAGGCCTGAGCCACGTGTCTGAGAGTTCTCCTTCCCTGTCAGAGTTTGG	4485	0	UF_Msa_CF_118564	contig11077___0rc	contig11077___0rc	Unknown	
4682	58	8	unmapped	0		0	CAGTGGAAGATGGTCTACTGTGGATGGGGCCATTGGGGTGTGATCTCATATTTACAACAA	4487	0	UF_Msa_CF_122322	contig26771___0	contig26771___0	Unknown	
4683	58	9	unmapped	0		0	CTCCCTCAAGATCCGTCCGTCAGCAGTGGAAATGCCAGGCTCAGCAGATATAGCTGGTCT	4489	0	UF_Msa_CF_121202	contig06162___0rc	contig06162___0rc	Unknown	
4684	58	10	unmapped	0		0	AGCATCTCTCTCTGATCTCAGTTCCTCTGTTGATCTACCATCCGGCTCAGATCCTGCTCG	4491	0	UF_Msa_AF_106251	contig08485___1rc_nrnt	contig08485___1rc_nrnt	Unknown	
4685	58	11	unmapped	0		0	TCTCTCACTGCTCCCAAGAAGTCTGCCTCCCTGTTCAGAGGACGATACCACTTCCTGGGA	4492	0	UF_Msa_AF_109111	contig09000___1_nr0nt1	contig09000___1_nr0nt1	Unknown	
4686	58	12	unmapped	0		0	AATGTGACTGCGCCAGACAGCATCTCCCAGCCGCTGGACTTCAAAGTGCATTATATGGGG	4494	0	UF_Msa_CF_118784	contig27835___0	contig27835___0	Unknown	
4687	58	13	unmapped	0		0	GTCAAAAACACACTCAAAAAGAAACCAACTGATGAAATTAACAGCACCTCCTTCAAACCC	4496	0	UF_Msa_CF_118125	LMB_S454.521.C1___0rc	LMB_S454.521.C1___0rc	Unknown	
4688	58	14	unmapped	0		0	AACACATCGACCAGAAGTTTGTAATGTCTCCCCTGCTGTCTCTCTCCAACACCTCGGCTG	4498	0	UF_Msa_AF_100518	contig19155___1rc_nrnt0	contig19155___1rc_nrnt0	Unknown	
4689	58	15	unmapped	0		0	ACAAAGTTATCCCTTATATGGACGGGGAAGCACAGGTCAACAAGACCCCAGAAAAAGAAC	4500	0	UF_Msa_AF_106376	contig08380___1_nr0nt1	contig08380___1_nr0nt1	Unknown	
4690	58	16	unmapped	0		0	TAAGAAAAACAGCCAGCACGCAAATAACCAAGACCTGAACAGCTCCCATTGCTTCAGTCA	4502	0	UF_Msa_CF_126079	contig14962___0rc	contig14962___0rc	Unknown	
4691	58	17	unmapped	0		0	ACATGAATCTGGACTGAGCAGTGGATGTGAAAAAAGTTTGGAGGTCTCGCTGAGATCACT	4504	0	UF_Msa_AF_108225	contig05407___1_nr0nt	contig05407___1_nr0nt	Unknown	
4692	58	18	unmapped	0		0	GATGTCATCTACGAGAACGCCAGCAAGACATAATGATGGCGCCTCCTCCAGACGCTGCGA	4506	0	UF_Msa_CF_122951	contig13021___0	contig13021___0	Unknown	
4693	58	19	unmapped	0		0	GGAGCTGCACCGCCTGCACCTTCCTCAACCATCCCGCCCTCAACCGCTGTGAACAGTGCG	4508	0	UF_Msa_AF_101919	contig08429___1_nrnt	contig08429___1_nrnt	Unknown	
4694	58	20	unmapped	0		0	TTATTCTGCCGTGCCTGACAAGCAAAGAAAAGGCAGTCAATTCTGTAATTAACAAAGACA	4510	0	UF_Msa_CF_121022	contig21354___0rc	contig21354___0rc	Unknown	
4695	58	21	unmapped	0		0	AAACCTGCTTTAATAATGGAAGTGGTCTGTAACAGGATGGTGGCCAGCTACAGATCTGCT	4512	0	UF_Msa_AF_109836	contig29516___1_nrnt	contig29516___1_nrnt	Unknown	
4696	58	22		1028	E1A	0		479	1	(+)E1A_r60_1	E1A_r60_1	E1A_r60_1		CONTROL
4697	58	23	unmapped	0		0	TGATAACAAAGAGACTGCCAGCCAACGGGGCCGGAGGAGTGGCTCCACATGTGAAAAACG	4515	0	UF_Msa_AF_102845	LMB_S454.1061.C1___1rc_nrnt-1	LMB_S454.1061.C1___1rc_nrnt-1	Unknown	
4698	58	24	unmapped	0		0	AGCAATCTGAAATTTGCACGTCATGTGGAACCAGACAATGAAGTCATTCAGAAGAAGCTA	4517	0	UF_Msa_AF_101559	contig01319___1_nrnt	contig01319___1_nrnt	Unknown	
4699	58	25	unmapped	0		0	CTCTCAATGCTATGTATCTTAAACCTACAAACAAGCAGGAGGAAGAGAATATGAGGGCGT	4519	0	UF_Msa_AF_101167	contig28667___1_nrnt	contig28667___1_nrnt	Unknown	
4700	58	26	unmapped	0		0	TCTGTCTGTACATTCTATTACCCTCATTCAATCCCCAAGGTGCAAGCTGAGCTTTACGAG	4521	0	UF_Msa_CF_117941	contig30458___0rc	contig30458___0rc	Unknown	
4701	58	27	unmapped	0		0	AGGCAGCTCCATCAACTTCTCCCATGAAAACAGTGGAAATTCCTCATGCTAAAGTGTAGC	4523	0	UF_Msa_CF_122964	contig20432___0rc	contig20432___0rc	Unknown	
4702	58	28	unmapped	0		0	TTGACTAAAAATGATTTCCGCAGCCTCGACAAGTAACTAAACCAAAACTTAACCCCGAAA	4525	0	UF_Msa_CF_122023	contig19820___0rc	contig19820___0rc	Unknown	
4703	58	29	unmapped	0		0	CCTCCAAAGTGGCCAATGAGCTCAGGCTGTGAGCAACTTCCCCTTATTATCACATTATCC	4527	0	UF_Msa_AF_106509	contig24131___1rc_nrnt	contig24131___1rc_nrnt	Unknown	
4704	58	30	unmapped	0		0	GCAACTAAGACAGCATCTCCCTTAGAGAAATTAACATACACATCTCATGTTTTGTTTGTT	4529	0	UF_Msa_AF_101274	contig29951___1_nrnt	contig29951___1_nrnt	Unknown	
4705	58	31	unmapped	0		0	TTCCAAGACTCAGGTGCAGTAGGAAAGAGCCAAGAGATGATGTGAATCCAAGAAACAGAG	4531	0	UF_Msa_CF_123091	contig11953___0	contig11953___0	Unknown	
4706	58	32	unmapped	0		0	AATCTGCATTTGCTGCCCGTCAGACGGAAGGAGAGTCTGACCGACCTCTGCTGATCTGTG	4533	0	UF_Msa_CF_118844	contig17804___0rc	contig17804___0rc	Unknown	
4707	58	33	unmapped	0		0	GCTGACGTCAGCACTGGTCAGTAATGGCGACAGTGACGTACTCTCGGATGTGTCTTCTCC	4535	0	UF_Msa_CF_118005	contig28395___0rc	contig28395___0rc	Unknown	
4708	58	34	unmapped	0		0	ACTTTGCTTCATGAAAAAGATAACACCCAATCTCTGAGAGGATCCAACCTCAGCCACACA	4537	0	UF_Msa_CF_119982	contig04878___0	contig04878___0	Unknown	
4709	58	35	unmapped	0		0	ATTTGCCCAACAGTTACATGGACTTCCCAAAGGGGATGCCTATGTCAATGTATGGAGGAA	4539	0	UF_Msa_AF_105267	contig19063___1_nr1nt0	contig19063___1_nr1nt0	Unknown	
4710	58	36	unmapped	0		0	TCCAACGGCTGGCTGTGAGGTGACCCGGGCAGAGTGTATGTGTGTGTTCAGTTGTGTTCC	4541	0	UF_Msa_CF_123310	contig29979___0rc	contig29979___0rc	Unknown	
4711	58	37		1028	E1A	0		853	1	(+)E1A_r60_a97	E1A_r60_a97	E1A_r60_a97		CONTROL
4712	58	38	unmapped	0		0	ACCTTTGTCCTTGGAGGGCTGCTGGTTGTCTTGCTGCTGATCACAGGAGTGTTTGGGAGG	4544	0	UF_Msa_AF_101751	contig21184___1_nr0nt1	contig21184___1_nr0nt1	Unknown	
4713	58	39	unmapped	0		0	AGATGCACAAAGGGGAGAAGAACTTCTTGTGCACCACGTGCGGGAAGTCATTTTTATCTT	4546	0	UF_Msa_CF_123382	contig22514___0	contig22514___0	Unknown	
4714	58	40	unmapped	0		0	TTTGTTCTTCTCCCTCCACCTGGGTCACATCCTGCTGCTGGACGCCCTCGCCTGGCTGAT	4548	0	UF_Msa_AF_107639	contig07466___1rc_nr0nt1	contig07466___1rc_nr0nt1	Unknown	
4715	58	41	unmapped	0		0	GGATATGCTAAATTCCAGACATTCCCAGTCTAAATTTAAGATTTGGAAATAACCGCAAAC	4550	0	UF_Msa_CF_121419	contig15634___0rc	contig15634___0rc	Unknown	
4716	58	42	unmapped	0		0	CCCGACGGGGGACATACAGAAAGGCAAAGTCATTCATCGAAAGGTCTAGTCTACCTCCAG	4552	0	UF_Msa_AF_108087	contig22590___1_nr0nt	contig22590___1_nr0nt	Unknown	
4717	58	43	unmapped	0		0	CGGGGGCAGTAGGCGATGCGCGCGACGGCTCGCAGTGAGGGGCAACTGCACAGAGTTTTG	4554	0	UF_Msa_CF_122586	contig12474___0	contig12474___0	Unknown	
4718	58	44	unmapped	0		0	CTTGTACATGTATGTATATTCACCATACTTTTCTATTAAACATATCAATAATGATTCAGT	4556	0	UF_Msa_AF_107435	contig09900___1_nr0nt1	contig09900___1_nr0nt1	Unknown	
4719	58	45	unmapped	0		0	ATACAGCCTCCAGAATGGGTAAGGAAGGGACGCTGGTGTCAGGGAGGACACCCTATCCTT	4558	0	UF_Msa_CF_127292	contig13037___0	contig13037___0	Unknown	
4720	58	46	unmapped	0		0	TTCCGCAGTACAGCCACTGCTGCCATGGTAAACGTCCTCCTCCCTCTCGATGAAAACAAT	4560	0	UF_Msa_AF_103661	contig25497___1_nr0nt1	contig25497___1_nr0nt1	Unknown	
4721	58	47	unmapped	0		0	TTTCGTAGTGCTCAAAACACACCTTACGCTTGAATCTTTAAATCCATCGTGTGTTTGTGG	4562	0	UF_Msa_CF_124484	contig04403___0	contig04403___0	Unknown	
4722	58	48	unmapped	0		0	ATAATCCAAATTATCAGTCCATCCAAGTCCTCTGCGCTGACCTTGCAGGACAGTACTAGT	4564	0	UF_Msa_CF_121231	contig16217___0	contig16217___0	Unknown	
4723	58	49	unmapped	0		0	AGGCCTCGTCATTCCTTATCAATGTGAAGAAGCAGAGACGATGATGCAATAAAGGTTTTT	4566	0	UF_Msa_CF_122749	contig28326___0	contig28326___0	Unknown	
4724	58	50	unmapped	0		0	CATCTTCATTTTCTTTGAAGCGCAAACCTTTTTATTGGCGAGCAGTCTAATCCCCGCCTT	4568	0	UF_Msa_CF_121516	contig04935___0	contig04935___0	Unknown	
4725	58	51	unmapped	0		0	TTGAACCTGTGGACACTCTTCTGTACCAGGAGTCACTTCACATGGACACTTTATTAGGGA	4570	0	UF_Msa_CF_121086	contig32679___0rc	contig32679___0rc	Unknown	
4726	58	52	unmapped	0		0	TTCCAGTTTTTGCTGTTTATGAAAGCCACTGATCAGTGTCCGAGCAAAGAGAGGAAGACG	4572	0	UF_Msa_CF_126004	contig22817___0	contig22817___0	Unknown	
4727	58	53	unmapped	0		0	CGTGGTTCTGTGGTGTGCTGTTGTAAACGAGTCCTTCACATTAAACACTACTGAGATACT	4574	0	UF_Msa_CF_118210	contig19995___0rc	contig19995___0rc	Unknown	
4728	58	54	unmapped	0		0	GAGCACAGCATTATGAGAATTCACATCATTCCAGTTGTCTTTAGAGCACCTCAGAGAAAC	4576	0	UF_Msa_CF_125543	contig12000___0rc	contig12000___0rc	Unknown	
4729	58	55	unmapped	0		0	GAGGAGTTCTTGCTTCAACAGTGTTTGTTTTTAACGGTTTAACTTTTTCTTTCCTTCGTC	4578	0	UF_Msa_AF_104055	contig19969___1_nr0nt	contig19969___1_nr0nt	Unknown	
4730	58	56	unmapped	0		0	CCGCCTCCACCTTTCTCCTCCTCACCAGCCCTCCCCATCATTTCCCTCAGTCACAAGTCC	4580	0	UF_Msa_CF_118726	contig01815___0rc	contig01815___0rc	Unknown	
4731	58	57	unmapped	0		0	AGAAGTCTGGTTTAGAAATGAACTTCTCTTTCCTGAACTACGCCCAGTCAAGCGAGTGCA	4582	0	UF_Msa_AF_102027	contig19360___1_nrnt0	contig19360___1_nrnt0	Unknown	
4732	58	58	unmapped	0		0	TGTGCTGCCTATCAGACGCTGGTGATGGAGGCCAGGCAGTTCGATGACTTCTGGAGTTTC	4584	0	UF_Msa_CF_125583	contig26178___0rc	contig26178___0rc	Unknown	
4733	58	59	unmapped	0		0	ACCAAGAAGCATGGCATGAGTTGTCAGAGCTCTACATCAACGAACACGACTATGGAAAAG	4586	0	UF_Msa_AF_105302	contig27704___1_nrnt	contig27704___1_nrnt	Unknown	
4734	58	60	unmapped	0		0	AGGTACAGTTCAACAGGGGTTTGAGGGAAAACAAACAAAAGGCGAGCACACTTACTGACA	4588	0	UF_Msa_CF_122772	contig18385___0	contig18385___0	Unknown	
4735	58	61	unmapped	0		0	TTCCGGCAGCATTGGATATAGCATTGGAGGAGACATCCGGGCTGTGTGTATGGAAGATGG	4590	0	UF_Msa_CF_123221	contig05624___0	contig05624___0	Unknown	
4736	58	62	unmapped	0		0	TGACGTTCAGTAACCTGTGCGGCTGCGACGAGCCTGTCAGCTCTGTGACTGTTCACCAAA	4592	0	UF_Msa_AF_105173	contig00030___1rc_nrnt	contig00030___1rc_nrnt	Unknown	
4737	58	63	unmapped	0		0	GAACAGAGATGAAGTGACATTCATGAAGAGACTCAGAAAAAAGTGAAATGTCGCAGCCAA	4594	0	UF_Msa_AF_101051	contig10143___1_nrnt	contig10143___1_nrnt	Unknown	
4738	58	64	unmapped	0		0	GATCCCAGAATAGCCACTGTATACCTCATTTTTTCTTGTCCATACGTCAATTTATAACTA	4596	0	UF_Msa_AF_103729	contig28862___1rc_nr1nt0	contig28862___1rc_nr1nt0	Unknown	
4739	58	65	unmapped	0		0	TTGCCTCCATTCCCCTCTCCCTCTTTTGCTGACGTACAGCACATCGACTTGTAGACAATT	4598	0	UF_Msa_AF_101899	contig03781___1_nr0nt	contig03781___1_nr0nt	Unknown	
4740	58	66	unmapped	0		0	GGATTCCACGAGCTGAAATGGAAAAAATGGAGACTCTTATCCTTGGAGAGTTGAAGGAGA	4600	0	UF_Msa_AF_105429	contig11990___1_nrnt	contig11990___1_nrnt	Unknown	
4741	58	67	unmapped	0		0	TCCCTGAAGGTGTAGCCATGGAGGTGACAAAGACTGCCATGGAGAAGGTTCCAGATCACA	4602	0	UF_Msa_AF_105930	contig31436___1rc_nrnt	contig31436___1rc_nrnt	Unknown	
4742	58	68	unmapped	0		0	CAAAAAAGAGGTCCTGGAGCAAGAGTAGCACAATCACAAAGAAGAACAGAGGCTCCTTCA	4604	0	UF_Msa_CF_119132	contig16922___0	contig16922___0	Unknown	
4743	58	69		0		0		3245	1	ETG09_35454	ETG09_35454	ETG09_35454		CONTROL
4744	58	70	unmapped	0		0	AGAGCTCCATCGGCACTTTGAGACGCATGGATCTCCAGTCATGATGGGAGGGGATAGGGA	4607	0	UF_Msa_AF_103032	contig14975___1_nrnt	contig14975___1_nrnt	Unknown	
4745	58	71	unmapped	0		0	TTCCCAAACAGAAACCCATTGCGGGCGTCAAACAGGTCGTCGTCGTGGCTTCAGGGAAAG	4609	0	UF_Msa_AF_102268	contig32567___1rc_nr0nt1	contig32567___1rc_nr0nt1	Unknown	
4746	58	72	unmapped	0		0	ATTAGACATCGACAAGCTGCCTGGTGATAAACTGGGCAAGTTGGTGAACATCATTCATGC	4611	0	UF_Msa_AF_109339	contig16420___1rc_nrnt0	contig16420___1rc_nrnt0	Unknown	
4747	58	73	unmapped	0		0	TGGATTCACTATTGAACTGGCTTCTGCACTCACAGTCGTGTTGGCTTCCAATATCGGAAT	4613	0	UF_Msa_AF_102872	contig31070___1rc_nrnt	contig31070___1rc_nrnt	Unknown	
4748	58	74	unmapped	0		0	ACACCTGGGAAGGTGGAGAAGAACGGAGCAGGCCACAGCAGTGACAGTGAGGACCAGTCC	4615	0	UF_Msa_AF_109397	contig24357___1_nr0nt	contig24357___1_nr0nt	Unknown	
4749	58	75	unmapped	0		0	ATCTCAGTGCCAGTGCCAGACCAGTCATCAGGGCTGGCACGGCGTGGAGGTGTACTCCTT	4617	0	UF_Msa_CF_124012	contig28070___0	contig28070___0	Unknown	
4750	58	76	unmapped	0		0	TAATGGCGACGCTTCTGGGGTCCGGGTCCCCTTGTACTGGAGGAAAACGAAGACATTGCA	4619	0	UF_Msa_AF_108084	contig25217___1_nr0nt	contig25217___1_nr0nt	Unknown	
4751	58	77	unmapped	0		0	ATTCAGTACCTCCAGTACAGAAAGGGAACGTTTATACGGGAGTCAGTCAAATCCGAGTGA	4621	0	UF_Msa_AF_105284	contig04148___1rc_nrnt	contig04148___1rc_nrnt	Unknown	
4752	58	78	unmapped	0		0	ACTGTATTGGGTTCAAGTTTCAGGTACAGTATGTTTCCTCCTTCTCATTCAGATTGTAAA	4623	0	UF_Msa_AF_104911	contig23657___1_nr0nt	contig23657___1_nr0nt	Unknown	
4753	58	79	unmapped	0		0	TGTAAGAGGCTGTTGCTCGGTGCAACGGTGACATTTGTCTTATAAGATCATCCTGAAGGA	4625	0	UF_Msa_CF_120612	contig14770___0rc	contig14770___0rc	Unknown	
4754	58	80	unmapped	0		0	AGATAAGTTTGATTCCACTTATTCCAACAAACCCACAGGAGGAGACGTCACACAACCACG	4627	0	UF_Msa_CF_125338	contig08676___0	contig08676___0	Unknown	
4755	58	81	unmapped	0		0	CATTGGGATTTGTGTGAAAAGAAAGAATATATGCCACGTTACGCTAAGGCAATCGAGACC	4629	0	UF_Msa_CF_119454	contig08408___0	contig08408___0	Unknown	
4756	58	82	unmapped	0		0	CTTTGATCCTCTGGAGACGTTCCTGAAGGATGTCAAGCACTACTACTCCGGTGAGATCTT	4631	0	UF_Msa_CF_119921	contig26440___0	contig26440___0	Unknown	
4757	59	1	unmapped	0		0	ATAAGAAGTGACAGACGTGACTTTCAGGTTCCACCTTAAATCCAGACCCCGTTTCTGAGA	4632	0	UF_Msa_CF_123702	contig28531___0rc	contig28531___0rc	Unknown	
4758	59	2	unmapped	0		0	TCAACACAACCTATGCAAATTGTGCATGTACAGTATCCTTTGTTTGATACACTAACCAAA	4634	0	UF_Msa_AF_105335	LMB_S454.sd.146.C1___1_nrnt	LMB_S454.sd.146.C1___1_nrnt	Unknown	
4759	59	3	unmapped	0		0	TGGCATCCTGCTGACAGAGCTAGTGACCAAGGGCAGAGTGCCCTATCCAGGCATGAACAA	4636	0	UF_Msa_AF_109316	contig04055___1_nrnt	contig04055___1_nrnt	Unknown	
4760	59	4	unmapped	0		0	CCGAGTGCTGGTCAAAGCAGAGATGGAGAAGTTTCTTCAGAACAAAGAGCTGTACAATAA	4638	0	UF_Msa_AF_109498	contig01935___1_nr0nt	contig01935___1_nr0nt	Unknown	
4761	59	5	unmapped	0		0	TCCTCTCATGTCAGAGTGTCTACTCTACTACATCAAAGACGGAATTACAAGGGTGGGTCA	4640	0	UF_Msa_AF_104023	contig01699___1rc_nrnt	contig01699___1rc_nrnt	Unknown	
4762	59	6	unmapped	0		0	GACACTTTGCATGTGAACTAGTGTTAGATCTATTTTCCTCTCCTCTATAACTGTCTTCTC	4642	0	UF_Msa_AF_102324	contig09059___1_nr0nt	contig09059___1_nr0nt	Unknown	
4763	59	7	unmapped	0		0	GAAAGAAAATAAGATAGATCCATCTCTGGATGAAGACACTGATTCTACTGTTCTTGACCC	4644	0	UF_Msa_CF_120357	contig13200___0	contig13200___0	Unknown	
4764	59	8	unmapped	0		0	GTTGGTTTCATTGTTTGATTACCTGGTCTTAAAGGCTGCATTAAGTCTTACAACTTTTTG	4646	0	UF_Msa_CF_126728	contig05289___0	contig05289___0	Unknown	
4765	59	9	unmapped	0		0	CTGAGCTCCTGATGGATCAGGCACAGAACAGTCCACTTTTGTCTTTGGTTGGACCTTGTT	4648	0	UF_Msa_CF_121292	contig04812___0rc	contig04812___0rc	Unknown	
4766	59	10	unmapped	0		0	TAAGTTAATCTTTAACTAGTTGCGTGATCAGACTGGACTGACGTCAGGGACTGCGGATCT	4650	0	UF_Msa_CF_126014	contig31015___0	contig31015___0	Unknown	
4767	59	11	unmapped	0		0	ACTCTGGTCCCGGTCTCGGACCCTGGTCCCCGGTCCTGGTCCCAGACTCTGGACCCTGGT	4652	0	UF_Msa_CF_123631	contig03134___0rc	contig03134___0rc	Unknown	
4768	59	12	unmapped	0		0	GAAGCACATGGTGCTTTGCTGCATCATGATGGCACCATCACCTGCCTGGAGTTTTATGGG	4654	0	UF_Msa_AF_105042	contig18369___1_nr0nt	contig18369___1_nr0nt	Unknown	
4769	59	13	unmapped	0		0	CAAATTTTACCAATACCTGCATTGAGCAGACTAGAAGATCCCCTCGGAGCTATCATGACC	4656	0	UF_Msa_AF_104120	contig03414___1_nrnt0	contig03414___1_nrnt0	Unknown	
4770	59	14	unmapped	0		0	GCTCCTCCTCTGCCAGTGTGGAGGGGACAGTAATGAGAGGCTGCTTCATGGGCATGGTCA	4658	0	UF_Msa_CF_126222	contig11371___0	contig11371___0	Unknown	
4771	59	15	unmapped	0		0	TTTAGGTGAGGGTGCTGGAGTGGTAACCCTACATCGCCGTCCTGGGGCGATTAAGGAGAA	4660	0	UF_Msa_CF_123569	contig00950___0	contig00950___0	Unknown	
4772	59	16	unmapped	0		0	TCTGCAGATCTCCTCAGTGCAGCTGGCTAGACACAGGACCGTACAGCTGTTTTGTCCCAA	4662	0	UF_Msa_CF_126597	contig25696___0rc	contig25696___0rc	Unknown	
4773	59	17	unmapped	0		0	ATCCCTGACAAGGCACGGTGAGAAAAGGCACTATACTACCCTACAGTAAAAGCAAAACAG	4664	0	UF_Msa_CF_126967	contig29236___0rc	contig29236___0rc	Unknown	
4774	59	18	unmapped	0		0	TCTAAAACATGCTCACGTTACAAAGGATCAGATTGATGGACTGCGCTTCGAGAGGGCTTT	4666	0	UF_Msa_CF_120235	contig26977___0rc	contig26977___0rc	Unknown	
4775	59	19	unmapped	0		0	TCAGGTGTATTTCCAGCACTGGTATGGAGCCCGTCCTGCTCCGCCTCAAAAAACAAAAAA	4668	0	UF_Msa_AF_105956	contig29315___1_nrnt	contig29315___1_nrnt	Unknown	
4776	59	20	unmapped	0		0	GAACCCCCCTTCCTTACCCTGTGTTTAATAATTTAAAACATTCAACGTTATCACTTTTGT	4670	0	UF_Msa_AF_101390	contig13613___1_nr0nt	contig13613___1_nr0nt	Unknown	
4777	59	21	unmapped	0		0	AGCGCACACAACATGTCTACAGAGTCTACGTCACCACGTGCCTCGGCTTCGGAGGAAACA	4672	0	UF_Msa_CF_121866	contig18458___0	contig18458___0	Unknown	
4778	59	22	unmapped	0		0	GCCAAAGTCCAGGCTTTATCAAAACAATAATAAAATCAGTCTTCTTTTGAAGAGTCTCAG	4674	0	UF_Msa_CF_118554	contig28252___0rc	contig28252___0rc	Unknown	
4779	59	23	unmapped	0		0	CTGAACCATTGTGCTGCCCACTACACTCCCAACGCCGGAGACACCGACCGTCCTGCAGTA	4676	0	UF_Msa_AF_107711	contig21983___1rc_nrnt	contig21983___1rc_nrnt	Unknown	
4780	59	24	unmapped	0		0	CTATACCCGATGAGGAGGACACACACCTGTAGAGGCGACTAGGGAAGGAGAAGATGAAAC	4678	0	UF_Msa_CF_118127	contig16582___0	contig16582___0	Unknown	
4781	59	25	unmapped	0		0	TGGGCTTTGTGGACATCCTGCACAAACTCACCCAGGCCTCTGACTCCAACCTCAGTGACA	4680	0	UF_Msa_AF_100972	contig00568___1rc_nrnt	contig00568___1rc_nrnt	Unknown	
4782	59	26	unmapped	0		0	CTTAAATTATGAACTGATGATGGTGCTGGAGGAAAAGGGAAGGGATCACCAAAAGTACAA	4682	0	UF_Msa_CF_127001	contig07158___0	contig07158___0	Unknown	
4783	59	27	unmapped	0		0	CCATCCCGCCTCAGCTAACGCCGCTACTGTCCAGCAGTCCCTCATCATGGGCTCAGCGGT	4684	0	UF_Msa_CF_121919	contig08334___0	contig08334___0	Unknown	
4784	59	28	unmapped	0		0	AGTAATGGCAATTGATAGTGAGTTTCCTGTGATTCTGGGCCGTGATGTGTCTGGTGTAGT	4686	0	UF_Msa_AF_108760	contig26480___1_nrnt0	contig26480___1_nrnt0	Unknown	
4785	59	29	unmapped	0		0	AACTGACTTACCGGCCACAAATGCCTTTAAAGGTAAACACCCACAATGCACAGCTTTGTG	4688	0	UF_Msa_CF_125803	contig10140___0	contig10140___0	Unknown	
4786	59	30	unmapped	0		0	TAACATCTTAGCGACACAATGTCTCATCATATCCCAGGACAACCGGTCACTGCTATTGTG	4690	0	UF_Msa_CF_121614	contig27566___0	contig27566___0	Unknown	
4787	59	31	unmapped	0		0	ATCTCGACTTATCCGGGAGCTGCACAACCTCTACCCGCTGAAGGGCCTTCGGCACATAAA	4692	0	UF_Msa_AF_110032	contig00708___1rc_nrnt0	contig00708___1rc_nrnt0	Unknown	
4788	59	32	unmapped	0		0	GAGCGGAGGCTGGACCATTATGGCGGCCGTCATGAGGCTTGTAAACAGAAGTAATATAAG	4694	0	UF_Msa_CF_127336	LMB_S454.572.C1___0	LMB_S454.572.C1___0	Unknown	
4789	59	33	unmapped	0		0	GACTACCGCGTACAGCACGATGCAGCAGCGCTCTCGGCCGACGGTTCACGTTGACAGTTT	4696	0	UF_Msa_AF_108928	contig07572___1rc_nrnt0	contig07572___1rc_nrnt0	Unknown	
4790	59	34	unmapped	0		0	CTCTTACGGAACTGCCAACATAAGCCCACTGCCCTGCGATGGAAATGTCCTCAAACTCAA	4698	0	UF_Msa_AF_102389	contig20197___1rc_nrnt-1	contig20197___1rc_nrnt-1	Unknown	
4791	59	35	unmapped	0		0	ATTGACAGAGCCTGAATTATTATAGACTGATCGTGGGCCATAAAGAGAGCTGGGTTTTTT	4700	0	UF_Msa_AF_102787	LMB_S454.sd.141.C1___1_nrnt	LMB_S454.sd.141.C1___1_nrnt	Unknown	
4792	59	36	unmapped	0		0	TATATGGACCGTCCAAGTGGTGGCTCCTACAGAGATTCATATGATGGTTACGGATGAACA	4702	0	UF_Msa_AF_107730	contig05558___1_nr0nt1	contig05558___1_nr0nt1	Unknown	
4793	59	37	unmapped	0		0	TTCTTCTGTCTAAGAATTCACCGTGACATGTGGAGCGCCATCTTTGAACATTCAGACAAC	4704	0	UF_Msa_CF_127551	contig16932___0rc	contig16932___0rc	Unknown	
4794	59	38	unmapped	0		0	TTACAGGCCAGGAGAACAGAAACAACTTGAAAGCAGAACACTGGCATCTTGTCTCAGTGA	4706	0	UF_Msa_AD_200026	LMB_Add_123_rc	LMB_Add_123_rc	Unknown	
4795	59	39	unmapped	0		0	TGGAGAGATTTCAAAGGTCGCACAAAGAGAGGAAGCCCCAAGTATAGCCACTACAAAAGT	4708	0	UF_Msa_CF_124404	contig22443___0	contig22443___0	Unknown	
4796	59	40	unmapped	0		0	TGTTCTTTGGCTTCACTGTTGTCTACGGCCTTCGTGTGAACCTCAGTGTTGCATTGGTAG	4710	0	UF_Msa_AF_104141	contig09904___1_nrnt0	contig09904___1_nrnt0	Unknown	
4797	59	41	unmapped	0		0	TTTAAGGCTAGTGTCACAAATTTCAAAGGTTTCAACCCAAAGTGCCTCCTACCCAGCAGC	4712	0	UF_Msa_AF_108722	contig10695___1rc_nr1nt0	contig10695___1rc_nr1nt0	Unknown	
4798	59	42	unmapped	0		0	TTTCTAATTTGTTTTTATACTGTAGGTAGGAGAGACAGAAACAGGTTAACAAGAAGCGAG	4714	0	UF_Msa_AF_101163	contig00424___1rc_nr0nt1	contig00424___1rc_nr0nt1	Unknown	
4799	59	43	unmapped	0		0	ATATTGAAACTCAGCATGCCAACCGCAAACACAAATGTCCTGTCTGTTCAGAGCAGTTCC	4716	0	UF_Msa_AF_107914	contig19496___1rc_nrnt0	contig19496___1rc_nrnt0	Unknown	
4800	59	44	unmapped	0		0	CTCACCATCCCAGCTGGCAGAGAGTTGTTCCCCGGTATAGAGTCTCTCAACGTCTCTGTA	4718	0	UF_Msa_AF_105829	contig07492___1_nrnt0	contig07492___1_nrnt0	Unknown	
4801	59	45	unmapped	0		0	AGTAAACATAAACATGCAGTTTGCTTCCTCTCTGCTGAACAGATAATAAAGGTGAAACCC	4720	0	UF_Msa_AD_200167	LMB_Add_106_rc	LMB_Add_106_rc	Unknown	
4802	59	46	unmapped	0		0	GGAGCACAATACAGACGTATGAGAGACGCCGCTAAACAGTCATCTCCTCACCTGCTGCTT	4722	0	UF_Msa_CF_127583	contig09994___0	contig09994___0	Unknown	
4803	59	47	unmapped	0		0	ATCAGTTCAGATTGGGCGGTGTTCCGGGAATTTTTTACAAGGGTCAGACGATCAAACGTT	4724	0	UF_Msa_CF_127350	contig23885___0rc	contig23885___0rc	Unknown	
4804	59	48	unmapped	0		0	ACAGCAGCTGGCAGAATATCAGGAAGAAATTACTCAACAAAAGGATCTCCTGAAGCAACA	4726	0	UF_Msa_CF_121259	contig10192___0rc	contig10192___0rc	Unknown	
4805	59	49	unmapped	0		0	ACCAAATCTCAGTTTGTTTTCAGGGATAAATGGATCTACGTGCAGAAAGGGAGCACAAAA	4728	0	UF_Msa_AF_109062	contig32206___1rc_nr1nt0	contig32206___1rc_nr1nt0	Unknown	
4806	59	50	unmapped	0		0	ACGAGGGAGATAAATGCTCTGAGGGAGGCAAAGACCCTCAACCCTCAACAGACACTAGAG	4730	0	UF_Msa_CF_125904	contig21438___0	contig21438___0	Unknown	
4807	59	51	unmapped	0		0	CGTCAACGCCACCATGGTGTTCGAGTTCCTTTACAAGATGTGCGACGTCATGTCCGCCTA	4732	0	UF_Msa_AF_106204	contig15320___1_nr0nt1	contig15320___1_nr0nt1	Unknown	
4808	59	52		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
4809	59	53	unmapped	0		0	AGGAGAGGGCATTTTCATAAATATGCAAATACAAGGTCACATCGTCATCAACATCATCAT	4735	0	UF_Msa_CF_118304	contig18705___0	contig18705___0	Unknown	
4810	59	54	unmapped	0		0	TGTAATCTACCCAACTCAGGAGGAACTGGAAAATGTACAGAACATGGTGTCCCACACAGA	4737	0	UF_Msa_AF_102476	contig21541___1rc_nrnt	contig21541___1rc_nrnt	Unknown	
4811	59	55	unmapped	0		0	GAAGTTAAGAATGTGAAGTATAATGCTGCATCTCCTCTCATTGATCTCATTTCTTCATTC	4739	0	UF_Msa_CF_123633	contig31958___0	contig31958___0	Unknown	
4812	59	56	unmapped	0		0	AAGAAAATTGAAAACTCCTGGAGGGAAGCTGTTCACAGTGCCAAATGAAACCCTCGCCAT	4741	0	UF_Msa_AF_102280	contig06684___1rc_nrnt-1	contig06684___1rc_nrnt-1	Unknown	
4813	59	57	unmapped	0		0	CTGGGAGCCTGTTTGGAATATGTCTATTTATGACAAGTCTGGTTTATTTTGATGTATATG	4743	0	UF_Msa_AF_109793	contig28186___1rc_nrnt-1	contig28186___1rc_nrnt-1	Unknown	
4814	59	58	unmapped	0		0	AGCCAGACGAAGGAGCTGTGTAACATGATCCTGGACTGCTGCGCTCAACAGAGAACCTGC	4745	0	UF_Msa_AF_108786	contig00340___1rc_nrnt	contig00340___1rc_nrnt	Unknown	
4815	59	59	unmapped	0		0	ACAACTAATAATTTAAAAATGCCCAGAGGAAGCAGAAGCCGAACATCCAGGATGGCTCCC	4747	0	UF_Msa_AF_107904	contig14243___1_nr0nt1	contig14243___1_nr0nt1	Unknown	
4816	59	60	unmapped	0		0	TGACAGGTTGGAGGGCCAGCAGCCAGGAGTCAGTACCAGCAAAAGCACCGTCAGGCAGCA	4749	0	UF_Msa_AF_109216	contig20756___1_nrnt0	contig20756___1_nrnt0	Unknown	
4817	59	61		0		0		1286	1	ETG05_66023	ETG05_66023	ETG05_66023		CONTROL
4818	59	62	unmapped	0		0	AGTCCAAACTGAAGATGCAGCAGTTTACTACTGTCAGAGTTATCATTGGATCAATAGTCC	4752	0	UF_Msa_AF_109978	contig10415___1rc_nrnt	contig10415___1rc_nrnt	Unknown	
4819	59	63	unmapped	0		0	TCTTGCAGCCGCTGTGTTTACTAAGGATATTGATAAGGCCAACTATGTCTCCAATGGGCT	4754	0	UF_Msa_AF_102474	contig06009___1_nr1nt0	contig06009___1_nr1nt0	Unknown	
4820	59	64	unmapped	0		0	ATTTGAGATATTACATAATGGCAACCTGTATGGAGAAATCTGGCTGTACCCTGTCCCGGG	4756	0	UF_Msa_CF_124794	LMB_S454.sd.562.C1___0	LMB_S454.sd.562.C1___0	Unknown	
4821	59	65	unmapped	0		0	TTCCGTGAGCTGCGTGTATGTGGGTGCGTCAGGGTTGGCTCTGGATGTGTCGACGCAGCT	4758	0	UF_Msa_CF_126609	contig10811___0	contig10811___0	Unknown	
4822	59	66	unmapped	0		0	TCGTGGGATAACGAGGACAACAAAATTTCCCTTTGGTCCATTGGGAATTATGGAAGTTCT	4760	0	UF_Msa_AF_101181	contig11052___1_nrnt	contig11052___1_nrnt	Unknown	
4823	59	67	unmapped	0		0	GTAAAGTGCTCATCGGGACCAGTTTTCCTACCAGGTTTTGAGCTCTTTCAAAATCAACCA	4762	0	UF_Msa_CF_121945	contig24021___0	contig24021___0	Unknown	
4824	59	68	unmapped	0		0	TTTAACCGCCGAGCTAACTTTCGGCTCACTGGCTCTACCCGAATAAAAAGCTCCAAAGTC	4764	0	UF_Msa_CF_125788	contig23802___0rc	contig23802___0rc	Unknown	
4825	59	69	unmapped	0		0	ACTTTATTAGTGGACAATGAGGACGCTGCTTGTGCTGTATCTGTGTGTGTACGTCGTATG	4766	0	UF_Msa_CF_121135	LMB_S454.sd.492.C1___0	LMB_S454.sd.492.C1___0	Unknown	
4826	59	70	unmapped	0		0	AATTCTGCAGACAGTATTCATTGCCTTACCACCACATATTAAAAAGCCAGCACTGAACGT	4768	0	UF_Msa_AF_104002	LMB_S454.sd.80.C1___1_nrnt	LMB_S454.sd.80.C1___1_nrnt	Unknown	
4827	59	71	unmapped	0		0	AAACAAGGACATGCAATTTATGACACTATACACAGGCTGCACCCACAGCTGTTCACTGTC	4770	0	UF_Msa_CF_121367	contig30781___0rc	contig30781___0rc	Unknown	
4828	59	72	unmapped	0		0	TGAGAGATGGGGAAGGCTGTCGGAGAGGGGGGACCCGGAGAGGAAGAGCAGGACGGTCGA	4772	0	UF_Msa_CF_126851	contig10224___0	contig10224___0	Unknown	
4829	59	73	unmapped	0		0	TGCTTGAAAAAGGCAGCAATGCACAGGCAGCTAGACTATGAAGAGGAGGCGGATTCGGCA	4774	0	UF_Msa_CF_118250	contig20319___0	contig20319___0	Unknown	
4830	59	74	unmapped	0		0	GGCTCCACCACATGCTACCTCCTGTCCCAGGCTTTCGGAAAACGCTATATTGTTAACCTC	4776	0	UF_Msa_AF_109967	contig25264___1_nr1nt0	contig25264___1_nr1nt0	Unknown	
4831	59	75		1028	E1A	0		1348	1	(+)E1A_r60_a20	E1A_r60_a20	E1A_r60_a20		CONTROL
4832	59	76	unmapped	0		0	TGTCTTTTAAACTATACAGACAGTATACGGGAGACTAGGCAACCATGTCTGAAAGGAAGG	4778	0	UF_Msa_AF_110148	LMB_S454.978.C1___1_nr0nt1	LMB_S454.978.C1___1_nr0nt1	Unknown	
4833	59	77	unmapped	0		0	TTCCCCTGCAGAGAAGTCCCAGCTGGACTGCACCAACAAACTGCTTAAGTCTGCCCAAAC	4780	0	UF_Msa_AF_103322	contig05966___1_nrnt0	contig05966___1_nrnt0	Unknown	
4834	59	78	unmapped	0		0	AAGGTCATCATCCACGGGTACAGGGCTCTGGGCAACAAGCCGTCCTGGGTGAAGGAGCTG	4782	0	UF_Msa_AF_106888	contig09378___1rc_nrnt-1	contig09378___1rc_nrnt-1	Unknown	
4835	59	79	unmapped	0		0	AGAGGAGGAGAGACTTGAGCAAGTTAGAAGGCTAGAGGAGCTGATGCGGGTGAAGCAGGC	4784	0	UF_Msa_CF_121082	contig25295___0rc	contig25295___0rc	Unknown	
4836	59	80	unmapped	0		0	GGCCAGTCTTTGAACACGTCGGCGTGGAGGCGCCGCCGGTTTCACTTCAGGACAACTTGA	4786	0	UF_Msa_CF_123664	contig17584___0rc	contig17584___0rc	Unknown	
4837	59	81	unmapped	0		0	ATCACGTGAAGCGCTTGACTGGGAGGAAATAAAATGACAGGAGACAACATGTGTAAGGGA	4788	0	UF_Msa_CF_123805	contig04066___0	contig04066___0	Unknown	
4838	59	82	unmapped	0		0	ATGAGGAAAAATTTAAGGCAGCGCGACATAAGGACAATCTGGTTGTAGTGGTTCAGGTCC	4790	0	UF_Msa_CF_117982	contig00193___0	contig00193___0	Unknown	
4839	60	1	unmapped	0		0	TACTCTTCCGGAATTTGAGCATCTACCATCAAGCCCTCATTTCTTGTCCGAGTGCTTTCT	4633	0	UF_Msa_CF_120523	contig28182___0rc	contig28182___0rc	Unknown	
4840	60	2	unmapped	0		0	GTGTCACCTGCATAATTGCCTGATAATGGTGGTGTTGCCAAGTAAACTGTTTTCACTGGG	4635	0	UF_Msa_CF_122646	contig01380___0rc	contig01380___0rc	Unknown	
4841	60	3	unmapped	0		0	AGAAGAACATGGGAGTCGTGGAGAGCAACAAAGAAAATAGTCCCCATCAGACAGCTTCAT	4637	0	UF_Msa_AF_105365	contig28455___1_nrnt	contig28455___1_nrnt	Unknown	
4842	60	4	unmapped	0		0	TTCCTCATGAGGAGGAGTCCCCAGCTGGCCCAGAAGTCAAATGAGGAGCCAGAAAAGGAG	4639	0	UF_Msa_CF_124700	contig09583___0rc	contig09583___0rc	Unknown	
4843	60	5	unmapped	0		0	CATCAAGTAAGAAATCGTCAGACACCATCAAACTGCAGAAGAAGGTGAAGAAAGGAAAGG	4641	0	UF_Msa_AF_110167	contig11975___1_nr0nt	contig11975___1_nr0nt	Unknown	
4844	60	6	unmapped	0		0	TGTCGGATACAGGAGGGATCAGGGACAAGTTAGGGGACATTATCAGTCCATCTCCTGCAG	4643	0	UF_Msa_CF_123184	contig09983___0	contig09983___0	Unknown	
4845	60	7	unmapped	0		0	TGAACATCCGTGCCTACGTCAGTGCGCAGATGGGTGTTCCAACAAAGACAGTTGGTGTGA	4645	0	UF_Msa_AF_105498	contig09516___1_nr0nt	contig09516___1_nr0nt	Unknown	
4846	60	8	unmapped	0		0	AAAGTGCGCACAGTGTTTCTCCTGGGTAGCTCCCCACAGGATGACCCTGACCTCAACTCA	4647	0	UF_Msa_CF_120811	contig15827___0rc	contig15827___0rc	Unknown	
4847	60	9	unmapped	0		0	AATGCAGGACAATGACAAAAATGGAAGCGAGCTGGAGACGAAGAAGCCCCAAAACAAAAG	4649	0	UF_Msa_CF_127362	contig05194___0rc	contig05194___0rc	Unknown	
4848	60	10	unmapped	0		0	GGTCTACCCGTCCAAACAACGCTGCTCCGCCAGAGAGGCTCTCCTCCATCCATTCTTCTT	4651	0	UF_Msa_AF_108992	contig20132___1_nrnt0	contig20132___1_nrnt0	Unknown	
4849	60	11	unmapped	0		0	TACATTCGTCCAGAGAGAAGCTACGATTCACTTGAAGCCCTCATTACGGCCATCAACAAT	4653	0	UF_Msa_AF_101527	contig28859___1_nrnt	contig28859___1_nrnt	Unknown	
4850	60	12	unmapped	0		0	CCTCCTGTGTGTCAGGCGGAGGCTCAGATGGACCTGGACTGTACATATAATTTATTACAG	4655	0	UF_Msa_AF_104249	contig08999___1_nr0nt	contig08999___1_nr0nt	Unknown	
4851	60	13	unmapped	0		0	TTCAGAGTCTGAGAGCAGCAGTGATGATGAATCTGAGTCCAGGAAGAGGAGTGGAGTGGA	4657	0	UF_Msa_CF_120631	contig05620___0	contig05620___0	Unknown	
4852	60	14	unmapped	0		0	TTTGATGCAAAGAGGAACAATGTGGCCATGCTGCTGGAGACTAACTACAGAGAGAGGTTA	4659	0	UF_Msa_AF_105415	contig12030___1_nrnt	contig12030___1_nrnt	Unknown	
4853	60	15	unmapped	0		0	AAGGCAGTGAAAATGACTCTGAAAAACAGGGAGCCCACTCAGCTGGAATCACTGAGTATT	4661	0	UF_Msa_AD_200330	LMB_Add_22	LMB_Add_22	Unknown	
4854	60	16	unmapped	0		0	ATTCCCTACCTGGAGTTGCCACTCCACCGGTTTCCTACTGATTACTGCGCTAATCCTCAT	4663	0	UF_Msa_CF_125586	contig08461___0rc	contig08461___0rc	Unknown	
4855	60	17	unmapped	0		0	AGAGGTTCGGGTCATGGTGGCGTCTGCGCAGAAGAACCTGCTGGAGGAGAGACTCAAACT	4665	0	UF_Msa_AF_100205	contig14057___1_nrnt	contig14057___1_nrnt	Unknown	
4856	60	18	unmapped	0		0	ACAAATTCTCTTAAACCCGGACGAGCCGGTGGAGGTAAAAATGGTAGCCTCTTGACTAAA	4667	0	UF_Msa_CF_118350	contig19505___0	contig19505___0	Unknown	
4857	60	19	unmapped	0		0	AAGTCCATCAAGAAGGGCCTGAAGTGGCTCCTCAACAACATCGCCAAGGACTACGAGGCC	4669	0	UF_Msa_AF_110253	contig19916___1rc_nrnt	contig19916___1rc_nrnt	Unknown	
4858	60	20	unmapped	0		0	TCAGTCTTCAGAGCACTGGTAGCGTACTACTGCGTGGATGTCATAGTGTGACCTCCGCCG	4671	0	UF_Msa_CF_119537	contig24662___0	contig24662___0	Unknown	
4859	60	21	unmapped	0		0	GTGGAGTACTCGGTGGACAAGAGCGACCTGCAGACATCTCTGGAGAAGAAGATTGAAGAG	4673	0	UF_Msa_CF_124112	contig23268___0	contig23268___0	Unknown	
4860	60	22	unmapped	0		0	GTCTGAAAGATCAGAACGCTCCGACCGCTCATACTCTAAAGACACATCTTCCCGCACTTC	4675	0	UF_Msa_CF_123350	contig26674___0	contig26674___0	Unknown	
4861	60	23	unmapped	0		0	TCTTGCTGTCGACAATCTGAGCTTATCCTTGGCAACTATTGCGGTACCATCTTAGCACTT	4677	0	UF_Msa_AF_102068	contig27703___1_nrnt	contig27703___1_nrnt	Unknown	
4862	60	24	unmapped	0		0	AGTAAGAAGAGCCTCCTGCTGAAGGCGATGGGAAAGGAGATTAACAATGCAGACGAGTGG	4679	0	UF_Msa_CF_123261	contig05709___0	contig05709___0	Unknown	
4863	60	25	unmapped	0		0	CCGCCTAAACGGCAGCAGGAAAAGCAAACTCTCCTCCCGCCGCTAAGAAACTGGCAACAA	4681	0	UF_Msa_CF_121313	contig26321___0	contig26321___0	Unknown	
4864	60	26	unmapped	0		0	GCAAACATTTCACCAAACATTGCATGAGTGTGCAGACTTTTAATCAAAGCAAAATCATGT	4683	0	UF_Msa_AF_103492	LMB_S454.1016.C1___1_nr0nt	LMB_S454.1016.C1___1_nr0nt	Unknown	
4865	60	27	unmapped	0		0	GCTCTGTGGATTTGGTCATCCTGATGGTGTGTGCAGTGGCTGTCCTTGTAGTCCATGGGG	4685	0	UF_Msa_AF_110027	contig02847___1_nrnt	contig02847___1_nrnt	Unknown	
4866	60	28	unmapped	0		0	TGGTGGCTGTGAGTTACATCCCAGAAGTGAGAATTATGTCCATTCCAAATCTCCGGTACA	4687	0	UF_Msa_CF_120822	contig16519___0	contig16519___0	Unknown	
4867	60	29	unmapped	0		0	TATGTGAATGTGGGTCTGTCTATCAATGATGCAGTTCTAAGGAGTCGAGTGGAACTGTGG	4689	0	UF_Msa_CF_121681	contig20627___0rc	contig20627___0rc	Unknown	
4868	60	30	unmapped	0		0	ATTTTACCTTTTCCTTGACAAAGATCACAAAATGGATATGACTTACGAAGAGAGCATGGT	4691	0	UF_Msa_CF_127808	LMB_S454.sd.457.C1___0rc	LMB_S454.sd.457.C1___0rc	Unknown	
4869	60	31	unmapped	0		0	TCGCATGTCAGCTGAGGAGCAGCTGCGCTTTAAGTTGGACAACACAATTGGCGGCTCCTC	4693	0	UF_Msa_CF_127051	contig07700___0rc	contig07700___0rc	Unknown	
4870	60	32	unmapped	0		0	ACTCAGTTTACAGAGCACTTTAACAACATGAGCTATTGGGTGCGCTCTTTGATAATCCAG	4695	0	UF_Msa_AF_103443	contig18473___1_nrnt	contig18473___1_nrnt	Unknown	
4871	60	33	unmapped	0		0	ACACAACTTGCAGAATGTAAATGTTACATCCACCAACGGCATCTGCAGACAATGCTGGGA	4697	0	UF_Msa_CF_118752	contig15351___0	contig15351___0	Unknown	
4872	60	34	unmapped	0		0	GCATTCCAGCATGTCAGAGGTTTTAACCTTCATAAATATTGTTTAATGCATACCATTGAG	4699	0	UF_Msa_AF_108000	contig25024___1rc_nrnt-1	contig25024___1rc_nrnt-1	Unknown	
4873	60	35	unmapped	0		0	AGAGGAAGAAGTCGGCCTGCTGTCCAACTACGATGACTCTGTGGAGATGGATGCGGTGGA	4701	0	UF_Msa_CF_120462	contig20329___0rc	contig20329___0rc	Unknown	
4874	60	36	unmapped	0		0	GCTGTGATATTGACTGTGAAAACGACCCTAAAAACTGCATCAGTGAGAATTTGTTCATTG	4703	0	UF_Msa_AF_103382	contig00947___1_nrnt	contig00947___1_nrnt	Unknown	
4875	60	37	unmapped	0		0	TTTCCAGAATGTAGGGCTGAAGATGGCAACAAACCTGGCTATTAAAGTGCCTTCATGCCT	4705	0	UF_Msa_CF_123830	contig04678___0	contig04678___0	Unknown	
4876	60	38	unmapped	0		0	TCAAGAAGGAGGATAAGACTGCTGTGGATCCAGAGGAGCTCACTTTGGTTTATAACCTGA	4707	0	UF_Msa_AF_105281	contig04951___1rc_nrnt-1	contig04951___1rc_nrnt-1	Unknown	
4877	60	39	unmapped	0		0	GAAAAAAGCTGCTAAGGTCATAGGAGAAAACCTTCCCAAAGAACAAGGCCAAGGTGAGAT	4709	0	UF_Msa_AF_104637	contig30836___1rc_nrnt	contig30836___1rc_nrnt	Unknown	
4878	60	40	unmapped	0		0	AACAAGCTAAATTTCATAAAGAATTTGATAAACTGAAGCAAGAGCTGGAGAGGACTTACG	4711	0	UF_Msa_AF_105090	contig28953___1_nr1nt0	contig28953___1_nr1nt0	Unknown	
4879	60	41	unmapped	0		0	AGTCACTCTGCCTGTAATCCATGAGCAGAGTTTGCAGTTTTTAGGCTCTCAGCAGAATTT	4713	0	UF_Msa_CF_119612	contig02378___0rc	contig02378___0rc	Unknown	
4880	60	42	unmapped	0		0	GGAGGACCAAGGTTCTAAGGAAGCTTAATATTTCACATCTAATCAACTTTCTTTATACCA	4715	0	UF_Msa_AF_100188	LMB_S454.sd.274.C1___1_nrnt	LMB_S454.sd.274.C1___1_nrnt	Unknown	
4881	60	43	unmapped	0		0	GCATTGTGTTTGGGCAACCTGCTGCACCTCCAACTTCCTCAGCCCCCTCAGCCCCAGTAT	4717	0	UF_Msa_CF_120060	contig01598___0	contig01598___0	Unknown	
4882	60	44	unmapped	0		0	CTCCACGCCAAGACCATCAACAATGTGAATGAGTAGACTGACACTTTATCCCTTCTGCTC	4719	0	UF_Msa_CF_121642	contig03043___0rc	contig03043___0rc	Unknown	
4883	60	45	unmapped	0		0	ATGAACTGGCTCATCCACACTCTCCTGGCCCAGCATTGGTGGTTGCGAGTCTTCAGTTCG	4721	0	UF_Msa_AF_107784	contig09298___1_nr0nt	contig09298___1_nr0nt	Unknown	
4884	60	46	unmapped	0		0	AGTGCTGGTGGTGGGGGCCACAAAGAAGAGCCCAGTGCCCCGTGTAGCAAAACCACCAGT	4723	0	UF_Msa_CF_121886	contig14595___0rc	contig14595___0rc	Unknown	
4885	60	47	unmapped	0		0	TTGGACTCGTTAGAGCATCTTGGCTATGACGGCCCTCTGCTGGAGGAGAAGGTTCTGCTC	4725	0	UF_Msa_AF_101627	contig21068___1rc_nrnt0	contig21068___1rc_nrnt0	Unknown	
4886	60	48	unmapped	0		0	CACTCCGCATGTTCTAAGAGACGGTGGGTGTTTTCACTTTTATCCACTTTTAAATGGAAA	4727	0	UF_Msa_AF_106596	contig14889___1_nr0nt1	contig14889___1_nr0nt1	Unknown	
4887	60	49	unmapped	0		0	CAGAGATAGTGGAAATTAAGCTAATGCAATGTCACACAGCAAATTACATTTCAGAGCTAA	4729	0	UF_Msa_CF_127513	contig29686___0rc	contig29686___0rc	Unknown	
4888	60	50	unmapped	0		0	TGGCTGCAGCGGCAGCCACTGCTAAGATAACGGCCCAGGCAAGTATGAATCCCTTCCAAA	4731	0	UF_Msa_CF_127252	contig13706___0	contig13706___0	Unknown	
4889	60	51	unmapped	0		0	GGGTGAGGTGTTTGGTGTGGGTCTCGCTGCCTCACAACCTCTGTCACTACTACTGGAGGT	4733	0	UF_Msa_CF_125815	contig06198___0	contig06198___0	Unknown	
4890	60	52	unmapped	0		0	CGGGATCAGAGAGTGAAGAGAGTGAGGAAGGCTCTGAGACTGAGGAAGAGGAGGAGGAGG	4734	0	UF_Msa_CF_125822	contig01317___0	contig01317___0	Unknown	
4891	60	53	unmapped	0		0	AGTGTCCACACTCGGAGCCGCAGTCGAGCAAACGGCGCTGTCTCCATTCCCTTGGCATAA	4736	0	UF_Msa_AF_106231	contig11790___1rc_nrnt	contig11790___1rc_nrnt	Unknown	
4892	60	54	unmapped	0		0	GTCTGTGAGGAGTGAAGTCACCTGCACATCTGGGACAAAGACCGATGACTGGAATGCTCT	4738	0	UF_Msa_CF_127223	contig00149___0	contig00149___0	Unknown	
4893	60	55	unmapped	0		0	GGCTGCTCTGGGTTCCAGTACAAGTTCTCTGTTGTTAGTAACAAGAATGAAGATGACAGC	4740	0	UF_Msa_AF_106695	contig28569___1rc_nrnt-1	contig28569___1rc_nrnt-1	Unknown	
4894	60	56	unmapped	0		0	AGTCCGGAGACGAGAAAGTAAACAGGAGCGAGGAGTCCACGCCTGAAGAGATCAACAGGA	4742	0	UF_Msa_CF_120669	contig12131___0rc	contig12131___0rc	Unknown	
4895	60	57	unmapped	0		0	TTGGAAGAATATGGATGATGGTTTCAACATGGAGAGGACGGGAACAGAAGGCGATGAAGA	4744	0	UF_Msa_CF_120373	contig25553___0rc	contig25553___0rc	Unknown	
4896	60	58	unmapped	0		0	AGAGCATCACCCCACTAAAAACTGTGCAGGAAATTGACACTGCTGGAATTTGGGGTTTTG	4746	0	UF_Msa_CF_126382	contig21909___0rc	contig21909___0rc	Unknown	
4897	60	59	unmapped	0		0	TGATGCCTTCAGAGAGTTTGTGGGCTCTGGGATGAACTACCATCTACAGGGTAATGAATT	4748	0	UF_Msa_AF_109586	contig03585___1_nrnt	contig03585___1_nrnt	Unknown	
4898	60	60	unmapped	0		0	AGTACACATCTCCCGTCTTCATGGATGACAATGGAAATAGGCCCTTTGGACTTTATTGTG	4750	0	UF_Msa_CF_125884	contig03510___0	contig03510___0	Unknown	
4899	60	61	unmapped	0		0	ATACGTTCGTGTTCCTGACGGTCACTTCTGGCTCGAGGGGGATCATCACGGACACAGTCT	4751	0	UF_Msa_AF_101080	contig32293___1rc_nrnt	contig32293___1rc_nrnt	Unknown	
4900	60	62	unmapped	0		0	CAGGCCTGAGTGGGGCCTGAAAATCACACTGGTGTCTTACATGGAGCGCAAAGACCTGGA	4753	0	UF_Msa_AF_101711	contig19736___1_nrnt0	contig19736___1_nrnt0	Unknown	
4901	60	63	unmapped	0		0	GCCAGAGAGGTTTAACTTATTGAGAAAGACTTGCTGTTTTTTCTACCTTTTTCACAAGTA	4755	0	UF_Msa_AF_103515	contig02815___1_nr0nt1	contig02815___1_nr0nt1	Unknown	
4902	60	64	unmapped	0		0	AACAGGCTTAGTGACGTAATCGTGTTTTTGTGGTGTGTGACTGACTGACTGAGTGAGTGA	4757	0	UF_Msa_AF_107429	contig27873___1_nr0nt	contig27873___1_nr0nt	Unknown	
4903	60	65	unmapped	0		0	AAGTTTCCTGCTCTTTAACTCGGTTTGAAAAACAGCTTCAGTTCAATAAAGGTGACAAAC	4759	0	UF_Msa_AF_100885	LMB_S454.sd.229.C1___1_nrnt	LMB_S454.sd.229.C1___1_nrnt	Unknown	
4904	60	66	unmapped	0		0	TCTAGAATTTTGGAAAATCAAGTCTGAATCAGACGTGTGAAGTCCCGTTCCCCGCATCGT	4761	0	UF_Msa_CF_121146	contig31636___0	contig31636___0	Unknown	
4905	60	67	unmapped	0		0	CTCCCAGTGCGGGAAGACCTTCCTCACCTCTGGCGAGCTCCTCCTCCACAAACGGATCCA	4763	0	UF_Msa_AF_100990	contig20862___1_nrnt0	contig20862___1_nrnt0	Unknown	
4906	60	68	unmapped	0		0	TAAAAACCATTGAAGGAGGCGGGGACTTGGTCCAAGGTGTTATTAAATTCAGGTATAGCA	4765	0	UF_Msa_AF_106364	contig30463___1_nrnt	contig30463___1_nrnt	Unknown	
4907	60	69	unmapped	0		0	CATACTGGATACTTAGCGGGTGTAATTCACAAGAGATCAATAAACATGTTTGGGTTTTTT	4767	0	UF_Msa_AF_106711	contig31751___1rc_nrnt	contig31751___1rc_nrnt	Unknown	
4908	60	70	unmapped	0		0	TGAGGCCCGCCAACCAGTTTGTCCCAAGGCTGTACGGGTTCAAGATCCACCCCATGGCTT	4769	0	UF_Msa_AF_104151	contig20986___1rc_nrnt	contig20986___1rc_nrnt	Unknown	
4909	60	71	unmapped	0		0	AAGATACAAGCAGGATGTTTACTTGCTTCCCAAGAAGATGGATGAATACGTCGCCAGCCT	4771	0	UF_Msa_AF_105897	contig18009___1_nrnt	contig18009___1_nrnt	Unknown	
4910	60	72	unmapped	0		0	TTACCCCAGCAGTCGGAGTGACCCATATCCACCTAGCCGTGGTGAGCGATTGGGCAGGCA	4773	0	UF_Msa_AF_105751	contig28668___1_nr0nt1	contig28668___1_nr0nt1	Unknown	
4911	60	73	unmapped	0		0	CTCAGGTGCAGCAGGAGGACTTCATGTTCTGGTTGGGGGCGGTAATGCGCCTACAAGCTG	4775	0	UF_Msa_CF_123242	contig15379___0	contig15379___0	Unknown	
4912	60	74		1028	E1A	0		643	1	(+)E1A_r60_a22	E1A_r60_a22	E1A_r60_a22		CONTROL
4913	60	75	unmapped	0		0	TCTGAACAAACAGGGCACAAGTGCAACTCGGGCTTCGTCTCTGTCAGCGGGTTCCTGTTG	4777	0	UF_Msa_CF_124885	contig21851___0	contig21851___0	Unknown	
4914	60	76	unmapped	0		0	TCCTCGTGGAGAGTCTTATGCTGGGCAGTGCTCGCACACAGAAAACAAGAGCCTGGGTGA	4779	0	UF_Msa_CF_123578	contig26434___0	contig26434___0	Unknown	
4915	60	77	unmapped	0		0	TAGGCTAAATCCTGTTTGTCCAGAGAGTGTGCAGGGCCAGGTAAGTCGACAGAGTCCCCG	4781	0	UF_Msa_AF_103403	contig15571___1_nr0nt	contig15571___1_nr0nt	Unknown	
4916	60	78	unmapped	0		0	ACAGATGTAACATTTCTCCTGGTTCTTGCCAGTGTTTGAGTGGTCGTTACTCTCCTCATC	4783	0	UF_Msa_AD_200366	LMB_Add_79_rc	LMB_Add_79_rc	Unknown	
4917	60	79	unmapped	0		0	TCCTGACCTGGGCCTGCACACACTTCGGCCTGGGTGCTGCTTGCTGGTTCTTGGTCTTCA	4785	0	UF_Msa_CF_126635	contig10446___0	contig10446___0	Unknown	
4918	60	80	unmapped	0		0	GTTGAGCAAATTCCATAGAGGGGCGATGTGAATCAAGTGGAGTCATAATGTGCTACTACA	4787	0	UF_Msa_CF_124021	contig13218___0	contig13218___0	Unknown	
4919	60	81	unmapped	0		0	AAACACCGGCCGATCCCGAGGCTTCGGCTTCGTTCTCTTCAAAGACTCCTCCAGTGTAGA	4789	0	UF_Msa_AF_105434	contig06220___1rc_nrnt	contig06220___1rc_nrnt	Unknown	
4920	60	82	unmapped	0		0	GCAGTGGTCATCAACCAGCCAGCCCCGCTCTCCTCGCCCCACCAGGCCGGCTCTGACACT	4791	0	UF_Msa_AF_106530	contig23542___1_nr0nt	contig23542___1_nr0nt	Unknown	
4921	61	1	unmapped	0		0	ATATCAAGACTTCCTTCCCAAAAGAGAGCCAGTGACCAGCAACAGGAGGAGAAAAACTCA	4792	0	UF_Msa_CF_119199	contig08218___0	contig08218___0	Unknown	
4922	61	2	unmapped	0		0	TAACAATGTTTTGCCCCTTTCGGTCCTTGCCTGATAATTATTAGTAAAGTGAAATAGTGT	4794	0	UF_Msa_AF_106924	LMB_S454.sd.320.C1___1rc_nrnt	LMB_S454.sd.320.C1___1rc_nrnt	Unknown	
4923	61	3	unmapped	0		0	AGTAGAGGGTGGAGGGACCCACTCCAAAGTGGTGTTGGTGGCAGCAGATGGAAAGATCCT	4796	0	UF_Msa_AF_100035	LMB_S454.675.C1___1_nrnt0	LMB_S454.675.C1___1_nrnt0	Unknown	
4924	61	4	unmapped	0		0	ATCCGGGTCAAAGGTCACCAGCTGTTGAACAAGATGGCGGCCGCCGTGTTTTGGAGGAAA	4798	0	UF_Msa_CF_124959	contig13128___0	contig13128___0	Unknown	
4925	61	5	unmapped	0		0	AAATTTATTGATACAGCAGCAGAAACATCAGGTCTGTTCAGCCCCTGGAGAGAGGTTGGT	4799	0	UF_Msa_CF_126841	LMB_S454.385.C1___0rc	LMB_S454.385.C1___0rc	Unknown	
4926	61	6	unmapped	0		0	TAGCCTAGCTCCGCCTCCCAGCAGGTCCAACGGTGTGTGATTGACAGGTCGTTTACTGAT	4801	0	UF_Msa_AF_102202	contig15373___1_nr0nt	contig15373___1_nr0nt	Unknown	
4927	61	7	unmapped	0		0	CGGTGGACTACCATTAATGGAAACGTCTTTGTTTGGTTGTTATTTTGTGGTTGGATCACT	4803	0	UF_Msa_AF_100584	contig31117___1rc_nrnt	contig31117___1rc_nrnt	Unknown	
4928	61	8	unmapped	0		0	ATGGAATTCTTCAGACCACTTTTTCGTTTACGTGAGATCTGGCCCAAGATTAATTTGTCG	4805	0	UF_Msa_CF_120934	contig28049___0	contig28049___0	Unknown	
4929	61	9	unmapped	0		0	ACACAAGTCAAACACTGGTAAGTGTAAAAGGACAGCACCGTCTCCTCCAGTGTAAAGTCT	4806	0	UF_Msa_CF_120715	contig21458___0rc	contig21458___0rc	Unknown	
4930	61	10	unmapped	0		0	AAGAAACTGGTTCAGACCACATATGAATGCCTTATGCATCCATCGACTCTGTGAAGCCTG	4808	0	UF_Msa_AF_109389	contig13622___1rc_nrnt	contig13622___1rc_nrnt	Unknown	
4931	61	11	unmapped	0		0	GGTGAAGACGTCGTGAAGTTCTTTTTTCCTCTAGCTGTGTCTAAGATCCTGATTGAATGC	4810	0	UF_Msa_CF_120948	contig09483___0	contig09483___0	Unknown	
4932	61	12	unmapped	0		0	ACCGTACGATGGAGACACGTACTGCACGGCTGAGGTCATCAGAGACACTATTACCTATAA	4812	0	UF_Msa_CF_126625	contig06361___0	contig06361___0	Unknown	
4933	61	13	unmapped	0		0	TATCAGAGGTATAGTGTATAGCGAGGAATAAGCCTGTGAGGATTTGGGTTGCTAGGCAGA	4814	0	UF_Msa_AD_200390	AY116000_rc	AY116000_rc	Unknown	
4934	61	14	unmapped	0		0	AATGCTCCAATACACGAGATATTTGATGGAATCGGAGTGATGGTGCAGGACGTGCTGAAA	4816	0	UF_Msa_AF_103988	contig27053___1_nrnt	contig27053___1_nrnt	Unknown	
4935	61	15	unmapped	0		0	CAGAAGGATATTGCTAGGCTAGCTCGAGTCTCTGGCAACGTAGCTGTAGCTACATGATGG	4818	0	UF_Msa_CF_120019	contig25115___0	contig25115___0	Unknown	
4936	61	16	unmapped	0		0	AGAAAGGCTCAAGACATTTCGAGGACGTTAAACGTACAAACAACGAGCGTTAAACCCCAG	4820	0	UF_Msa_CF_118429	contig07077___0rc	contig07077___0rc	Unknown	
4937	61	17	unmapped	0		0	ACCGTCAAAGGATATGAAAATGGAAACTTTGTAAGGACCCACCATCCTGGGCAATGTTAT	4822	0	UF_Msa_CF_120932	contig13519___0rc	contig13519___0rc	Unknown	
4938	61	18	unmapped	0		0	AATGTTACATCTGTCTGAAAGCCTTTCCTCTGAGAGAATACAGCCGACACACTGAGCTCT	4824	0	UF_Msa_AF_105320	LMB_S454.sd.386.C1___1rc_nrnt	LMB_S454.sd.386.C1___1rc_nrnt	Unknown	
4939	61	19	unmapped	0		0	AGGAACACTGGGAAGAGTGTTTCCCAGGCCACCGATAGCCAATTGCTGGAGATGTCCCTG	4826	0	UF_Msa_CF_120046	contig21965___0rc	contig21965___0rc	Unknown	
4940	61	20	unmapped	0		0	TTTGCCTTAAAGCTGTCCGCCACCACCAACATACAGATGCCCAAAGTCTCCGGAGCATCG	4828	0	UF_Msa_CF_118316	contig21412___0	contig21412___0	Unknown	
4941	61	21	unmapped	0		0	CTACATCATTCTCCTAAGTGACTTTTAGAGCTATGTGATCCTTGGCATTAAACAAAAAAC	4830	0	UF_Msa_AF_106716	contig00248___1_nr0nt	contig00248___1_nr0nt	Unknown	
4942	61	22	unmapped	0		0	GTTAATGTGAGGACTTCGTTTTCAAACCAGTAAACTAAGTCTTTGGACAAAACGAACATT	4832	0	UF_Msa_CF_127209	LMB_S454.164.C1___0	LMB_S454.164.C1___0	Unknown	
4943	61	23	unmapped	0		0	ATGTTCAGAGGCGACCTCCCCACCGTCAGGGATGCACACGGAAACTACTTTATTGACCGC	4834	0	UF_Msa_AF_103569	contig25777___1rc_nr1nt0	contig25777___1rc_nr1nt0	Unknown	
4944	61	24	unmapped	0		0	TTTCATCCAGTTCCCTCTCCAGGGCCCCGAGGCGCAGCAACAGAGAGCTGTGGTCCTTCT	4836	0	UF_Msa_CF_124143	contig21041___0	contig21041___0	Unknown	
4945	61	25	unmapped	0		0	ATCAGAAAGGAAACTCAACGACTTCCAGGAAGAACAGATAGGCCAACTGTACGAACTCCT	4838	0	UF_Msa_AF_103915	contig12269___1_nr1nt0	contig12269___1_nr1nt0	Unknown	
4946	61	26		1028	E1A	0		390	1	(+)E1A_r60_3	E1A_r60_3	E1A_r60_3		CONTROL
4947	61	27	unmapped	0		0	CAGCCATGAAGATGACAGAGGAAAACAGTTCTGGAAAGTGGGAAATAACAATGGATGATG	4841	0	UF_Msa_CF_119931	contig18673___0	contig18673___0	Unknown	
4948	61	28	unmapped	0		0	AGCACCAAAAGCAAATCTGTGGACTCCAGTTTGGGAGGGCTTTCCAGGTCGAGCACTGTC	4843	0	UF_Msa_AF_107063	contig24027___1_nr0nt1	contig24027___1_nr0nt1	Unknown	
4949	61	29	unmapped	0		0	CCGCAGATGTTATGCCTTCACCCATGCTGCTATGCCAGGAGAACCCCTGGTTGTACTACA	4845	0	UF_Msa_CF_118902	contig21177___0	contig21177___0	Unknown	
4950	61	30	unmapped	0		0	CGGAGGCCAACAAAGCACCAACCTTAACTAGGAAATCACTTGGATAGATTTTAAACCAGT	4847	0	UF_Msa_CF_121032	contig08136___0	contig08136___0	Unknown	
4951	61	31	unmapped	0		0	TCTGATGGAAAGAGGAAATGAAGAAGGGATTCACAATACAGCTAAATGCAGAGAACAGGC	4849	0	UF_Msa_CF_123072	contig31624___0	contig31624___0	Unknown	
4952	61	32	unmapped	0		0	GGGAAACATCTCTCAGTTTGAAGATGGAACCGGAAATATTAGAGATGCCAAGGACCTTGT	4851	0	UF_Msa_CF_121206	contig11678___0	contig11678___0	Unknown	
4953	61	33	unmapped	0		0	CTGAAGGTCAAAAGTAATTTGTACGGATGATGTGTGTAGTACGGAATGAAAGATAAAGGT	4853	0	UF_Msa_AD_200273	LMB_Add_163	LMB_Add_163	Unknown	
4954	61	34		0		0		812	1	ETG04_27747	ETG04_27747	ETG04_27747		CONTROL
4955	61	35	unmapped	0		0	ACAGCATGAGGAGATATTTTGACAAACGATGGACTGAACTGCTGGAATAAAAACATTCCA	4856	0	UF_Msa_AF_103345	contig00979___1rc_nrnt	contig00979___1rc_nrnt	Unknown	
4956	61	36	unmapped	0		0	TAACGGCCTGGACAACAAGCTGAGAGAAGATCTGGAGAGGCTGAAGAAGATCAGGGCTCA	4858	0	UF_Msa_AF_107726	contig12334___1_nrnt	contig12334___1_nrnt	Unknown	
4957	61	37	unmapped	0		0	TTTCTGGACAACGATGAATTGGAGAGGACCGGCATCGACCTCGGCACCACAGGACGTCTA	4860	0	UF_Msa_AF_109253	contig01949___1rc_nrnt	contig01949___1rc_nrnt	Unknown	
4958	61	38	unmapped	0		0	CCATATCTACCACTGGCACCGGCACCGGCTCTGAAAGACGCAGGTCATACCTGACGCCAG	4862	0	UF_Msa_CF_117958	contig14937___0rc	contig14937___0rc	Unknown	
4959	61	39	unmapped	0		0	GCTGTCAGCAGGGAGCAAGCCCGCAGTGCCAAAGTCTCATCATCTCTGCCGAGGATGCCG	4864	0	UF_Msa_CF_119794	contig09961___0	contig09961___0	Unknown	
4960	61	40	unmapped	0		0	CGACGGCCGATGAGTTTCCGAGAGTTTCAGCTGAAATGTCGGTTTTTCACGACGAGATCG	4866	0	UF_Msa_CF_123517	contig31270___0	contig31270___0	Unknown	
4961	61	41	unmapped	0		0	ATGGGAGCTGTTACAGATGATGAAGTTATTCGGAAACGTCTACTTATTGACGGGGACGGA	4868	0	UF_Msa_CF_120825	contig04630___0	contig04630___0	Unknown	
4962	61	42	unmapped	0		0	ATGATTCTGATTACAGTCAGAGTGACGCAGAGGAAGAAGAGACCTCAGACCATGAACAAG	4870	0	UF_Msa_CF_122659	contig12047___0rc	contig12047___0rc	Unknown	
4963	61	43	unmapped	0		0	CACCCAGACTACCAGGAGTTGTATAGCGGAGGTAAAGATTGTAACGTCCTGGCGTGGGTT	4872	0	UF_Msa_AF_100884	contig00402___1_nrnt	contig00402___1_nrnt	Unknown	
4964	61	44	unmapped	0		0	TCTGGACTCATTCGGTAATCTGGAGGTTAGTCCTCCCGTCACTGTGAATGGAAAAAACTA	4874	0	UF_Msa_AF_105766	LMB_S454.sd.547.C1___1_nrnt	LMB_S454.sd.547.C1___1_nrnt	Unknown	
4965	61	45	unmapped	0		0	GGAGGAATAACCAGATTCGGAGCTGGGGAAATGTGGAGTGGGCCCATGACTACGACATGT	4876	0	UF_Msa_AF_101113	contig13994___1_nr0nt1	contig13994___1_nr0nt1	Unknown	
4966	61	46	unmapped	0		0	GCATTAGCTATTTTTAATTGGACAAAGCAAAGAAAACATTGATTACAGTAGCAGAGTCAT	4878	0	UF_Msa_AF_107492	LMB_S454.629.C1___1_nr0nt1	LMB_S454.629.C1___1_nr0nt1	Unknown	
4967	61	47	unmapped	0		0	AGAGGATCCGCTTTGGGAAGATGGCGTTGAAGTGCAGAAACTGCCGCGCTGCCATTCATC	4880	0	UF_Msa_AF_110281	contig00594___1rc_nr1nt0	contig00594___1rc_nr1nt0	Unknown	
4968	61	48	unmapped	0		0	GGGTGGAGCGCAGATCCAGCAGGTCCTCAACATCGAGTGTCTGACCGACTTCTCTGACGC	4882	0	UF_Msa_CF_118923	contig07261___0rc	contig07261___0rc	Unknown	
4969	61	49	unmapped	0		0	GCAGCCACTTAGGCAACAGTCCAAATCCTCCTATTCATAAAAGGTCTATGGTTCAGTACA	4884	0	UF_Msa_CF_127618	contig10838___0rc	contig10838___0rc	Unknown	
4970	61	50	unmapped	0		0	TGTAGGCTATGTATTATATTGCTAGTGACAATGTTGTGGCAGTGACAGTTTTCCCACTGC	4885	0	UF_Msa_CF_127322	LMB_S454.sd.583.C1___0rc	LMB_S454.sd.583.C1___0rc	Unknown	
4971	61	51	unmapped	0		0	CCTGCAGCCTGACAGACCATGAACAGTTTAATAACCACAGAAACAGTGAAGGTTAAAAGG	4887	0	UF_Msa_CF_127413	contig15277___0rc	contig15277___0rc	Unknown	
4972	61	52	unmapped	0		0	TTCACATTCCAGGTTTCGAGACCTCTGCTCATTCAACCAGGATGAGTTCCTTCAGAAAGT	4889	0	UF_Msa_AF_104835	contig12658___1_nrnt	contig12658___1_nrnt	Unknown	
4973	61	53	unmapped	0		0	AATCAAAAATTTGCCGAAGCCCATTGAGAGTCTGATGACACGCTGCTGGTCTAAAGATCC	4891	0	UF_Msa_AF_108757	LMB_S454.sd.516.C1___1_nrnt	LMB_S454.sd.516.C1___1_nrnt	Unknown	
4974	61	54	unmapped	0		0	CAGGACACACACGGGAGAAAGGCCATACAGATGTGAAATATGCAGAAAGACTTTTATCAC	4893	0	UF_Msa_AF_110267	contig07021___1_nrnt0	contig07021___1_nrnt0	Unknown	
4975	61	55	unmapped	0		0	CAGGAGGAGGAAACTCCCGGAGAGAAGTATTATGACAAAGCCAAATGTTTCTTTGACAAC	4895	0	UF_Msa_AF_108956	contig00640___1_nr1nt0	contig00640___1_nr1nt0	Unknown	
4976	61	56	unmapped	0		0	CGTATCCACAGAGTTAAGACATCTACAGTATGGTATGACTCGAGAGCATCCATCAAAAAA	4897	0	UF_Msa_AF_105410	contig07553___1_nr0nt1	contig07553___1_nr0nt1	Unknown	
4977	61	57	unmapped	0		0	TATTTCGGGTTCACTCACTGCCCGGACATCTGCCCGGATGAAATAGAGAAAATGATTGAA	4899	0	UF_Msa_AF_105929	contig24045___1rc_nrnt	contig24045___1rc_nrnt	Unknown	
4978	61	58	unmapped	0		0	ATACACTGCCTCCACCCTGGGACTTCCATCTGTTGCCTGCTGTCCCCTCCTGGGTGTCCA	4901	0	UF_Msa_CF_119350	contig17714___0rc	contig17714___0rc	Unknown	
4979	61	59	unmapped	0		0	TGGCATTCGTATTGAAAATGTGGTCCTTGTCATACCAGCTAAGCCCAAATACAACTACAG	4903	0	UF_Msa_AF_105423	contig27006___1_nrnt	contig27006___1_nrnt	Unknown	
4980	61	60	unmapped	0		0	CTGGGACCAACTTGGGGTTGCTTATGGATGTCTTTAAAGAGTAAATCTATATTTCTTATA	4905	0	UF_Msa_AF_100176	LMB_S454.1099.C1___1_nrnt	LMB_S454.1099.C1___1_nrnt	Unknown	
4981	61	61	unmapped	0		0	ATCCATCCAAGAAGGGATTCACAAACTAACCACCGCCACTTCCTTCCAACTGTTGCTACA	4907	0	UF_Msa_CF_122440	contig24964___0rc	contig24964___0rc	Unknown	
4982	61	62	unmapped	0		0	TGTGAGTTGAGAGGACTTCTACTGCATGGTGGCTCCATCCCACTGTGCCATTAGCCGCTC	4909	0	UF_Msa_CF_122021	contig07991___0	contig07991___0	Unknown	
4983	61	63	unmapped	0		0	AGTGCAAAAGCTGGATCACTGCGGATCACAAAGAGTCCTGGAGCCCTTTTTTATTTGGAT	4911	0	UF_Msa_CF_127819	contig13069___0rc	contig13069___0rc	Unknown	
4984	61	64	unmapped	0		0	GACACACAGCTGGATAGAGCGAGTGTTCACAAAATGCGGGAATGTGGTTTATGTTAGCAT	4913	0	UF_Msa_AF_108128	contig16177___1rc_nr1nt0	contig16177___1rc_nr1nt0	Unknown	
4985	61	65	unmapped	0		0	TTCAGTGAGGACGGCACGGTGCTGCAGATCGCCAACTTACCTGATCTCTATAAAGTGTTT	4915	0	UF_Msa_AF_105183	contig21740___1_nrnt0	contig21740___1_nrnt0	Unknown	
4986	61	66	unmapped	0		0	TAACCAAAGTAGTGATTGTGTATGTATATGTGTGAGTGTGTTCTATTAAAGTAGAACTAG	4917	0	UF_Msa_AF_102804	contig14807___1rc_nr0nt	contig14807___1rc_nr0nt	Unknown	
4987	61	67	unmapped	0		0	AGCACTCGGGCTTGTTGCTACCACAGACGTACGCCAAGTTGTCCGTGAACTTTGTCTACA	4919	0	UF_Msa_CF_119785	contig20179___0	contig20179___0	Unknown	
4988	61	68	unmapped	0		0	CAGTGAGCAAGAGTCGTCGTCCTCAGGGCAGGAGAACAGATTCCCAGTCACATAATTCAG	4921	0	UF_Msa_AF_102604	contig02737___1_nr0nt	contig02737___1_nr0nt	Unknown	
4989	61	69	unmapped	0		0	AACATATGAGTAACACAAGGACATAACATACAGTCAGGTGACTGGACTCAAATACTGTCC	4923	0	UF_Msa_CF_125580	contig18574___0rc	contig18574___0rc	Unknown	
4990	61	70	unmapped	0		0	TTTATGTGCTGATTGTTGGCGGTTGGTCATTTTCTCTTTACGCCATCCAGCTTGTCTGCA	4925	0	UF_Msa_AF_103507	contig19287___1rc_nrnt-1	contig19287___1rc_nrnt-1	Unknown	
4991	61	71	unmapped	0		0	TAACGCCACGTTGCAAAAGTGGCATGACAAAACTAGACTGACTATGGGCAAAAGCAGCAA	4927	0	UF_Msa_AF_104860	contig15664___1_nrnt0	contig15664___1_nrnt0	Unknown	
4992	61	72	unmapped	0		0	TAACAAAGCCATTAGAGGCAAAGAGGCCACACTCTCCTCTTCCTAAAGATGGAATGATGG	4929	0	UF_Msa_AF_105421	LMB_S454.sd.589.C1___1_nr1nt0	LMB_S454.sd.589.C1___1_nr1nt0	Unknown	
4993	61	73	unmapped	0		0	TCCTGCTGGACCATGTGAAGTCTTTCTCTGAAGTTTTCAAACATAATTCCTCTCAGTTTC	4931	0	UF_Msa_CF_123970	contig22661___0rc	contig22661___0rc	Unknown	
4994	61	74	unmapped	0		0	CTATGTGGTGATACCGAGCCGCGAGACCCACAGACAGAAGCTTACGTGTATTGTGACGTA	4933	0	UF_Msa_AF_108832	contig26535___1_nrnt0	contig26535___1_nrnt0	Unknown	
4995	61	75	unmapped	0		0	AAACTGGAGGGACAGGTCCATCCGGGTGAAGAGGTCGGTGAAGAAGGAGAAGCATGGAGT	4935	0	UF_Msa_CF_118769	contig00514___0	contig00514___0	Unknown	
4996	61	76	unmapped	0		0	GCTTAGGCATAAATGAGCCTGATAGATCTGGGTTTGGCTTCAGTGTTTCTAAAAGTGCTG	4937	0	UF_Msa_AF_100002	contig27168___1_nr1nt0	contig27168___1_nr1nt0	Unknown	
4997	61	77	unmapped	0		0	ATTGAAATGAATTCATTTCCTTGCTTCAGCTGGGATTCTCACATCCTTTTCAACTTACCC	4939	0	UF_Msa_CF_124698	contig05790___0rc	contig05790___0rc	Unknown	
4998	61	78	unmapped	0		0	CGAGTACCGTGGCAAACAAGTGTTTAAGTCCTCTGGCTTTTCTCACCAGGAGGCTCTCTG	4941	0	UF_Msa_CF_121836	LMB_S454.206.C1___0rc	LMB_S454.206.C1___0rc	Unknown	
4999	61	79	unmapped	0		0	CAATTGTAATGATCTGGATGCAGGTGTGAGTGTGAAACATGCCTTTTTGAATAAAGAGGT	4943	0	UF_Msa_AF_105995	contig27626___1_nr0nt1	contig27626___1_nr0nt1	Unknown	
5000	61	80	unmapped	0		0	TTTTCAATATGGACTCTACAAGCCAACCTGCTTTTGAGCTCCAGGTTCTGGCCACGTAAT	4945	0	UF_Msa_CF_124077	contig09459___0rc	contig09459___0rc	Unknown	
5001	61	81	unmapped	0		0	TTCATTCATATCTGGGTAAGCATGGGGATCCAGCAGCCAATTGGGGACATTGATATCTAC	4947	0	UF_Msa_AF_106763	contig07696___1_nrnt	contig07696___1_nrnt	Unknown	
5002	61	82	unmapped	0		0	AATTCAAGGAGGCAGAGCGTTTATTCAGCAAGTCTTCTGTCACATCAGTTGCAGCGGTAT	4949	0	UF_Msa_AF_100749	contig31980___1_nrnt	contig31980___1_nrnt	Unknown	
5003	62	1	unmapped	0		0	TACCTCACCACATTGCTCTAGTGACACTGCACATGTCAAAAGGTCATTCCTAACTATGTT	4793	0	UF_Msa_CF_124712	LMB_S454.sd.299.C1___0	LMB_S454.sd.299.C1___0	Unknown	
5004	62	2	unmapped	0		0	ATCAGAGATTCCAGCACCATCTGCCATGAAGGATTACCTGAAGCCAGACACTCTAAAACT	4795	0	UF_Msa_CF_125432	contig21961___0rc	contig21961___0rc	Unknown	
5005	62	3	unmapped	0		0	AGAATGGCCGGGCTGCTGAAAAAGACAACCGGCCTGGTCGGTCTGGCAGTGTCCCACAAC	4797	0	UF_Msa_CF_125466	LMB_S454.146.C1___0rc	LMB_S454.146.C1___0rc	Unknown	
5006	62	4		1028	E1A	0		418	1	(+)E1A_r60_a135	E1A_r60_a135	E1A_r60_a135		CONTROL
5007	62	5	unmapped	0		0	ACTGGCAGCCCCAAACCAGTGTCCCTCCCCTCTTTGGGAACATGATTATTTCCTTTTGTG	4800	0	UF_Msa_CF_124614	contig19009___0	contig19009___0	Unknown	
5008	62	6	unmapped	0		0	TTTTTCTTTTGACGACACATTTGCGAGTCCCGAAACGTCAACTGGAACTCAATGCTGCGT	4802	0	UF_Msa_AF_110280	contig14517___1rc_nrnt	contig14517___1rc_nrnt	Unknown	
5009	62	7	unmapped	0		0	ACAACGCGGCAGGAAACTTTGTCTGTCCGTCAGAACGTCTGTCAGCAAACGGCTGGAAAA	4804	0	UF_Msa_AF_106224	contig30249___1rc_nrnt-1	contig30249___1rc_nrnt-1	Unknown	
5010	62	8		1028	E1A	0		571	1	(+)E1A_r60_a107	E1A_r60_a107	E1A_r60_a107		CONTROL
5011	62	9	unmapped	0		0	GACGCCCATTAAGTTTGTCCTTTACCCAGACCAGAATGGACAGTGGAGGGTCCAGTGTGT	4807	0	UF_Msa_AF_101439	contig32723___1rc_nrnt-1	contig32723___1rc_nrnt-1	Unknown	
5012	62	10	unmapped	0		0	AAAGGCCAAGTTTCTGTCGGGTGTCTCTAAGAAAGACTTCATTGATGTGCTGAGAAGGAC	4809	0	UF_Msa_AF_106965	contig31131___1rc_nrnt	contig31131___1rc_nrnt	Unknown	
5013	62	11	unmapped	0		0	CTAATGCTTCTGCCCCTCCCTGCAGCGTCACATACTAGCTGACTTGTTTGTATGAACAGT	4811	0	UF_Msa_CF_125607	contig10858___0rc	contig10858___0rc	Unknown	
5014	62	12	unmapped	0		0	TTGTCTTTCATGGAGGGGGCAATCATTTATGTCATCAAGAAGAACGATGACGGCTGGTTC	4813	0	UF_Msa_AF_109185	LMB_S454.sd.158.C1___1rc_nrnt	LMB_S454.sd.158.C1___1rc_nrnt	Unknown	
5015	62	13	unmapped	0		0	ATATGCGTCAATAGTGTCCAAGAAGTGTCATCATGTACTGTATGTGGATATGGACCCTCA	4815	0	UF_Msa_CF_117985	contig24183___0rc	contig24183___0rc	Unknown	
5016	62	14	unmapped	0		0	GTGACACAAAAGGGTAATTTATTATTTGGCCAGTGGATTTTCATCTACCACTCCCATTGG	4817	0	UF_Msa_AF_102481	contig29190___1rc_nrnt-1	contig29190___1rc_nrnt-1	Unknown	
5017	62	15	unmapped	0		0	TAGTCCGGCTGACTGGACCTCCGCCGACGGGAGAGTTGGGTCAGCTGATGCTCCCCCCAT	4819	0	UF_Msa_CF_127821	contig09075___0rc	contig09075___0rc	Unknown	
5018	62	16	unmapped	0		0	TCTGAGCGACTGCAGCCTTTCAAAAGTGATTGCTATAACAACAACAAGCATCCCGCAGAT	4821	0	UF_Msa_CF_127149	contig17028___0	contig17028___0	Unknown	
5019	62	17	unmapped	0		0	TGGCCACTTTCCCTCCAATCCTTCGGAGAGGTGCTGTGGAGGAGTGACTCTTCAGTGTGA	4823	0	UF_Msa_CF_118951	contig24250___0rc	contig24250___0rc	Unknown	
5020	62	18	unmapped	0		0	TGTGGTGTATCCCGGTGCGTTTGTGGACCTCTTCACCACACACCTCAGCCTCATATCACC	4825	0	UF_Msa_AF_105739	contig03764___1_nrnt	contig03764___1_nrnt	Unknown	
5021	62	19	unmapped	0		0	TGTCACAAGTGTACTATGACTGTACAATAACAAAGATAAGTGAGGATGCCTTGGATACTG	4827	0	UF_Msa_CF_118791	contig30284___0	contig30284___0	Unknown	
5022	62	20	unmapped	0		0	GGGGGGGAGAGACAGAGGAGGGGCCAATGTGGAGCGAAGGCGGGGCGCACGGTGCTACGG	4829	0	UF_Msa_CF_125614	contig12828___0	contig12828___0	Unknown	
5023	62	21	unmapped	0		0	ATCCGTTTGTGAAGGTCAGGTACTATTCATGCTGTTGGTTATACAGAAGGGAAGTCGGGA	4831	0	UF_Msa_CF_122981	contig29202___0	contig29202___0	Unknown	
5024	62	22	unmapped	0		0	AAGTTCAATTCCAGCATCTCCCCTTTAGCGAGGAGCTCATAGAGTCTTTTGATCTCAGCA	4833	0	UF_Msa_AF_105349	contig19101___1_nr0nt1	contig19101___1_nr0nt1	Unknown	
5025	62	23	unmapped	0		0	GAACATTAATACGAATGGCTGGGAGTCCCAACTCGACACATCGGTGCTGGAGCAGTCCAG	4835	0	UF_Msa_AF_104287	contig00273___1_nrnt0	contig00273___1_nrnt0	Unknown	
5026	62	24	unmapped	0		0	AAATGGTGGCCAGCGCTCGAGTGCAGAAGCTCCTCCGACGATATAAACTAGCGATTGCCG	4837	0	UF_Msa_AF_101192	contig10428___1_nr0nt1	contig10428___1_nr0nt1	Unknown	
5027	62	25	unmapped	0		0	ATCAAGTTCAACAAGTGCATCTACATCGAGGATGCCTGTCTGGAGAGGTTGAGCTCAATA	4839	0	UF_Msa_AF_102368	contig07901___1rc_nrnt-1	contig07901___1rc_nrnt-1	Unknown	
5028	62	26	unmapped	0		0	CTGCTCATCTATACGACCATCCTTAGCCTCCGCAAAGTTTCTACAGGTGACAGGAACATT	4840	0	UF_Msa_CF_119397	contig03130___0	contig03130___0	Unknown	
5029	62	27	unmapped	0		0	CACATGATGCTTTTTGGGCACACATGCCACTTGCACCTTGAGCTTATTTCAACATACATA	4842	0	UF_Msa_AF_101443	LMB_S454.sd.276.C1___1_nr1nt0	LMB_S454.sd.276.C1___1_nr1nt0	Unknown	
5030	62	28	unmapped	0		0	ACCCGCTCCGCTCCTGCTACTCATACACTATTCTCACACAACCTTCACTGTGAACTAGTC	4844	0	UF_Msa_CF_126807	contig09737___0rc	contig09737___0rc	Unknown	
5031	62	29	unmapped	0		0	TGATTGAATCCCTGGACCGGCCCTCGACACACAACTCGTCTCTGGGACTCTACTGTCCTA	4846	0	UF_Msa_CF_120885	contig04023___0	contig04023___0	Unknown	
5032	62	30	unmapped	0		0	TTATTTGGGTCTAGAAGTGATCGAGAAGCCAAAGTACGCTCCACTGAAATACATCGGACC	4848	0	UF_Msa_AF_101918	contig14658___1_nrnt0	contig14658___1_nrnt0	Unknown	
5033	62	31	unmapped	0		0	GAGGGACTGAAATTAGCATAGGAGTCCTCTGTTACTTTAGTAAGAAACTTAAGATAATGA	4850	0	UF_Msa_AF_100250	contig24015___1_nr0nt1	contig24015___1_nr0nt1	Unknown	
5034	62	32	unmapped	0		0	TACGCCATAGCATTGACTATGTCCCCCAATAACCTTGCTGGTGTTACACCCTGACGTCTC	4852	0	UF_Msa_AF_102100	contig27252___1_nr0nt1	contig27252___1_nr0nt1	Unknown	
5035	62	33	unmapped	0		0	CGAGTCCTGAAGTCCATTGCTATCGAGCCCGCTTTGGTTCTCAGGGTGGAAGTAGCCATG	4854	0	UF_Msa_CF_120628	contig31736___0	contig31736___0	Unknown	
5036	62	34	unmapped	0		0	GACTAACACAACAACGGAACCCAAAGGAAACTAAAATCACATTGTTTTCTGATACATGTA	4855	0	UF_Msa_CF_122403	contig10222___0	contig10222___0	Unknown	
5037	62	35	unmapped	0		0	ATAGACTGTATAAAACAGGCGACTGGTTTCACGGGAGTCTCGGACATCGCTGTTAGCATC	4857	0	UF_Msa_CF_120231	contig04478___0	contig04478___0	Unknown	
5038	62	36	unmapped	0		0	AGACAAGAGCCAGCCAGAAAGAGACCGGGTACTCGCAGAATTTCGAAGTGGTAAAGCTCC	4859	0	UF_Msa_AF_103690	contig03486___1rc_nrnt	contig03486___1rc_nrnt	Unknown	
5039	62	37	unmapped	0		0	TGATGGTTTCTCTGTCGTGGCTGACTATTTTGGTCGAGGGGTGTTTAACAAACTGACTCT	4861	0	UF_Msa_AF_106399	contig15381___1rc_nr1nt0	contig15381___1rc_nr1nt0	Unknown	
5040	62	38	unmapped	0		0	TCTCTAGGGTTCACGATGTACAGATTTTTGGTGTTTGAAATCACTCCTTTAAACATCAAA	4863	0	UF_Msa_CF_122395	contig08950___0rc	contig08950___0rc	Unknown	
5041	62	39	unmapped	0		0	ATGGAAAAGGAGAGTTCAAGTGTGAACCACATGATTCGGTGTGCTACGATGACGGCAAAA	4865	0	UF_Msa_AF_102544	LMB_S454.sd.264.C1___1_nrnt	LMB_S454.sd.264.C1___1_nrnt	Unknown	
5042	62	40	unmapped	0		0	CTGTAAGATACTACAGGCGCTGTTCCACTGTGACCAGGTCCAGTACACACTTGTGCCAGT	4867	0	UF_Msa_AF_103096	contig02511___1rc_nrnt0	contig02511___1rc_nrnt0	Unknown	
5043	62	41	unmapped	0		0	GTTCAGAGCCGCTGAATGCGCCGATGGCGCCCTGGAGATGCTATCCATCGCCGCCCCCGA	4869	0	UF_Msa_CF_125697	contig10615___0rc	contig10615___0rc	Unknown	
5044	62	42	unmapped	0		0	ACATGAACACAGGAACATCTCAGTCCCTCTCTGGAGCTCTCAACAGACAGAACCAGCTGA	4871	0	UF_Msa_CF_124057	contig07844___0rc	contig07844___0rc	Unknown	
5045	62	43	unmapped	0		0	CACTGACCTCGGCATCACAATCCTGGTGAACAGAGGATATGTTCCAAGGCAGAAGATACG	4873	0	UF_Msa_AF_103511	contig10296___1rc_nrnt-1	contig10296___1rc_nrnt-1	Unknown	
5046	62	44	unmapped	0		0	AGAAGAGCAGAGAAGAGACTGAGTACATGACTAAGTTGTTAATACCTCAGACTACATTTT	4875	0	UF_Msa_CF_123754	contig14667___0	contig14667___0	Unknown	
5047	62	45	unmapped	0		0	AGACGGGAAGAACATCGGATTCTCCGCAGTCACACAGTCAGGTTATGTCTGTAAGGATGG	4877	0	UF_Msa_CF_119244	contig06689___0	contig06689___0	Unknown	
5048	62	46	unmapped	0		0	TTGTTAAAAGCGGAGCATGTCGTCCAGCAGGAGGCTCGCTGAGCTCTTCACCTCTCTGAC	4879	0	UF_Msa_CF_120541	contig26092___0rc	contig26092___0rc	Unknown	
5049	62	47	unmapped	0		0	GTGATGCGCTGATTGGTGTGAAATATGAGAACAAATAAACAACTACTGCCTTTTACTTCC	4881	0	UF_Msa_CF_125969	LMB_S454.19.C2___0	LMB_S454.19.C2___0	Unknown	
5050	62	48	unmapped	0		0	GGGCTGCCGCCACAACAAACAAGAATGACACCTGCACTAGTTATTCGAGTGATGAAGAAG	4883	0	UF_Msa_CF_125726	LMB_S454.61.C1___0rc	LMB_S454.61.C1___0rc	Unknown	
5051	62	49		1028	E1A	0		1133	1	(+)E1A_r60_a104	E1A_r60_a104	E1A_r60_a104		CONTROL
5052	62	50	unmapped	0		0	GAAGCAACTGGCTGAATACAAGTGTGACACTAATGAAGCTATAAGCTTGAAGCTGGTTCG	4886	0	UF_Msa_CF_126396	contig02765___0	contig02765___0	Unknown	
5053	62	51	unmapped	0		0	AAACAAGTTTTTATCCACGCAATGAATCCTGCCAACGAAACCAGAACCGGGAGAGGTACA	4888	0	UF_Msa_CF_119538	contig20704___0rc	contig20704___0rc	Unknown	
5054	62	52	unmapped	0		0	TAACTTCTACCTTTGCGGCTCCCTGCGGTGTTTGCCTGTGACCTCTAGCACAACCAGGAG	4890	0	UF_Msa_CF_127398	contig22791___0	contig22791___0	Unknown	
5055	62	53	unmapped	0		0	ACAGCTGCTGTCCTCCGCCGCCCCCTCTGCTTCGTATTGTTCCCTCCACGTGCTGAGAAA	4892	0	UF_Msa_CF_117803	contig13741___0rc	contig13741___0rc	Unknown	
5056	62	54	unmapped	0		0	GTTCTCCCCCAGCTGTGTACCCGGGTATAGCCCTCCTCTCAGCAACCCATCCACCCCAAG	4894	0	UF_Msa_AF_102564	contig14732___1_nrnt0	contig14732___1_nrnt0	Unknown	
5057	62	55	unmapped	0		0	TGTGGCTCGCCTGGGACATCCAGGTGAAGAGGTTTGTCGCAATGAAGGTGGTGAAGAGTG	4896	0	UF_Msa_AF_109542	contig20658___1rc_nrnt	contig20658___1rc_nrnt	Unknown	
5058	62	56	unmapped	0		0	AATTTCAAAACTCAGAGGTCCTTGGAGAAAATGTGGGACACAGGGAGAATTGCACTCCCA	4898	0	UF_Msa_CF_126680	contig00175___0rc	contig00175___0rc	Unknown	
5059	62	57	unmapped	0		0	GTGGTTGTAAATGTTATCTACTTGCTTTATGTTGGATTCTTTTCCTTTGTTACACTGCGT	4900	0	UF_Msa_AF_102538	LMB_S454.392.C1___1_nr0nt1	LMB_S454.392.C1___1_nr0nt1	Unknown	
5060	62	58	unmapped	0		0	ATTTCCTTGTTGGATGAGATGACCCGAGTTGCTACTGGTGACATCATCATTAGGCAAAGC	4902	0	UF_Msa_CF_124046	contig10774___0rc	contig10774___0rc	Unknown	
5061	62	59	unmapped	0		0	CTCCTTGCGGCACAACAACCTAAAAAGGAAAAATTAAAAAGGAAATAAACGAGGGGAGGG	4904	0	UF_Msa_AD_200039	LMB_Add_149	LMB_Add_149	Unknown	
5062	62	60	unmapped	0		0	TATGGACATCATTTTGCCCAAGGTAGTACACCCCGCAACTGCGGACACGACACGACCTTC	4906	0	UF_Msa_CF_127231	contig32477___0	contig32477___0	Unknown	
5063	62	61	unmapped	0		0	CCTACCATCACTACTCTAATATCAGACCGTGTTATCTAAATATAGTCCTGTCTATTGTTT	4908	0	UF_Msa_CF_124705	contig00986___0rc	contig00986___0rc	Unknown	
5064	62	62	unmapped	0		0	GGTAGAAACTTATGCAGGACAATGTAAGTATTCTGCTGATTGTTCAATTTGTTGTTTCTG	4910	0	UF_Msa_AF_101686	contig28495___1_nrnt	contig28495___1_nrnt	Unknown	
5065	62	63	unmapped	0		0	GTGTAGAAATCATGATTTACTATTAATTATCATATATTATTATTATTGAAATATGTTTAA	4912	0	UF_Msa_AF_102778	contig08209___1_nr0nt	contig08209___1_nr0nt	Unknown	
5066	62	64	unmapped	0		0	GAAAACGTTGAGAAGTAAAAGTGACAACACACACGACCGCATCCTGACAGACACCATCTT	4914	0	UF_Msa_CF_121442	contig14358___0rc	contig14358___0rc	Unknown	
5067	62	65	unmapped	0		0	TTGTGTTATGTGGCTGCATCAGTGCTCAAGGCTGGGGCACCCATGTGTATGGCGTCTCCT	4916	0	UF_Msa_CF_119840	contig04431___0	contig04431___0	Unknown	
5068	62	66	unmapped	0		0	TGTTTGGGTTTATGTCACACACCCTCTTGCCATTACATCTTTTCCCCATAGCCACAGTGA	4918	0	UF_Msa_AD_200324	LMB_Add_27	LMB_Add_27	Unknown	
5069	62	67	unmapped	0		0	TATTCAAATATTCAAAAACAGGGAACAAAGATCGTGCTGCACCTCAAAGACGACTGCAAG	4920	0	UF_Msa_CF_127704	contig21592___0rc	contig21592___0rc	Unknown	
5070	62	68	unmapped	0		0	TGGAAATCATTCCCTATTCCACAACACTCACACCAATGCTTTGCCTGATGGCTTCGAGAA	4922	0	UF_Msa_AF_101482	contig23335___1rc_nrnt	contig23335___1rc_nrnt	Unknown	
5071	62	69	unmapped	0		0	TATGATGAAGAGGTAGAAGAGGCTATTCCCAAGACTGATGTTTTGGAGAAGCAGCCTGAG	4924	0	UF_Msa_AF_103029	contig05583___1_nrnt0	contig05583___1_nrnt0	Unknown	
5072	62	70	unmapped	0		0	CACTACCCGCCATCACTCCCTGCTCGGGTCCCCCGCCCCTGGCCACAAACTTTACAAACC	4926	0	UF_Msa_CF_119727	contig08654___0rc	contig08654___0rc	Unknown	
5073	62	71	unmapped	0		0	TACCTCAACAACAAAGGACACTCAAAGTGTGGAAAAAGGGGATGTGGAACAACGGCATGA	4928	0	UF_Msa_AF_105036	contig31365___1rc_nrnt-1	contig31365___1rc_nrnt-1	Unknown	
5074	62	72	unmapped	0		0	TCCACTGATCGTGCCCGAGGTTGATGTAAAAAGAAATCAAGCGAGATCAGGGAGTGAAAA	4930	0	UF_Msa_CF_124958	contig11212___0	contig11212___0	Unknown	
5075	62	73	unmapped	0		0	CACTAGAGTCGAACCATCAGTACCCCATGCAATAGTTATAAATAAAATGACCAAAATTTG	4932	0	UF_Msa_AF_110089	LMB_S454.769.C1___1_nrnt	LMB_S454.769.C1___1_nrnt	Unknown	
5076	62	74	unmapped	0		0	AAAGATGTCGAAAAACAACTCCTCAAGGCCACTCTGAATATTGGGCCCAACCAGGACTTA	4934	0	UF_Msa_AF_104014	contig08011___1rc_nrnt0	contig08011___1rc_nrnt0	Unknown	
5077	62	75	unmapped	0		0	AACCAAATGTTGCTGCTGTTAAAGCTGAGATTGAGGTGCAGGTTCTACCTGAACCAGCAT	4936	0	UF_Msa_AF_102326	contig27341___1rc_nrnt	contig27341___1rc_nrnt	Unknown	
5078	62	76	unmapped	0		0	AGACAACTGATCGGTGACAAGATGGCAGCAGAAGAGGACATACAGCGGCTGAGAAGGCAG	4938	0	UF_Msa_CF_124553	contig04027___0	contig04027___0	Unknown	
5079	62	77	unmapped	0		0	ACGCCTCAGTCCATCTCCGACCTCAAGTCCCTGGCCACGGCTCTGCTGGAGACCATCCAC	4940	0	UF_Msa_AF_110039	contig32044___1rc_nr0nt	contig32044___1rc_nr0nt	Unknown	
5080	62	78	unmapped	0		0	GCTCTGGGGATCTTAAGACTCTACCAGGATGTCCTTCTACACATGGACCTCATCAGCATA	4942	0	UF_Msa_AF_104481	contig20880___1_nrnt0	contig20880___1_nrnt0	Unknown	
5081	62	79	unmapped	0		0	ATGTACCAGCGCCCTAAGCGGTCGAGTGAATTTCCGAGTCGCCCTGAAGGCAACACTTTC	4944	0	UF_Msa_CF_121325	contig18312___0rc	contig18312___0rc	Unknown	
5082	62	80	unmapped	0		0	GATGAGTTCTAGGTCAAGGTTTCTCCCTTTGTCACCCTCGCCTCAATATATTCAATCCTC	4946	0	UF_Msa_CF_119177	contig30784___0rc	contig30784___0rc	Unknown	
5083	62	81	unmapped	0		0	ATACGATTAAGCTAACGTTGTTCATTTTATTTTGACCAACGAAAAGCGACGGTTTAAACG	4948	0	UF_Msa_CF_126824	LMB_S454.913.C1___0	LMB_S454.913.C1___0	Unknown	
5084	62	82	unmapped	0		0	GCATCAGAAACAGTATCTTGCGAATCTAAAAAAGTGCCTCTCAGGCCACACACTAAACCT	4950	0	UF_Msa_AF_109765	contig11156___1rc_nrnt0	contig11156___1rc_nrnt0	Unknown	
5085	63	1	unmapped	0		0	TATTACTTCAGGAGAGAATCAGCCTTTAATTAAAACAGCAGATGGCTGGTGACTGCCGGC	4951	0	UF_Msa_AF_104760	contig11141___1rc_nrnt-1	contig11141___1rc_nrnt-1	Unknown	
5086	63	2	unmapped	0		0	GCTGGGGAGGAAATTCAGAGCTTGAAACAACAGATTTTGGATAGAGATAAAGCTATTTGT	4953	0	UF_Msa_AF_103575	LMB_S454.17.C1___1_nrnt0	LMB_S454.17.C1___1_nrnt0	Unknown	
5087	63	3	unmapped	0		0	TTTAGTACGGAAGGAGAGTTAGATGAGGACCAGTCTCTTGTGACAGCCTCTTTGCTTAAC	4955	0	UF_Msa_CF_119260	contig05740___0	contig05740___0	Unknown	
5088	63	4	unmapped	0		0	TAAAAGTGAGAGGGTGAGGAGCCAGCCCGTGCAGCAGAAGTGTAAATTTGGATTTATTTT	4957	0	UF_Msa_CF_121502	contig12393___0rc	contig12393___0rc	Unknown	
5089	63	5	unmapped	0		0	ATATGCGGGAGCCAATTGAGTGGTTCAATTCTAGTGGTTTGTCGTCAGAGGACACAAGAA	4959	0	UF_Msa_CF_119463	contig22925___0	contig22925___0	Unknown	
5090	63	6	unmapped	0		0	GGGGTGAACAAGGTGGAGGGCATGTTGCGGCCGCTCGTGGAGAACGGCTTGAAATGTGTG	4961	0	UF_Msa_AF_100896	contig21827___1_nrnt0	contig21827___1_nrnt0	Unknown	
5091	63	7	unmapped	0		0	TACCATTCTGAGGCATCGCGTCACCTGTAACGTTACCGTGGACTGCAGCAAGCATCCACC	4963	0	UF_Msa_CF_120658	LMB_S454.789.C1___0rc	LMB_S454.789.C1___0rc	Unknown	
5092	63	8	unmapped	0		0	CTGTGCAATGTGCTGAAAGCTCAGGAGGAGGGCGCCGGTGACGGGAGGAAACTTCTTTCA	4965	0	UF_Msa_CF_124665	contig11706___0	contig11706___0	Unknown	
5093	63	9	unmapped	0		0	GCCGGCGACATTGACAGGATACTCAACGAATGTCACTTCAAGACCATCGTTCACGGAGAC	4967	0	UF_Msa_AF_105019	contig15298___1rc_nrnt-1	contig15298___1rc_nrnt-1	Unknown	
5094	63	10	unmapped	0		0	GCTGGCAGACGCTCCGGCGACCTCAGAACAAGCCGGCGCTAATGGAGTGAAGTCAGAGCC	4969	0	UF_Msa_CF_121876	contig29695___0rc	contig29695___0rc	Unknown	
5095	63	11	unmapped	0		0	TGTTTACAGAAGCCAAGGTTTTTCTCCCAACGATCAGGAAAAACAGTTCAGTGGCAGAGC	4971	0	UF_Msa_CF_127349	contig04121___0rc	contig04121___0rc	Unknown	
5096	63	12	unmapped	0		0	CAGCCAAGCCTGCAGCTGAGGATATGACATCAAAGGACTACTACTTTGACTCATACGCCC	4973	0	UF_Msa_AF_105462	contig24363___1rc_nrnt	contig24363___1rc_nrnt	Unknown	
5097	63	13	unmapped	0		0	ATCGACATCATCTTTGCCCAGACGTGGACGGACAGCCGTCTCAGTTACAACAGCACAATG	4975	0	UF_Msa_AF_104845	contig31111___1rc_nrnt0	contig31111___1rc_nrnt0	Unknown	
5098	63	14	unmapped	0		0	GACGTCACTGCTTAATTCCCTTCTCTCTGTGAAGGAGTGCTAATTAGTAGATACTGACAC	4977	0	UF_Msa_CF_127124	contig25522___0	contig25522___0	Unknown	
5099	63	15	unmapped	0		0	CTTGACCCGTCCATCATGGGAACTGGACCAATACCAGCCATCAGGAAAGCGGTTGAGAAA	4979	0	UF_Msa_AF_105118	contig23448___1_nrnt0	contig23448___1_nrnt0	Unknown	
5100	63	16	unmapped	0		0	ATAAAGTTCCAGAGAAGGTTATTAGCAAGATGACGTCCTTGGTGCCTCTGGGAAGAATGG	4981	0	UF_Msa_AF_102201	contig26753___1_nrnt	contig26753___1_nrnt	Unknown	
5101	63	17	unmapped	0		0	ACAAGAACACCACACAAGTCCTCACAAAATGAAAAGCACAAAGAGGAACCTGCTTCTCAC	4983	0	UF_Msa_CF_120284	contig20569___0	contig20569___0	Unknown	
5102	63	18	unmapped	0		0	TTTTACCAGCCTCCAGTCCAAAGAACAAGTATTGCTGGATATGAGCGCTTCAGGATCAGA	4985	0	UF_Msa_CF_118920	contig11689___0rc	contig11689___0rc	Unknown	
5103	63	19	unmapped	0		0	CAAGAGCCATCAAGAACCGCTTCTGCCAAACAACATTACTTGAGGCAGTCAAGATATTTA	4987	0	UF_Msa_AF_108847	contig08704___1_nrnt0	contig08704___1_nrnt0	Unknown	
5104	63	20	unmapped	0		0	GTCCATGATTGAAATAACAGATCCAGTTATTCTGGCTCTGGGGGCATCACGCAACAGGAG	4989	0	UF_Msa_CF_120391	contig25029___0rc	contig25029___0rc	Unknown	
5105	63	21	unmapped	0		0	CCGATTCACGGCTGACTGGCAGGGGAGGGTGGTCTGCCAACACGACGCCCCTCTCTGCAA	4991	0	UF_Msa_CF_123331	contig09544___0	contig09544___0	Unknown	
5106	63	22	unmapped	0		0	TTTCTATTGATGTGTTACTTGCTCTTCTCAGCTACATACAGAAGTTTGTCTCACACTCGG	4993	0	UF_Msa_CF_121781	contig18938___0rc	contig18938___0rc	Unknown	
5107	63	23	unmapped	0		0	TCTGCTGGAGGCCCTGAAGGGAGTCTTCATCACTGACTCCCTGAGGATGGCAGCAGGCAC	4995	0	UF_Msa_AF_104777	contig13650___1rc_nrnt0	contig13650___1rc_nrnt0	Unknown	
5108	63	24	unmapped	0		0	GACTCTGGGGACTAAATGAAGTTATTTGCAGATACCTTATCTGAATGGCTTCTTATTTTT	4997	0	UF_Msa_AF_108232	contig30752___1rc_nrnt	contig30752___1rc_nrnt	Unknown	
5109	63	25	unmapped	0		0	CATTGTCATGTGTCCTGCCTGTTCTTGGAACTACCTGTTCATCATTTTGGATGTACCTGT	4999	0	UF_Msa_CF_120467	contig13422___0	contig13422___0	Unknown	
5110	63	26	unmapped	0		0	AGGACTTTCTGTGTTCACTGCCTCTGCAACGACAACATAAGAGCACTACGCTGCGGAGTC	5001	0	UF_Msa_CF_119109	contig26362___0rc	contig26362___0rc	Unknown	
5111	63	27	unmapped	0		0	GCCTTTGCCCTAACATAAAACTTTTACCACAGTGTTTTCATTCAGGAGTGTAAATACTAA	5003	0	UF_Msa_AF_100761	contig12162___1_nrnt	contig12162___1_nrnt	Unknown	
5112	63	28	unmapped	0		0	TCTGGAGATCCTAAAGATTCTCATGCAGCAGCGGAGCACGGCACTGAGGGGGATAGTCAG	5005	0	UF_Msa_AF_102823	contig30487___1rc_nrnt0	contig30487___1rc_nrnt0	Unknown	
5113	63	29	unmapped	0		0	TACCAAGTGAGTGTTAGTTTTTGTAAATTCAGTGCTGTTGGAATCTGCAATACCGTAAAA	5007	0	UF_Msa_AF_105762	contig29926___1_nr0nt1	contig29926___1_nr0nt1	Unknown	
5114	63	30	unmapped	0		0	AAGGAAATGAACGGCAAGAACTTTGCCAAAATCTGCAAGGACTGTCACATCATCGATGGC	5009	0	UF_Msa_AF_107927	contig05571___1rc_nrnt	contig05571___1rc_nrnt	Unknown	
5115	63	31	unmapped	0		0	TCAGATGCTAAATATGAATTCTGCTCCGACCTTCATTCACTTCCCATCCAAAGGAAAACC	5011	0	UF_Msa_AF_100553	contig21883___1rc_nrnt	contig21883___1rc_nrnt	Unknown	
5116	63	32	unmapped	0		0	CATAAAAGAAACTAAAGACTGTGCTGAAGCTGCAGAGGCAGCAGACGGGGAAATAGTGAT	5013	0	UF_Msa_AF_102832	contig30513___1rc_nrnt-1	contig30513___1rc_nrnt-1	Unknown	
5117	63	33	unmapped	0		0	GCACACTGTACTCACATTTTGAGGAACCGATTTGTTTGACTTTGTTTTTCTCATTTTATG	5015	0	UF_Msa_CF_127642	contig01569___0	contig01569___0	Unknown	
5118	63	34	unmapped	0		0	TACTGAAGCAAGCCCCCGCTGTCAAGTGTCTGTGAAACTGTGCTGCTGTGGCTCTGAGGA	5017	0	UF_Msa_CF_122025	contig21122___0rc	contig21122___0rc	Unknown	
5119	63	35	unmapped	0		0	CTGAGGAGGAGAACCAGTTTCAACAGTATTCACAGCACATCATCAGGGCAGCGGCGGAGG	5019	0	UF_Msa_CF_120579	contig15686___0	contig15686___0	Unknown	
5120	63	36	unmapped	0		0	AAAGCAGTGAGAGTCAGAAAACACCTCCAGTGATGGAAAGGGTTCCAGTGGATCTGAAAA	5021	0	UF_Msa_CF_120865	contig14259___0rc	contig14259___0rc	Unknown	
5121	63	37		0		0		2515	1	ETG10_234183	ETG10_234183	ETG10_234183		CONTROL
5122	63	38		0		0		5024	1	DCP_20_9	DCP_20_9	DCP_20_9		CONTROL
5123	63	39	unmapped	0		0	GCCAAAGAGGGGTTCAGTACTGGACGCCACTACTGGGAGGTGTTTGTTGGGAGAACAAGG	5026	0	UF_Msa_AF_107236	contig02533___1rc_nrnt	contig02533___1rc_nrnt	Unknown	
5124	63	40	unmapped	0		0	GACCACTTTTCCTGCCAACACCAGCATACAACATGTATGGTCCTCTACTGTTTGGTTTTA	5028	0	UF_Msa_CF_123782	contig17000___0	contig17000___0	Unknown	
5125	63	41	unmapped	0		0	AGTCTAAATAGTTTTCACATTTTCTTTTTGCCCAGTGGACTTTAGTTGGTACCTCTGTTT	5030	0	UF_Msa_AF_101515	contig06876___1_nr0nt	contig06876___1_nr0nt	Unknown	
5126	63	42	unmapped	0		0	GCTCGTGTGTCTCTAACGTCTGTCAGTCTCTTGTGTGAACACCGCCTACAGCAAAATCCC	5032	0	UF_Msa_CF_125590	contig19889___0rc	contig19889___0rc	Unknown	
5127	63	43	unmapped	0		0	GACCGAGTGCACGTCTCTAATTTAGAGAAAAAGAAGAAATCTGCTGTACTTTACCAGAAA	5034	0	UF_Msa_CF_127824	contig14012___0	contig14012___0	Unknown	
5128	63	44	unmapped	0		0	CTTGTGCCCTTAAGTACCCGTCCAGTGACCTTTTTAAAGGATTCTTGTGTATATGGCTAA	5036	0	UF_Msa_CF_118614	contig14422___0	contig14422___0	Unknown	
5129	63	45	unmapped	0		0	AGGCAGACGTGCAGCAAGGACAGCAGCAGTTCAACCAGTTTACTGACGGACAGCAGTTGT	5038	0	UF_Msa_AF_109968	contig28158___1_nrnt	contig28158___1_nrnt	Unknown	
5130	63	46	unmapped	0		0	AAGAGGGAGAGTTTTTGAACTATAGTCAACACACACTCAAGAAAGGTGGTCATCAACGCA	5040	0	UF_Msa_AF_108909	LMB_S454.1004.C1___1_nr0nt	LMB_S454.1004.C1___1_nr0nt	Unknown	
5131	63	47	unmapped	0		0	AGGAGGAAGATATCCACGTAGCCTGTCTTGCGTCGTAATAGTCCAGCCCTGTAATGTCCT	5042	0	UF_Msa_CF_122366	contig25559___0	contig25559___0	Unknown	
5132	63	48	unmapped	0		0	CCTACAGATATAATCAAATTGGAGGAGAAGTGAAATCTGATCTCAAGAGGTCAATCAGGA	5044	0	UF_Msa_CF_118051	contig08272___0rc	contig08272___0rc	Unknown	
5133	63	49	unmapped	0		0	TTTATTATCTGCTGGACTCCATATTACCTGCTGGGACTGTGGTACTGGTTCTTCCCTGAT	5046	0	UF_Msa_AD_200349	LMB_Add_13	LMB_Add_13	Unknown	
5134	63	50	unmapped	0		0	AATCAGTAATACTACCTCTTCTCCTGCTGCTCAAAGGTCTGTCTCTTGTGACAGTGTGAC	5048	0	UF_Msa_AF_104393	contig29838___1rc_nrnt-1	contig29838___1rc_nrnt-1	Unknown	
5135	63	51	unmapped	0		0	TGTTCAGAGACAAGGTGGTGCTCGATGTGGGCTGTGGGACAGGCATACTGTCCATGTTCG	5050	0	UF_Msa_AF_106060	contig11703___1_nrnt	contig11703___1_nrnt	Unknown	
5136	63	52	unmapped	0		0	TTTTGGGCTTGAACGGAAAGGACCCGTCCTCCATGTGCTGTGAAGCCATGCTGGTGAAAA	5052	0	UF_Msa_AF_109144	contig21682___1_nrnt0	contig21682___1_nrnt0	Unknown	
5137	63	53	unmapped	0		0	AAAGCGTCATCAAGGGAATATAGTCCGTCTTTGTCCTCATGCCTTTGACATTTTGGGGAC	5054	0	UF_Msa_AF_106805	contig22057___1_nrnt	contig22057___1_nrnt	Unknown	
5138	63	54	unmapped	0		0	TGGAGGTTAAAACTCTTCATCATCATCTTAGTCAATGCTGCTGTGTCTGTTGTGGTGGAG	5056	0	UF_Msa_CF_120174	contig09989___0	contig09989___0	Unknown	
5139	63	55	unmapped	0		0	AGTTTGTTATATGTACGAGGACAGGCATGACACGGCTGAAGATACTTTGTATCATCGGGG	5058	0	UF_Msa_AF_100579	contig27715___1rc_nr0nt	contig27715___1rc_nr0nt	Unknown	
5140	63	56		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
5141	63	57	unmapped	0		0	AAGGAGCAGGGATTCCTTTCCTTCTGGAGAGGTAACCTTGCCAATGTCATCAGATATTTC	5061	0	UF_Msa_AF_110251	contig32407___1rc_nrnt	contig32407___1rc_nrnt	Unknown	
5142	63	58	unmapped	0		0	AATTAGATGTTTATCTCAACAGTGGCACCAGACACTCAGTCCGAACCAGACCAGAAGTGT	5063	0	UF_Msa_CF_120889	contig26600___0rc	contig26600___0rc	Unknown	
5143	63	59	unmapped	0		0	CTGGCAGGAGGACAGAATTGGCTTCCATCAGCCTCATGTACACAAGATGTTAGAGGACAA	5065	0	UF_Msa_CF_117819	contig00923___0	contig00923___0	Unknown	
5144	63	60	unmapped	0		0	CAAAGAGGAGGATGAGGATGAAGATATGGCCTGGCTCTGTTGCACTCTGCTCCCTCACAG	5067	0	UF_Msa_CF_120374	contig13607___0rc	contig13607___0rc	Unknown	
5145	63	61	unmapped	0		0	TATTATCAGCCTCTTTGTCCCAAGTCCTCAGTCATGTTTGGGTTTATCCAATACCTGCCC	5069	0	UF_Msa_CF_121679	LMB_S454.sd.603.C1___0	LMB_S454.sd.603.C1___0	Unknown	
5146	63	62	unmapped	0		0	CTGTCCAACTAAGCAGAGGATCCTAAAGAAGCTAGAAAAAACGGGGTGAGGAATGTTCTC	5071	0	UF_Msa_CF_120996	contig10564___0rc	contig10564___0rc	Unknown	
5147	63	63	unmapped	0		0	TGGCCCGTAGCGGCTAGTGGAGATGGCAAACGAGCATGAAGACAAACACAAGCCCTGGAA	5073	0	UF_Msa_CF_119872	contig23853___0	contig23853___0	Unknown	
5148	63	64	unmapped	0		0	AGAAGACCTACCCTCCTGGGGCTACACCGGCCGAGATCACACAGTGTAGCCTGGACCTGA	5075	0	UF_Msa_AF_108008	contig05136___1rc_nrnt0	contig05136___1rc_nrnt0	Unknown	
5149	63	65		1028	E1A	0		390	1	(+)E1A_r60_3	E1A_r60_3	E1A_r60_3		CONTROL
5150	63	66	unmapped	0		0	GCATGGTGGTTAGGAAGATCCCTTTATTTAAAATCTAAAGAGGAAAGATTGCAGGAATAA	5078	0	UF_Msa_CF_121592	contig15357___0	contig15357___0	Unknown	
5151	63	67	unmapped	0		0	ACGTGTTCAGTGATTTTCTGCTGAAGGAGCAGAACCAGGCCCGATACAAGAACATCCGAA	5080	0	UF_Msa_CF_123966	contig03650___0	contig03650___0	Unknown	
5152	63	68	unmapped	0		0	TGAGAAATGTGCTGTACATATGTTTGGACATATGTAATAAACTTTGTTACACAATGAAAA	5082	0	UF_Msa_AF_103328	contig18564___1_nr0nt1	contig18564___1_nr0nt1	Unknown	
5153	63	69	unmapped	0		0	AGAGATGGGCATGCAGGAGGACATACTGACAGGCCATGTATATCCAGAGGAGTATCTCCG	5084	0	UF_Msa_AF_103574	contig07913___1_nrnt	contig07913___1_nrnt	Unknown	
5154	63	70	unmapped	0		0	TACCTGACCCAGATTTGCCCTGAATGGCTGAAGAAGTATGTGGACTATGGGAGGAGCTCT	5086	0	UF_Msa_AF_110208	contig20878___1_nrnt	contig20878___1_nrnt	Unknown	
5155	63	71		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
5156	63	72	unmapped	0		0	AATCTTTTTCCTGGTCAGTTTGCTCTTACGGCGCAATAACCAAGTCCCTTGGATAAGGCT	5089	0	UF_Msa_CF_120750	contig12846___0	contig12846___0	Unknown	
5157	63	73	unmapped	0		0	AGCAACACGTGCTGACCACAATAACTCCAAAACAGCAGAACACACAGGCGCGCAGCCACG	5091	0	UF_Msa_CF_126002	contig22559___0	contig22559___0	Unknown	
5158	63	74	unmapped	0		0	TACAGTTTCTATAAGATGGTAATAAGAACCCTTCTCGAGAGGATGGGACTCCTGAGCCCT	5093	0	UF_Msa_CF_120160	contig10592___0rc	contig10592___0rc	Unknown	
5159	63	75	unmapped	0		0	TTTGTCACTGCCAAGGAAGAACAGAGGAAGTTTGAGAGGCTGCGGTGCGAGGCGGGATCT	5095	0	UF_Msa_CF_118885	contig18624___0rc	contig18624___0rc	Unknown	
5160	63	76	unmapped	0		0	GTTCAGCACGCACAAGACCGTGTTTGATTTGACAATATTTGTTACAATAATTTTGCTTTG	5097	0	UF_Msa_AF_107508	contig31530___1_nr0nt1	contig31530___1_nr0nt1	Unknown	
5161	63	77	unmapped	0		0	CAGACATACCTGCTCTTCTACGAGGAAATGTTGTAATGTGACTACTAAACATTTTCCCCC	5099	0	UF_Msa_CF_123316	contig19227___0	contig19227___0	Unknown	
5162	63	78	unmapped	0		0	TGATCATATCCTCGAAAAAGGATCAGAGGTTCACAGTTGTGGATCATGCTGAATTCCCCG	5101	0	UF_Msa_AF_104290	contig28002___1_nrnt0	contig28002___1_nrnt0	Unknown	
5163	63	79	unmapped	0		0	TCTTCTCCAAGAACTCAAAGTACATCCTGTCCAGTGGCAAAGACTCCGTGGTTAAACTGT	5103	0	UF_Msa_AF_109628	contig17334___1_nrnt	contig17334___1_nrnt	Unknown	
5164	63	80	unmapped	0		0	GGGCACTGGAGAATGAGTCCACAGATCTCCTCAAAAGGGTGCGACGTGATCTGCCTGATT	5105	0	UF_Msa_CF_120740	contig16255___0rc	contig16255___0rc	Unknown	
5165	63	81	unmapped	0		0	AAACCAGGAAGACGGCCAGCGGCATCATTTCCACCATGAAGAACCGCAGGGATTGGTCCT	5107	0	UF_Msa_AF_107777	contig28433___1_nrnt	contig28433___1_nrnt	Unknown	
5166	63	82	unmapped	0		0	CAGCCTTTAATTTGAGCACCATAGACATTTACATGAGGTTTTGTCCCAGTGATTAAGGCC	5109	0	UF_Msa_CF_120833	LMB_S454.sd.381.C1___0rc	LMB_S454.sd.381.C1___0rc	Unknown	
5167	64	1	unmapped	0		0	AATATTTTGGCATCTCAGGTCGATGGTGTTGTTGCGGCTGTTATCTTCGTGTCCAACTAG	4952	0	UF_Msa_CF_126421	contig20998___0	contig20998___0	Unknown	
5168	64	2	unmapped	0		0	ACCCTTGGAGGGAGCCAACAACATCCAGGTGAGGAGGGCAGTAAAGGACACGTTCTCCAA	4954	0	UF_Msa_AF_101607	contig16260___1rc_nr0nt	contig16260___1rc_nr0nt	Unknown	
5169	64	3	unmapped	0		0	CTGACAAGACGCCGAAGGACTCCAGTGCTCCTGTTGCAACGAGGATAGACCCGAGTAAAG	4956	0	UF_Msa_CF_126735	contig25523___0	contig25523___0	Unknown	
5170	64	4	unmapped	0		0	TGCAGGCGGAGGTCTGAGCACATTTTGTACTTTTTTATAAATTGCGTTTGTGTGTTTTTT	4958	0	UF_Msa_CF_120267	contig02176___0rc	contig02176___0rc	Unknown	
5171	64	5	unmapped	0		0	GGGAGTTGCGGGACTGAGGTTAGAACCTGAACCTTTCCCCATTCCTGCTTTACCAGTTGT	4960	0	UF_Msa_AF_109433	contig29558___1rc_nrnt-1	contig29558___1rc_nrnt-1	Unknown	
5172	64	6	unmapped	0		0	ACACCAAGAACATCGCACCATGAATGAGACAGCTATTTCCTTTGCCAAGGATTTCTTGGC	4962	0	UF_Msa_AF_102865	contig28075___1_nrnt	contig28075___1_nrnt	Unknown	
5173	64	7	unmapped	0		0	CAGTGTCAGTCAGTTCACCAGCTTGGTCCAGACAGAAATGTTTCAACAACTATTTGATGG	4964	0	UF_Msa_CF_123167	contig22551___0rc	contig22551___0rc	Unknown	
5174	64	8	unmapped	0		0	ATCATTCCTCATGGTGCTAAATCTGCCAGGAGTGGGTCAGAATGAAGGAGAAAAGGATCT	4966	0	UF_Msa_CF_124701	contig29124___0rc	contig29124___0rc	Unknown	
5175	64	9	unmapped	0		0	TCATTGGGGCATGGTGAAGCAAAGAGGCAACGCTGGGACAAATGAAGACGAATCAGAACG	4968	0	UF_Msa_CF_122853	contig17562___0	contig17562___0	Unknown	
5176	64	10	unmapped	0		0	ATTGCCAAGAAACCGAAGAAGAATCCCTGGTCAGACAATGAATCTGATGACGTGTCAGAC	4970	0	UF_Msa_CF_121172	contig05208___0rc	contig05208___0rc	Unknown	
5177	64	11	unmapped	0		0	TGAGGAGTTCCTGGGTGCTGAACTGGTCAGCCTTCGTCTCCTGGCTTTGACCAGAGAAGA	4972	0	UF_Msa_CF_119938	contig06290___0rc	contig06290___0rc	Unknown	
5178	64	12	unmapped	0		0	TCAAGTCGGTTCTGGCCTGTGTGGGAGGGTTTGTCCTCGGAGGAGCTTTTGGTGTCTTCA	4974	0	UF_Msa_AF_105733	contig20543___1_nr0nt1	contig20543___1_nr0nt1	Unknown	
5179	64	13	unmapped	0		0	AACGGCTAACAATAACCTGTCCAAAGTCTGTCCAAAGGCAACAAAAACCCAGCATCAGAT	4976	0	UF_Msa_CF_120057	contig17303___0	contig17303___0	Unknown	
5180	64	14	unmapped	0		0	TGTTGCTAGGATGTCTACAAAGAACACTTTCTTCAGAGGTGACAAAGATGATTTTATACA	4978	0	UF_Msa_CF_118569	contig17850___0	contig17850___0	Unknown	
5181	64	15	unmapped	0		0	TCTGGTGGACGATGGACCGAAAGATGAGATCACCACCCAGGTCTGGACCTTCACTCGCAA	4980	0	UF_Msa_AF_100664	contig17428___1_nrnt	contig17428___1_nrnt	Unknown	
5182	64	16	unmapped	0		0	TCTCGTCGCTGTTGTCTCCTGCGGTGTGCGGTGAAAGCCAGCCAAAGAGCAGTAAAATGG	4982	0	UF_Msa_AF_109424	contig21606___1_nr0nt	contig21606___1_nr0nt	Unknown	
5183	64	17	unmapped	0		0	TCTTTATGTGATCAAGAAACAGATGGAGGTGTTGCAGGAGTCCAGGATGATGATCCCAGA	4984	0	UF_Msa_AF_100597	contig17289___1rc_nrnt	contig17289___1rc_nrnt	Unknown	
5184	64	18	unmapped	0		0	ATGACCCAGACTTAATGAGGGTGGTGCTGGCTGTGATTGCTGGCCTGCTAGGTACTGTTA	4986	0	UF_Msa_CF_118761	contig17540___0	contig17540___0	Unknown	
5185	64	19	unmapped	0		0	ACGACCAAAACCACAGCCAGAAAAGACGAAGGCACCTCCCAAGAACAAAAAGGTGAAAAA	4988	0	UF_Msa_CF_123874	contig23645___0rc	contig23645___0rc	Unknown	
5186	64	20	unmapped	0		0	GCTAAAACCTCTGTGTGGAAACTTTATAGCTTTGCTTTACTAAAAACTGCTGCATTTATG	4990	0	UF_Msa_CF_124920	contig21905___0rc	contig21905___0rc	Unknown	
5187	64	21	unmapped	0		0	ACATCAATCAGGAGCTCGCCTCGCTGGGCCTCTCCACATGTATCGAGGCCAGCTCACCAG	4992	0	UF_Msa_CF_125664	contig13084___0	contig13084___0	Unknown	
5188	64	22	unmapped	0		0	TGAGTGTGTCGTTGACAGAAAAACTCCAGTTTGTAGGCTATGCGACACTGGTACCATACA	4994	0	UF_Msa_CF_125895	contig08483___0	contig08483___0	Unknown	
5189	64	23	unmapped	0		0	AGTACATCGCCAACCTGCTGAAGACGGCTTTCCCCCATCTGCAAGATGCCCAGGTGAAGG	4996	0	UF_Msa_AF_107555	contig20713___1_nrnt0	contig20713___1_nrnt0	Unknown	
5190	64	24	unmapped	0		0	AGTACAGCTCGGCTCGGTCAAGAGGATTAATAGCCTGCTCAAAACTGAACCAGAGAATTA	4998	0	UF_Msa_AF_103295	contig02327___1_nrnt0	contig02327___1_nrnt0	Unknown	
5191	64	25	unmapped	0		0	TTTATCAGATGAGACATTAACATTGCTGGTAGAAGAGGAGGAAGAGGATAGCAATGAGGA	5000	0	UF_Msa_CF_124656	contig24867___0	contig24867___0	Unknown	
5192	64	26	unmapped	0		0	GGGAGAAAAACGTGGCCACAGGGTGCAACCACTTCCAGCCTTTTAGTACATTTCCCGCTG	5002	0	UF_Msa_CF_123273	contig13862___0rc	contig13862___0rc	Unknown	
5193	64	27	unmapped	0		0	CTGTCACATTTCACAAGGACATTGAAGTTTTGATGATCACAGCCACCAGAGACAGAGGGA	5004	0	UF_Msa_CF_126740	contig20947___0rc	contig20947___0rc	Unknown	
5194	64	28	unmapped	0		0	ACCAAAGACATGGGCAAGTTCAGCTCTGTCACAGTCTCCACCATCGACGAGGAGGAGGAG	5006	0	UF_Msa_AF_101933	contig09597___1_nrnt	contig09597___1_nrnt	Unknown	
5195	64	29	unmapped	0		0	TGAAGAAAAACACATTTAGAATCCATCTTTAGTATCTAACCTGAAACTGCAGCAGTCTAC	5008	0	UF_Msa_CF_126842	contig29553___0rc	contig29553___0rc	Unknown	
5196	64	30	unmapped	0		0	ATTTCGGTATCGGGGAAAAACTGACAAGTGAAAATCCTAGATCCCCTGCCACTACTGAGT	5010	0	UF_Msa_CF_118584	contig20955___0rc	contig20955___0rc	Unknown	
5197	64	31	unmapped	0		0	GAAAGACAAATGAGCAGAATAATCATTTTTCCCCTTCTTGTCACCAAATCCTGTATTGTT	5012	0	UF_Msa_AF_103863	contig32107___1_nr0nt1	contig32107___1_nr0nt1	Unknown	
5198	64	32	unmapped	0		0	TTCAGAAGTTTTATGTAAGACCTCACTTCGGTTGAAATCTGTCCAAAATAAATGGTTGGA	5014	0	UF_Msa_AF_105201	contig29667___1rc_nrnt-1	contig29667___1rc_nrnt-1	Unknown	
5199	64	33	unmapped	0		0	ATAAAGTCCAGGGAGCCTGACAGAAGTCTGATTATGTTAACTTGTGGAGCTGGGGAAGAT	5016	0	UF_Msa_AF_108285	LMB_S454.876.C1___1rc_nr1nt0	LMB_S454.876.C1___1rc_nr1nt0	Unknown	
5200	64	34	unmapped	0		0	ATTCCCTTCATGGCCACAGAGGTTAAGTTTCAGTTACCGTAACAATATTGTTTTTACAAA	5018	0	UF_Msa_CF_122641	contig07594___0	contig07594___0	Unknown	
5201	64	35	unmapped	0		0	AGTGAAGACGGACTCTTAAGTACATCCACCACCACATATTCCACTACTACATGACCAGAT	5020	0	UF_Msa_CF_119781	contig29631___0rc	contig29631___0rc	Unknown	
5202	64	36	unmapped	0		0	GAGGAAGATGCTGAAAGAGGTGGTGAAGTCTGCCAAGAGCAGCGTGAAGGCTCGAGTTCT	5022	0	UF_Msa_CF_126899	contig26367___0rc	contig26367___0rc	Unknown	
5203	64	37	unmapped	0		0	ATGAGCAGGATGTTCCTTCACCTGCTCTGTTTGTCCCAGAGCCACAGGAGGAGCTGGAAA	5023	0	UF_Msa_CF_124140	contig23000___0rc	contig23000___0rc	Unknown	
5204	64	38	unmapped	0		0	CCATGGAATGAAGAGCATCAAATATCTGTGACTATGAAGCTGTTAGAACTGTAAAAATGT	5025	0	UF_Msa_AF_103070	contig31186___1_nrnt	contig31186___1_nrnt	Unknown	
5205	64	39	unmapped	0		0	ACTTAGGCTACCAGCGCAGGAATAAGGATGTGATTGCATGGGTTAAGAAACGCAGAAGAA	5027	0	UF_Msa_AF_102796	contig32153___1rc_nrnt	contig32153___1rc_nrnt	Unknown	
5206	64	40	unmapped	0		0	TAGGTTTTATTGTCTATTGTGGCTGTAGTCCATGGTAACTGCCAGACATGTGTGTGTGTG	5029	0	UF_Msa_AF_101431	contig14481___1_nr0nt	contig14481___1_nr0nt	Unknown	
5207	64	41	unmapped	0		0	CCCTTCGTACTTGGAATGACGTATGGTTTGCTGTTTGTAGTGGATTATCCGTGGTCATTC	5031	0	UF_Msa_CF_121974	LMB_S454.sd.29.C1___0rc	LMB_S454.sd.29.C1___0rc	Unknown	
5208	64	42	unmapped	0		0	TGTCTGTTGCTTGACCTTGTTCTTATGAACTGCCGTCTTTGAAATTTTAAGGATGGAAGC	5033	0	UF_Msa_AF_106064	contig19403___1_nr0nt1	contig19403___1_nr0nt1	Unknown	
5209	64	43	unmapped	0		0	CAAAAAACTGTTACGAAATAGCAGCACACAAACTGTCTCTGACAAGAGCACCCAAACTGT	5035	0	UF_Msa_AF_107539	contig03518___1_nrnt0	contig03518___1_nrnt0	Unknown	
5210	64	44	unmapped	0		0	CTGTAGCTATGTGAGCTGAAGGCACATTATGTACATGTATTTTTATTTAGGCTAAAGCTT	5037	0	UF_Msa_CF_119308	contig25738___0	contig25738___0	Unknown	
5211	64	45	unmapped	0		0	TGGGACTACGGCTGGTCCTTCTGCATTTCCACGCAGGCACTCGCGTGAACCAGCTCTACA	5039	0	UF_Msa_AF_100956	contig18751___1_nrnt	contig18751___1_nrnt	Unknown	
5212	64	46	unmapped	0		0	CTCTGATGACGATAAGCCAAAGTCAAGGAAAGAGCAGATAGCAGAGCAGAGAGAGTATAA	5041	0	UF_Msa_AF_109366	contig11281___1rc_nrnt	contig11281___1rc_nrnt	Unknown	
5213	64	47	unmapped	0		0	AGCTAGATGAGTGGAAGGCCAAGAAAACTAGTGCCTTTGCAGAAGTAGTTGCGTTAGTAG	5043	0	UF_Msa_CF_118240	contig07479___0rc	contig07479___0rc	Unknown	
5214	64	48	unmapped	0		0	ATAAGAAAGATGGTTGTGACTTTGCCAAGTGGAGGTGTGTGCTCAAGATCTCAGATGGCT	5045	0	UF_Msa_AD_200178	LMB_Add_29_rc	LMB_Add_29_rc	Unknown	
5215	64	49	unmapped	0		0	GAAAGCTGAGCGCCTGCAAAGCTGCAGTGGAGCATTTATTTTGGCTTCCTGAGAAACAAA	5047	0	UF_Msa_CF_124233	contig14411___0	contig14411___0	Unknown	
5216	64	50	unmapped	0		0	AGAGGAATGTGCCAGTCAGGAGGAGCAACGCAAGGAGTCCCTTGTTCACCCCATCTGCAA	5049	0	UF_Msa_CF_125856	contig18027___0	contig18027___0	Unknown	
5217	64	51	unmapped	0		0	CGTCAGAGAGCAGAAGGGATAATATATTGGTTGCATTTTATTCAAGATAAGTCAACGTAA	5051	0	UF_Msa_AF_100162	contig19725___1_nr0nt1	contig19725___1_nr0nt1	Unknown	
5218	64	52	unmapped	0		0	AAATGCTAGAAGAACTACGTGGGAGAACCTCTCTTTTCATATTTTGCAGAATAATCATCA	5053	0	UF_Msa_AF_108833	contig30289___1rc_nrnt0	contig30289___1rc_nrnt0	Unknown	
5219	64	53	unmapped	0		0	TCTACAGAGAGTCTCAGACAGGTTCCGGTGTACAGAGAGTCTCAGACAGGTTCGGGTCTA	5055	0	UF_Msa_AF_105185	contig09953___1_nr0nt1	contig09953___1_nr0nt1	Unknown	
5220	64	54	unmapped	0		0	AAGTCCTTCTCTCGGTCAATGAGTCTGTTTAGAAGCTGTGGTGCCTTCTTTTGGTATGTG	5057	0	UF_Msa_AF_107656	contig16966___1_nr0nt1	contig16966___1_nr0nt1	Unknown	
5221	64	55	unmapped	0		0	AATGTGTCGGTCAAGGACGTTCGCCGTGGGAATGTGGCTGGTGATAGCAAGAACGACCCA	5059	0	UF_Msa_AF_104419	contig26552___1rc_nrnt	contig26552___1rc_nrnt	Unknown	
5222	64	56	unmapped	0		0	CCCAGTCCGTGGCTGTGAATGGAGATCCCAGCTGCAGGCGATCGGCTCTTCTTAAAGATG	5060	0	UF_Msa_AF_108676	contig08877___1_nrnt0	contig08877___1_nrnt0	Unknown	
5223	64	57	unmapped	0		0	TCCTATGCTCCACCAACTGAGTAGTGACCAGACTACACTAATACACATAGTGAAATCACC	5062	0	UF_Msa_CF_127709	contig14558___0	contig14558___0	Unknown	
5224	64	58	unmapped	0		0	GCCACAGAGTCTCAACACTGACACAGTCTCATTGAAAAGGCTGGAGAAGTATAAATGTGG	5064	0	UF_Msa_CF_121455	contig03568___0	contig03568___0	Unknown	
5225	64	59	unmapped	0		0	AGATCTACTCCTCACTCACTTAACCTTACATAACTCCCAGAAAACCACAAATAGTTGAAT	5066	0	UF_Msa_CF_124180	contig28274___0	contig28274___0	Unknown	
5226	64	60	unmapped	0		0	GTAAAACTGTGTTGACCTCGAAGATCGGAGGTCTCATGGCATTTGCTCAGAAGAGGAGCA	5068	0	UF_Msa_AF_104649	contig18394___1_nrnt0	contig18394___1_nrnt0	Unknown	
5227	64	61	unmapped	0		0	TTAATTGAGAAGAAAAACAAGAACATAATCCAGTGGAGGGGAGAGAACTCGGGCAGCCAA	5070	0	UF_Msa_AF_101524	contig18058___1_nrnt	contig18058___1_nrnt	Unknown	
5228	64	62	unmapped	0		0	ATTTGGGAAGCTTCCAACCTAACCAGCAGCTAGATGCTAAAACTTTAAACCCTGCCGAGT	5072	0	UF_Msa_CF_121976	contig24562___0	contig24562___0	Unknown	
5229	64	63	unmapped	0		0	AGCCGGATACATATGGTGCTGGAGGATGTGCCGCTTACAGCTGTGTGAAGGAAAATGGTG	5074	0	UF_Msa_CF_126036	contig02125___0	contig02125___0	Unknown	
5230	64	64	unmapped	0		0	ATACCAAATGGGAGTCTACTTGGACAAAGCGACTGCCAGACTTCAGATTATAATGGCTGC	5076	0	UF_Msa_AF_102736	contig12163___1rc_nrnt	contig12163___1rc_nrnt	Unknown	
5231	64	65	unmapped	0		0	AGATTGAGACCGGATACGTGGGTTAACACCTTCCTGATGCTGTCAGTAACCATACTAAGA	5077	0	UF_Msa_CF_123907	contig20805___0	contig20805___0	Unknown	
5232	64	66	unmapped	0		0	GAGTTATACTATTTTTACAAACAAATAAGAAAGAAAACACAAATTCCACATATACTAATC	5079	0	UF_Msa_AF_103583	contig29427___1_nr0nt1	contig29427___1_nr0nt1	Unknown	
5233	64	67	unmapped	0		0	TGTAGAACTCGGACCTACCCTCGGCTTGAAGAAGTCCAGTTCGTTGGAGAGCCTCCAGAC	5081	0	UF_Msa_AF_104799	contig05042___1rc_nr0nt	contig05042___1rc_nr0nt	Unknown	
5234	64	68	unmapped	0		0	CACATCACTTTGCCGTACTGATGTCTCTGTCTACTCGTTCTTCTTCTCCTTCTGTTTGAG	5083	0	UF_Msa_AF_107450	contig23455___1_nr0nt	contig23455___1_nr0nt	Unknown	
5235	64	69	unmapped	0		0	GCGAGACCACCACTGTCGTCACCGGCACCTCAGAACACAGCATCTCTAACGAGGACCTGA	5085	0	UF_Msa_AF_100361	contig04060___1rc_nr0nt	contig04060___1rc_nr0nt	Unknown	
5236	64	70	unmapped	0		0	TCACCAAAACCTCCCAGAAGTTTGGCCAGTGGGCCGACAGCCGGGCCAACACCGTCTATG	5087	0	UF_Msa_AF_102673	contig18210___1_nrnt	contig18210___1_nrnt	Unknown	
5237	64	71	unmapped	0		0	TACAAGATCCTGATGAACCTTCTCTAACAGACTCCAACAGCAAACCCAAAGTGGAGTGCA	5088	0	UF_Msa_AF_106709	contig15700___1_nrnt	contig15700___1_nrnt	Unknown	
5238	64	72	unmapped	0		0	GAGAGTGTGCAGGATGGAGCAGTGGTGGGTCTGAACAACAGTGTCATCAGGCTCCTGGTT	5090	0	UF_Msa_AF_107965	contig04849___1_nrnt	contig04849___1_nrnt	Unknown	
5239	64	73	unmapped	0		0	GTGGACGCTCTGATCCTGAGCGCTCTGAGAAAAATGCTCGACTTTGGAGACGACTTCATT	5092	0	UF_Msa_AF_110255	contig14175___1_nrnt0	contig14175___1_nrnt0	Unknown	
5240	64	74	unmapped	0		0	TCCCACCTTCCACTGGGCCCTGACGGAGCTGGCTGTCTGTGTCATCGTGGAGGAAATATT	5094	0	UF_Msa_AF_103740	contig01895___1rc_nrnt-1	contig01895___1rc_nrnt-1	Unknown	
5241	64	75	unmapped	0		0	GATTGACGTATGCCGATGACACCAAGCCTGAAGACTGGGACAAACCTGAGAACATTCCAG	5096	0	UF_Msa_AF_106030	contig04261___1_nr0nt	contig04261___1_nr0nt	Unknown	
5242	64	76	unmapped	0		0	CTAAGCAGTATGCAGCAGTGTGTGGCTACAGTATCAGTGTTCTCCCGCTACAGGGCCACG	5098	0	UF_Msa_CF_126576	contig02639___0rc	contig02639___0rc	Unknown	
5243	64	77	unmapped	0		0	ACAAACGTGTTTGTAAGGTTCCAAGCTGAGACCATCGCCTGTGCTGCATATTCCTCGCTG	5100	0	UF_Msa_AF_101492	contig26454___1rc_nr0nt	contig26454___1rc_nr0nt	Unknown	
5244	64	78	unmapped	0		0	CAATTTCTCTACAAGGGCGAGGGGCTTAATAAAACGGCTATTGGCGACTACCTTGGGGAG	5102	0	UF_Msa_AF_106635	contig05103___1_nrnt0	contig05103___1_nrnt0	Unknown	
5245	64	79	unmapped	0		0	AGGCTGATGCTCCTAACACGGGGCTGATTCCAGAGAGTGATGCTGTAGGAGTGACTGTAG	5104	0	UF_Msa_AF_102249	contig21437___1rc_nrnt	contig21437___1rc_nrnt	Unknown	
5246	64	80	unmapped	0		0	ATGATGCTGATGGAGGAAGCAGGGAGAATTGCCAGAGATGAACATGGCTCTAGCAAATTA	5106	0	UF_Msa_AF_110194	contig04020___1_nrnt	contig04020___1_nrnt	Unknown	
5247	64	81	unmapped	0		0	ATCAACGCAGAGTGTAGGATCCGTGACGGGCTGAAGGGGATCCATCTCACTGTGGACAAG	5108	0	UF_Msa_AF_100589	contig31570___1_nrnt0	contig31570___1_nrnt0	Unknown	
5248	64	82	unmapped	0		0	AACTTCTACCACCGTTGGTTTGATGTCATCTTCCTGGTCAGCGCCCTGTCCAGCATCCTC	5110	0	UF_Msa_AF_101581	contig13843___1rc_nrnt	contig13843___1rc_nrnt	Unknown	
5249	65	1	unmapped	0		0	AAGAAGAAATACTGGGTAATGTTGCTGAACCTGGTCTACCAGCTTCCTGGCCATTTTCCA	5111	0	UF_Msa_CF_118709	contig27007___0	contig27007___0	Unknown	
5250	65	2	unmapped	0		0	GATACTGATCCAACAACAGTCACTTTTTTAAAAACAGGTTGAGAGGAGTGTTGGTAGGAC	5113	0	UF_Msa_CF_122482	contig15666___0rc	contig15666___0rc	Unknown	
5251	65	3		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
5252	65	4	unmapped	0		0	AAAGGAGAGAAGAAGTCCAGGAAGTTTTTCAACGTGGGGGAGAAGGATGAGAAAAAGACT	5116	0	UF_Msa_CF_119155	contig09477___0	contig09477___0	Unknown	
5253	65	5	unmapped	0		0	AGTTTTCCCTTAAGCTGTTTAAATGTAGAAGGGAGGAGTGGTGTGGACAACCGTAACAAT	5118	0	UF_Msa_CF_117773	contig08230___0	contig08230___0	Unknown	
5254	65	6	unmapped	0		0	CATTGCGTGAACACACCCTCCCTGGTGATGGGGCTTTCAGGCCACATTTCAAGACAAAGA	5120	0	UF_Msa_AF_103591	contig08107___1_nr0nt	contig08107___1_nr0nt	Unknown	
5255	65	7	unmapped	0		0	GCCCAGAGGATGAAAACTAAATGTTTCCAACAGAAACTTAGCCAATACTTACAGCTCACC	5122	0	UF_Msa_CF_123495	contig08834___0rc	contig08834___0rc	Unknown	
5256	65	8	unmapped	0		0	ATGGAGAAAATTCTATACGCGATAATGAATACAGCGCTCCTGAGCCTGAAGCAGTTCCAG	5124	0	UF_Msa_AF_107705	contig12051___1_nr0nt	contig12051___1_nr0nt	Unknown	
5257	65	9	unmapped	0		0	ACGATGTGGCCCCGCCCGGGGGACCCTACCTGGGTGAACAGGATAGAGTTCAGGTGTGAA	5126	0	UF_Msa_AF_108814	contig00265___1_nrnt	contig00265___1_nrnt	Unknown	
5258	65	10	unmapped	0		0	AGGGTCACCATTCGCAAGTCAAAGAACATCCTGTTTGTCATTACTAAACCAGACGTCTAC	5128	0	UF_Msa_AD_200125	LMB_Add_40	LMB_Add_40	Unknown	
5259	65	11	unmapped	0		0	TGCTGGATGACTCCAACTACCCGGGCAGCATGCAGGACTTCAAAGGTGCACAGGTGGACT	5130	0	UF_Msa_CF_121964	contig00790___0	contig00790___0	Unknown	
5260	65	12	unmapped	0		0	TTCAGCCGAAGCTGATGAGTGGTTTCAAGGAAAAGATGCCCAGCCTATTCTGATCTCTCT	5131	0	UF_Msa_AF_100201	contig16807___1rc_nrnt0	contig16807___1rc_nrnt0	Unknown	
5261	65	13	unmapped	0		0	TACACAGAATTATTAAACAATGGCCAACACTGCCCGGAGAGCAGACACAAGAAACCGACA	5133	0	UF_Msa_CF_120194	contig23941___0	contig23941___0	Unknown	
5262	65	14	unmapped	0		0	TTGGCGCAGACAGAGGAGGATGTAGACAAGGGGGAGGATGGTTCAGACGAAGGAGATGAC	5134	0	UF_Msa_CF_123265	contig13297___0	contig13297___0	Unknown	
5263	65	15	unmapped	0		0	AGCTGCAGGATGACTCTGGCTGCTGTGTACGTCAGGTGCTGTGGGAAATATCAAAACCCC	5136	0	UF_Msa_CF_117812	contig19619___0rc	contig19619___0rc	Unknown	
5264	65	16	unmapped	0		0	TAAAGCTTTTGGACGATAACGGGAACATCGCTGAAGAACTCAGCATCCTCAAGTGGAACA	5138	0	UF_Msa_AF_108396	contig04474___1rc_nrnt	contig04474___1rc_nrnt	Unknown	
5265	65	17	unmapped	0		0	TGTTTCATTTGTGACCGAGTTGAGAACTTCCAGCAGAGAGGGTCACATAAGACACAGGAA	5140	0	UF_Msa_CF_123637	contig13387___0rc	contig13387___0rc	Unknown	
5266	65	18	unmapped	0		0	TGGATGCTCATGATTCAGTATATTTTCAAAGAGTCCCCGGATGAAGACGACATTTCTGTT	5142	0	UF_Msa_CF_121903	contig09591___0	contig09591___0	Unknown	
5267	65	19	unmapped	0		0	CCGACAGAGATATTCAGTGTATTATTCTGTAGTTGAAACCTGTTGTCAGAAGTTACATAT	5144	0	UF_Msa_AF_104405	contig30828___1_nr0nt	contig30828___1_nr0nt	Unknown	
5268	65	20	unmapped	0		0	AAATTAACGACAACCTAATGGAGCTGCTGATTATGATCAACGCCTGCAAGATCGCCTCCT	5146	0	UF_Msa_AF_102840	contig31578___1rc_nrnt	contig31578___1rc_nrnt	Unknown	
5269	65	21	unmapped	0		0	GCACCCCAAGTACTCCAGACTATAAGAGTGAAAGGCGGCGTGGATCTAAAGTAAAGCGGT	5148	0	UF_Msa_AF_107132	contig00171___1rc_nrnt0	contig00171___1rc_nrnt0	Unknown	
5270	65	22	unmapped	0		0	CTCTGGTAATGAGCTGTTGTAAAACATACCAAAAGAAGAAAGAGGTCAAGCTGTGAAAGA	5150	0	UF_Msa_AF_106454	contig21658___1_nr0nt1	contig21658___1_nr0nt1	Unknown	
5271	65	23	unmapped	0		0	AGGACATGTTGAGTAAGGACCTGGAGGAGACCCAGGGAGGCTGCTCTGCCAATTTGCTCT	5152	0	UF_Msa_AF_104993	contig18976___1rc_nrnt0	contig18976___1rc_nrnt0	Unknown	
5272	65	24	unmapped	0		0	ATGTCTTCAGGGAGTGCTTTTTGCGCCTGGATCTGACCCAGGCACTGGAGCTTCTGGCAT	5154	0	UF_Msa_AF_102351	contig31072___1rc_nrnt	contig31072___1rc_nrnt	Unknown	
5273	65	25	unmapped	0		0	GTTTACTGGAGATTTACACGAGGCGGTCACATTTGAGGACTGGGTTGAAGTCAAATTTAT	5156	0	UF_Msa_AF_103717	contig14702___1rc_nrnt0	contig14702___1rc_nrnt0	Unknown	
5274	65	26	unmapped	0		0	ACGGGAAGCAGCAGCCTGTTAGCTGTGCTGCTGTTAGCTTGTACAGCACAAGGGCAGAGG	5158	0	UF_Msa_CF_124387	contig29847___0rc	contig29847___0rc	Unknown	
5275	65	27	unmapped	0		0	GATGAAAACGTGTCTTCAGGGTAGAAATCAGAGAAAATTGAAGCGAAACTCCTCCTTTGA	5160	0	UF_Msa_CF_125711	contig17556___0rc	contig17556___0rc	Unknown	
5276	65	28		1028	E1A	0		1133	1	(+)E1A_r60_a104	E1A_r60_a104	E1A_r60_a104		CONTROL
5277	65	29	unmapped	0		0	GGCTTACTATCTACCATGATATATTGTGTTACCACTCATTTCCCCCTTTCTGTTGTTGTC	5163	0	UF_Msa_AD_200213	EF128004	EF128004	Unknown	
5278	65	30	unmapped	0		0	ACCGGGGAGAACCGCAAGCTGCAAGTGAATGAATACTGCTCTCCCGTGATAGTGAAGTGA	5165	0	UF_Msa_CF_126783	contig23701___0	contig23701___0	Unknown	
5279	65	31	unmapped	0		0	ATAATTTCACAACAATCAAGAACAGAGTGGCGCTTGTGAAGGCAGCTTGGATTACGCTGA	5167	0	UF_Msa_CF_122250	contig27998___0rc	contig27998___0rc	Unknown	
5280	65	32	unmapped	0		0	GGAGTTGCCTTTCTAAACCACTGTTGGTAAATGTATAAAACCACAATCTAGCAAGATAAA	5169	0	UF_Msa_AD_200221	DQ666527	DQ666527	Unknown	
5281	65	33	unmapped	0		0	GCCTGGGAGGCAGAGGAGGTGCTCAGACAACAGAAGATGGCTGAGAGAGAAAAGCGGTCC	5171	0	UF_Msa_AF_105734	contig30981___1_nr0nt	contig30981___1_nr0nt	Unknown	
5282	65	34	unmapped	0		0	GAAACACACCACAAATGTAACGCGTCTGTTGAGCTCTCAACCACATAACCCCAAGATACC	5173	0	UF_Msa_CF_127102	contig09329___0rc	contig09329___0rc	Unknown	
5283	65	35	unmapped	0		0	GAACGCGGACGATCCAAAGAAGAAGAAGCAGCGGCGGCAGCGGACTCACTTCACCAGCCA	5174	0	UF_Msa_AF_101101	contig05236___1rc_nr0nt1	contig05236___1rc_nr0nt1	Unknown	
5284	65	36	unmapped	0		0	TAACAACTCACTGAGAGAGAACCCAGTCCTCACCAAACTCAGACTGAGAACTCTTGAAGA	5176	0	UF_Msa_AF_108064	contig20871___1rc_nrnt	contig20871___1rc_nrnt	Unknown	
5285	65	37	unmapped	0		0	TATAGTAGACGATGTGGCTGTTCGCTCTAGTAGACTGGGGTTTTAGAAAGTAGCGGGTTT	5178	0	UF_Msa_CF_120453	LMB_Sanger.15.C3___0	LMB_Sanger.15.C3___0	Unknown	
5286	65	38	unmapped	0		0	GGGTACATGTTCATCTGAAGCCTGTGTGTTTTATTTAAATGTGTGGAATTAATGACTGAA	5180	0	UF_Msa_CF_118545	LMB_S454.816.C1___0rc	LMB_S454.816.C1___0rc	Unknown	
5287	65	39	unmapped	0		0	GATGAAGTGGACCAACATGCTTTATAAGGCAGAGGGCCTCAAAATCAAAGATGATGAGGC	5182	0	UF_Msa_AF_102664	contig29576___1_nrnt	contig29576___1_nrnt	Unknown	
5288	65	40	unmapped	0		0	GATGGCCCACCTGAGCTCCTGTTTATCCATGGAGGCCACACAGCCAAGATCTCTGATTTC	5184	0	UF_Msa_AF_103108	contig01885___1rc_nrnt	contig01885___1rc_nrnt	Unknown	
5289	65	41		1028	E1A	0		799	1	(+)E1A_r60_n9	E1A_r60_n9	E1A_r60_n9		CONTROL
5290	65	42	unmapped	0		0	ACGTTCAAGAGGATTTGGGTTTGTTACGTTTACAGATGCTGCCAGTGTAGATAAAGTCTT	5187	0	UF_Msa_AF_106194	contig18402___1rc_nrnt	contig18402___1rc_nrnt	Unknown	
5291	65	43	unmapped	0		0	TGTCAGAGGTCACTTGGACAAGATGGAGCCCAGCAAGATTACAAAGTTTGAGAAGGCTTT	5189	0	UF_Msa_AF_107989	LMB_S454.sd.593.C1___1_nrnt	LMB_S454.sd.593.C1___1_nrnt	Unknown	
5292	65	44	unmapped	0		0	TCGGCTCTCCTGATGTCAAACTATTTTCCACTCAGTTCCCATATCGCGCCACATGCATTC	5191	0	UF_Msa_CF_120406	contig00067___0rc	contig00067___0rc	Unknown	
5293	65	45	unmapped	0		0	CCTGGACAAGCGCACTGTGTATCAGCTGAAAAGCAACATGGAGTCTGCAACCGGATTCCT	5193	0	UF_Msa_AF_105308	contig21821___1_nr1nt0	contig21821___1_nr1nt0	Unknown	
5294	65	46	unmapped	0		0	AACTTGCAGCTGAAGCCTCATTCAGAACAAATCCAGCTCTTGTCACAAACCAGTTCTACA	5195	0	UF_Msa_CF_122401	contig26174___0rc	contig26174___0rc	Unknown	
5295	65	47	unmapped	0		0	GGCAGTATGGTTATGATGGAGAAGACTTCATAGCATTTGACCTGAAGACAGAGAAATGGA	5197	0	UF_Msa_AF_107675	contig10456___1rc_nrnt	contig10456___1rc_nrnt	Unknown	
5296	65	48	unmapped	0		0	TCAGCTGTGGTTCGCTGGGACCCTCCAGACCTGACTAACGGCATGGACCTGCAGGGTTAC	5199	0	UF_Msa_AF_100308	contig19869___1_nrnt0	contig19869___1_nrnt0	Unknown	
5297	65	49	unmapped	0		0	AACTGATGGCATTGGAGCACCCTGTGTTCATGTGGTGGATGATGGGTTGGGGCTGACCCA	5201	0	UF_Msa_AD_200161	LMB_Add_18_rc	LMB_Add_18_rc	Unknown	
5298	65	50	unmapped	0		0	AGTAAAGTAAGCAGTCAGTTCACTGATGAATACCTGCCTGACCAACGCTCTCACTTGTAC	5203	0	UF_Msa_AF_102491	contig29556___1_nr1nt0	contig29556___1_nr1nt0	Unknown	
5299	65	51	unmapped	0		0	CCTCGTGGATCTGCTTCAGGGGTGAACAAGACACATGCATTATCTCCAAAGATGTTTTTT	5205	0	UF_Msa_AF_105670	contig18604___1_nr1nt0	contig18604___1_nr1nt0	Unknown	
5300	65	52	unmapped	0		0	AATCAACCACCAGATACTGATTGGTTTCTGGACCCCCCAGAACCCCCCAATACAGTCCCT	5207	0	UF_Msa_CF_118473	contig22929___0rc	contig22929___0rc	Unknown	
5301	65	53	unmapped	0		0	ACATTCAATATTCTATGATTGTATGTGGACAAATTGACAGTTTTGAAAGTTAAATTTTTT	5209	0	UF_Msa_AF_103386	contig02395___1_nr0nt1	contig02395___1_nr0nt1	Unknown	
5302	65	54	unmapped	0		0	ATCTGCTACACACTATTGGTCGTGTACATGCAGGAGGAACAGCACCGTCCGCCTGGAAGC	5211	0	UF_Msa_AF_100434	contig23044___1_nrnt0	contig23044___1_nrnt0	Unknown	
5303	65	55	unmapped	0		0	AACTGCAGAGAAAACACGTCAGATGAAGTCATGCAAAGCGCTTTCATGGTTATTTCCCAT	5213	0	UF_Msa_CF_124840	contig31309___0	contig31309___0	Unknown	
5304	65	56	unmapped	0		0	AACGCAACCTTCTGCTCCAGTTTATTTACGAGCGTAATTTACAACATCTAATTGGCTTAA	5215	0	UF_Msa_CF_127800	contig13108___0	contig13108___0	Unknown	
5305	65	57	unmapped	0		0	AAATCTTTACAAGAGTCACGCGTTTTCTCCTCCATCTAGCTGGATGCAAAAGTGTCGGCA	5217	0	UF_Msa_CF_124117	LMB_S454.49.C1___0rc	LMB_S454.49.C1___0rc	Unknown	
5306	65	58		0		0		5219	1	DCP_22_0	DCP_22_0	DCP_22_0		CONTROL
5307	65	59	unmapped	0		0	TCAAGTATGACCACATCTTGAAGTGGGAGTTGTTCCAGCTGGCAGACTTGGACACGTATC	5221	0	UF_Msa_AF_107997	contig18861___1rc_nrnt	contig18861___1rc_nrnt	Unknown	
5308	65	60	unmapped	0		0	CTGGTACACAACAGGAGCCAATTTAATAATCAATCCCATTACCACAGCATTAAAATCAAT	5223	0	UF_Msa_CF_122934	contig12717___0rc	contig12717___0rc	Unknown	
5309	65	61	unmapped	0		0	GCTACGAGTACTTGAGGGAGCTGGGATACCCTTTGCCCTCCTACAGGACTCTGTGTAACC	5225	0	UF_Msa_AF_105439	contig01337___1rc_nr1nt0	contig01337___1rc_nr1nt0	Unknown	
5310	65	62	unmapped	0		0	AAAGATGAGGATTTACCTGGGACAGCTGCAGAGGGGAGCGTTTGTCATACGCCGACGGTC	5226	0	UF_Msa_AF_106268	contig06957___1_nrnt	contig06957___1_nrnt	Unknown	
5311	65	63	unmapped	0		0	TAAAGAGGTTCAGAGGGAGTGATAGGAGGCATCTGGTCAAGCAGTGAAACGGCCCAGCAC	5228	0	UF_Msa_CF_118811	contig02032___0	contig02032___0	Unknown	
5312	65	64	unmapped	0		0	ATAAGATCCAGCTGATCAACAACATGTTGGATAAGGTTGGTGAGATGATCATCGGTGGCG	5230	0	UF_Msa_AF_109043	LMB_S454.sd.586.C1___1_nrnt	LMB_S454.sd.586.C1___1_nrnt	Unknown	
5313	65	65	unmapped	0		0	CATACAGTGTATACTTTCTTCTTTCAACATAACCAACTGCAGGCTTTGTTTTGAAGGAAA	5232	0	UF_Msa_AF_100692	contig30349___1rc_nrnt	contig30349___1rc_nrnt	Unknown	
5314	65	66	unmapped	0		0	TGAGGAGCACCATGAAGAGGACCTGTTTCTCTACATGACCTACAGTAATGAGAGTGTGTA	5233	0	UF_Msa_AF_102739	contig18264___1_nrnt	contig18264___1_nrnt	Unknown	
5315	65	67	unmapped	0		0	CCTTCCACACAAATTCAGCTATCGATTTTAGGCCTTTTACGCTTCACATGCCTTTTCTTT	5235	0	UF_Msa_AF_102118	contig01065___1rc_nrnt0	contig01065___1rc_nrnt0	Unknown	
5316	65	68	unmapped	0		0	CTCTGTTCAGCTGTTGGATCTGCTTGCTCCAGACCTGGATCAGCCCTGAGCCGTCCCTCT	5237	0	UF_Msa_CF_119295	contig26729___0	contig26729___0	Unknown	
5317	65	69	unmapped	0		0	TGAACAGCGAGACCAGCGTGAACCCTGACTCTGATCCCGCTAACCCGTGACATTTGACCG	5239	0	UF_Msa_CF_121489	contig23964___0	contig23964___0	Unknown	
5318	65	70	unmapped	0		0	ACACAAAGGAAATTGGTGGTGAGGAGGAGGTTATGTTCAAAGTGCAGTTGGGTCATTCAG	5241	0	UF_Msa_CF_122156	contig07094___0rc	contig07094___0rc	Unknown	
5319	65	71	unmapped	0		0	CTGGCAGTGGGTGAAGGCCCGTTCGTGTCTCACTGTCTGCTGGGGGGAGAAGTCAAAGCT	5243	0	UF_Msa_AF_102317	contig02391___1_nrnt	contig02391___1_nrnt	Unknown	
5320	65	72	unmapped	0		0	AACCGAGCAGCCAGGTATTGTGAAATCTGGCCAGTATAAACACATACAAGTGGAGCTTGA	5245	0	UF_Msa_CF_124487	contig20561___0	contig20561___0	Unknown	
5321	65	73	unmapped	0		0	TCTTCTGGTTCTCAGTAGCTTCACCCTGCATTTGTACCCGCATCCACCTGTGTCCTAAAC	5247	0	UF_Msa_AF_107577	contig23555___1rc_nr0nt1	contig23555___1rc_nr0nt1	Unknown	
5322	65	74	unmapped	0		0	CTGCCTTTGTACATGCCCGGAGGTGGTTTGGATAATGGCACAGCAGCTGGTGGTTTTGGA	5249	0	UF_Msa_CF_126118	contig24143___0rc	contig24143___0rc	Unknown	
5323	65	75	unmapped	0		0	CACTCAAAATAAAAAGAAGATGGCTCAGTGGTGCCAGCTCCAGATGCTGGACTGTAAGTA	5251	0	UF_Msa_CF_127175	contig24113___0	contig24113___0	Unknown	
5324	65	76	unmapped	0		0	AAGAAGTTGACAGGCTGACAGAAACTCAAGCATCTGCTCAGGAGGAGTGGAAAAGCAAAA	5253	0	UF_Msa_CF_127027	contig10316___0rc	contig10316___0rc	Unknown	
5325	65	77	unmapped	0		0	GAGACAAATGTTTTGTTGATGTGTTTGTTGTGTTTGTCAGGACGGGTCGCCAATGGGTGA	5255	0	UF_Msa_AF_104139	contig14097___1_nrnt0	contig14097___1_nrnt0	Unknown	
5326	65	78	unmapped	0		0	CAACAGGCAGGTGGTTGCTGAGGCAGTGGGAGTCTTGTGCGGAGATCAAACAATCCGGCC	5257	0	UF_Msa_CF_123276	contig07542___0rc	contig07542___0rc	Unknown	
5327	65	79	unmapped	0		0	TAAAGTAAATGGAACAGCGATCATTCAGCTTCCTTCCAAGCAGCAGGTTCAGGTACTGGA	5259	0	UF_Msa_AF_107149	contig06270___1rc_nrnt-1	contig06270___1rc_nrnt-1	Unknown	
5328	65	80	unmapped	0		0	TTCTGCCACTGCCTCAGAATGTAATAGACTATTTACTGGACGATGGGACACTGGTAGTCT	5261	0	UF_Msa_AF_109853	LMB_S454.402.C1___1_nrnt	LMB_S454.402.C1___1_nrnt	Unknown	
5329	65	81	unmapped	0		0	AACGCCCGCACTTCACTGCTGAAGAACAATTAAAATAACACAAACACACACTCCTGAAAG	5263	0	UF_Msa_AF_101028	contig13335___1rc_nrnt-1	contig13335___1rc_nrnt-1	Unknown	
5330	65	82	unmapped	0		0	TAAAATGAGGTGACAAACATGATCCTGCTGCTTGTACAAATAAATAAATAAAAACACTAG	5265	0	UF_Msa_AF_100582	contig06802___1rc_nr0nt	contig06802___1rc_nr0nt	Unknown	
5331	66	1	unmapped	0		0	CGACAGCACGTCACCTACAGACGACCAGACTGCCAGCTAAGGTCAATCAGTTGTCACCCA	5112	0	UF_Msa_CF_124862	contig31627___0rc	contig31627___0rc	Unknown	
5332	66	2	unmapped	0		0	ATCTACTTGTATGACACACAGCAGACACTCCCTTTCGGTTTGGTGTCTAATGTCCACTAC	5114	0	UF_Msa_AF_104957	contig10613___1_nr1nt0	contig10613___1_nr1nt0	Unknown	
5333	66	3	unmapped	0		0	AAACAAATGGAGGACACACTCAGGAAGTCCATTTTCGAAGTGCTGATGAAATTTGCGTTT	5115	0	UF_Msa_AF_109041	contig23682___1_nr0nt1	contig23682___1_nr0nt1	Unknown	
5334	66	4	unmapped	0		0	ACACTGTATGTATCCTGCTCACCCTCTCCTCCATGTAACGAAGTAACTAGGCTGTCCAAA	5117	0	UF_Msa_CF_119858	contig01391___0rc	contig01391___0rc	Unknown	
5335	66	5	unmapped	0		0	TTATTTCCCCTCTGCGTACACAACATATCAAGGCAGACAGTTATAAAGCCCAGGAGAAGG	5119	0	UF_Msa_CF_120746	contig16163___0	contig16163___0	Unknown	
5336	66	6	unmapped	0		0	AACTGGTTTATAAAACACACCAGCTTAGAAGTGGTTTCAAGCAACACAGCCGGAGGAGGT	5121	0	UF_Msa_CF_123831	contig30795___0	contig30795___0	Unknown	
5337	66	7	unmapped	0		0	TGATGAAGAAGGACAAGAAGAGACAGAGTGAATCGGGAAGTGGAAACTCCAGTGACCCTC	5123	0	UF_Msa_CF_122691	contig07289___0	contig07289___0	Unknown	
5338	66	8	unmapped	0		0	TTGAGACTGGTTTTGAGAAGGGTGGACAGACGCGGGAGCACGCAATGTGGCCAAAACAGC	5125	0	UF_Msa_AF_107500	contig06559___1_nr0nt1	contig06559___1_nr0nt1	Unknown	
5339	66	9	unmapped	0		0	TTGTTTGCCGTGTTAAGGAAAACATCGCGCTGCTGCTCGCTAGCAAACACGTCATGTCTC	5127	0	UF_Msa_CF_119328	contig09642___0rc	contig09642___0rc	Unknown	
5340	66	10	unmapped	0		0	CTGCACCAGTATAAGACCGTTTCTGCCAGTGACATCCAGTACAAACCAGTCAGTGTAGCC	5129	0	UF_Msa_AF_107530	contig07627___1rc_nrnt0	contig07627___1rc_nrnt0	Unknown	
5341	66	11		0		0		2943	1	ETG07_105829	ETG07_105829	ETG07_105829		CONTROL
5342	66	12	unmapped	0		0	AAGGTTGACCGAGCAAATTTTGGCACTCAAAAAAGAGAAGAATGATGCTCTCTCTAAAAA	5132	0	UF_Msa_AF_106460	contig29081___1_nrnt0	contig29081___1_nrnt0	Unknown	
5343	66	13		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
5344	66	14	unmapped	0		0	TCACGATAATTGTTATGGCAATGATAATGATGAACATGAAGGACAGTGAGGATGAGGAGG	5135	0	UF_Msa_CF_125898	contig11190___0	contig11190___0	Unknown	
5345	66	15	unmapped	0		0	CAGGTCAAAATGGAGAGAGTTTTGCTTTAAGATTTGATTTAAGGGAACACCGTCAATCTC	5137	0	UF_Msa_CF_123810	contig04356___0	contig04356___0	Unknown	
5346	66	16	unmapped	0		0	CGGATGCCTAAGCCGGAAGCAATCTGCTACCATACTTTTTTAAAATATTAAATGAATAAC	5139	0	UF_Msa_CF_117948	contig01927___0rc	contig01927___0rc	Unknown	
5347	66	17	unmapped	0		0	TTTATGAAGGGTGTCCCAACCTTTATGCTCCAAATGTGTCCCTCCTTAAAATCATTGACT	5141	0	UF_Msa_AF_102376	contig27553___1_nrnt	contig27553___1_nrnt	Unknown	
5348	66	18	unmapped	0		0	GAAGGAGAAGCAGCATCATCACCAGCAGTCTAGCTCCTCCTCCTCTTCTGACATGTCCAC	5143	0	UF_Msa_CF_118921	contig13330___0rc	contig13330___0rc	Unknown	
5349	66	19	unmapped	0		0	TTAGCATTCAGTCTCTCAGTCTTTATGGGTGGGACATGGGTTTGGAGCGGGGAGGGTGCG	5145	0	UF_Msa_CF_121274	contig21949___0	contig21949___0	Unknown	
5350	66	20	unmapped	0		0	AGACAGTTCTGTAATTCTCACTACGCTGACCTAGATGCAAACAGAGATGCAGATGCAGAC	5147	0	UF_Msa_AF_105213	LMB_S454.610.C1___1rc_nrnt	LMB_S454.610.C1___1rc_nrnt	Unknown	
5351	66	21	unmapped	0		0	CCATTTTGTTGTTTCTCCTGGGAAACTCTAGTAATTTGCCCTCAAACTTTATTATGAAGA	5149	0	UF_Msa_AF_103901	contig08269___1_nr0nt	contig08269___1_nr0nt	Unknown	
5352	66	22	unmapped	0		0	TATCGAACAGACTCTCGTTACTGTGGCCGGGAAAAGCTCGTCGACAGGCCGGATGAGGAA	5151	0	UF_Msa_CF_121395	contig08432___0	contig08432___0	Unknown	
5353	66	23	unmapped	0		0	AAATGAGGGTGCGCGGGTGCGCCGGCAACACGACAGCAAATGAACATACAATGAACCAGC	5153	0	UF_Msa_CF_125182	contig13465___0rc	contig13465___0rc	Unknown	
5354	66	24	unmapped	0		0	GGCCCCTCATACGTTTTCTATATAAATAAAACTGCTTAGTAAGCATTGTACAGAGACCTT	5155	0	UF_Msa_AF_106209	contig02074___1_nr0nt1	contig02074___1_nr0nt1	Unknown	
5355	66	25	unmapped	0		0	CGAGGCTAAGATCAAGGCCGAGTACGCTCAGCTATTGGAGGACATGCAAAACGCCTTCCG	5157	0	UF_Msa_AF_104360	contig24036___1_nr0nt1	contig24036___1_nr0nt1	Unknown	
5356	66	26	unmapped	0		0	GAGAAATTTAATGAGATTCTGTCTGAGAACAGAGTTCGTCCCACAGCACTGTTACCCCTC	5159	0	UF_Msa_AF_107481	contig26202___1rc_nrnt-1	contig26202___1rc_nrnt-1	Unknown	
5357	66	27	unmapped	0		0	TATACCCCTACCACTTACACAGCCTATCCCAGCAGTGTGGCCGACATGCACCAGCAGCCT	5161	0	UF_Msa_CF_120695	contig04266___0	contig04266___0	Unknown	
5358	66	28	unmapped	0		0	GGAGTGCAGGCTTTTGCAGATGCTCTACTAATCATCCCCAAGGTTTTGGCCCAGAACTCT	5162	0	UF_Msa_AF_100355	contig17661___1_nr0nt1	contig17661___1_nr0nt1	Unknown	
5359	66	29	unmapped	0		0	GCTTTATATCCAGGATTTGCTGTCACCATCCGTGTTTCACTGTTTATGACACGTTACTAC	5164	0	UF_Msa_CF_119638	contig17960___0rc	contig17960___0rc	Unknown	
5360	66	30	unmapped	0		0	TTCTTTTCACTGCGGCTCTGTTTGGCTTTGCTGACAGGTTCTTCATCTATTTCAGCAGCT	5166	0	UF_Msa_AD_200092	LMB_Add_40_rc	LMB_Add_40_rc	Unknown	
5361	66	31	unmapped	0		0	GTGTTTATTAATCTGTACATCTCTGCAACAGGACGCATCAGTTTGACTGACTGATACTGG	5168	0	UF_Msa_AF_103640	contig08686___1_nr0nt	contig08686___1_nr0nt	Unknown	
5362	66	32	unmapped	0		0	GCACTCATTGAGCAGTCCGGTCAATGTCCGCTTTAGAGGCTATCTCCAAACTAAAAACCG	5170	0	UF_Msa_CF_123170	contig20476___0rc	contig20476___0rc	Unknown	
5363	66	33	unmapped	0		0	TTTGTGTGTAGAGTTCTGAAAATATGAGGCATTCTTTCAGAAAATGTGTGTCAACAAACG	5172	0	UF_Msa_AF_103203	contig25265___1_nr0nt1	contig25265___1_nr0nt1	Unknown	
5364	66	34		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
5365	66	35	unmapped	0		0	AACATGAACGCCTTGACTGGCGTCTTGTGTCTTTTGGTAAAAACACAACCTGAAACCCTG	5175	0	UF_Msa_CF_126536	contig27109___0	contig27109___0	Unknown	
5366	66	36	unmapped	0		0	ACACTCATCGCCCTGGCAGACAAACATGCAAGGGAGCTGGAGGAGGAGATGGAGAATCCA	5177	0	UF_Msa_AF_105566	contig18816___1rc_nr0nt	contig18816___1rc_nr0nt	Unknown	
5367	66	37	unmapped	0		0	TGTGGTAACTTTTCTGACACCTCCTGCTTAAAACCCAAAAAGTCAGAAGGATCGTGAGGC	5179	0	UF_Msa_AD_200114	LMB_Add_47	LMB_Add_47	Unknown	
5368	66	38	unmapped	0		0	TGATAGCCTGTCTGCTCACATACATTATATTAATGCCATGAAATTTAAATTTTACAATAC	5181	0	UF_Msa_AF_102164	contig14970___1_nr0nt1	contig14970___1_nr0nt1	Unknown	
5369	66	39	unmapped	0		0	GACTGCACGAGTACTTTGTTATTGGTAAATAAGGAAAATTCCAAGTTGCAAGAAAGACAT	5183	0	UF_Msa_CF_124436	GP3-1A7.g___0rc	GP3-1A7.g___0rc	Unknown	
5370	66	40	unmapped	0		0	TCAGCAACAGAGTACTACAAAGATGTCCTGAAGCAGGACAATACTCACGTGGAGGCTATA	5185	0	UF_Msa_AF_103281	contig31808___1rc_nrnt	contig31808___1rc_nrnt	Unknown	
5371	66	41	unmapped	0		0	TTTCTGTATCAGCTCCTTACAGAAATGCTGCTTCTTTCTGCTACTGTTGGTGATGCTGAT	5186	0	UF_Msa_CF_118877	contig12657___0	contig12657___0	Unknown	
5372	66	42	unmapped	0		0	TTAATGACTGAGAGTGAACTGTCCATGTCAAGTGAGAGGGGCTGTCTCACCATCATATCT	5188	0	UF_Msa_AF_100011	contig29515___1rc_nr0nt1	contig29515___1rc_nr0nt1	Unknown	
5373	66	43	unmapped	0		0	ACCAGCCTGTCCTGTCTTTCTGCGTTTAGCTGGCATGCCATGCAAATCTGAGACACGCAA	5190	0	UF_Msa_CF_120328	contig02003___0rc	contig02003___0rc	Unknown	
5374	66	44	unmapped	0		0	CTCTGCCAACTTAAGGACAAGGTAGAGGTCATGACTCTGACCTCTGACCTCCAGCCCTTC	5192	0	UF_Msa_AF_107046	contig03861___1rc_nrnt	contig03861___1rc_nrnt	Unknown	
5375	66	45	unmapped	0		0	CAAACCCAAAAGACCTGTCTGCTCACCATACTTGCAAGGGAGGGCACAGCAGGACAAAGT	5194	0	UF_Msa_CF_117872	contig06569___0rc	contig06569___0rc	Unknown	
5376	66	46	unmapped	0		0	GAAGACCTCTCTAACAGCAGCGGGCAGTTTAGTTACCAACTTTAAAACTTCATTTCAGCA	5196	0	UF_Msa_CF_118145	contig07356___0	contig07356___0	Unknown	
5377	66	47	unmapped	0		0	AATGCAGCCCACACGGGTTCACAACAGAAGAGAAATAGTAAAAGTGTTGTACGTGCAATG	5198	0	UF_Msa_CF_127173	contig28091___0rc	contig28091___0rc	Unknown	
5378	66	48	unmapped	0		0	ATGGAATATTAGTTAGAGACATCTCCTCCAGCCTTGGCTTAAGGCACAGCGTGACTGAAA	5200	0	UF_Msa_CF_125772	contig10657___0	contig10657___0	Unknown	
5379	66	49	unmapped	0		0	CTGCATCATCATCAGGCCTTCATCAGGCCTAACGCCTCGCTTGGTAGACATCCTTGTTTA	5202	0	UF_Msa_CF_123662	contig07713___0rc	contig07713___0rc	Unknown	
5380	66	50	unmapped	0		0	CCAGAGAAGAGCCTGGACGATTTCTTTGCCAAGCGGGATAAAAAGAAGAAGAAAGAGAAA	5204	0	UF_Msa_AF_105360	contig24862___1_nr0nt1	contig24862___1_nr0nt1	Unknown	
5381	66	51	unmapped	0		0	TTAAACGACTTTTACCTTCACAGGTTTCTACCAACATGGTGAGGACTAAAGCCGACAGCG	5206	0	UF_Msa_CF_121512	contig15966___0rc	contig15966___0rc	Unknown	
5382	66	52	unmapped	0		0	AAGAATCACGGTTCTTTGTGGCGTAAACAAACCGTCGGTGGGAGGCGGCCACCGAACTCA	5208	0	UF_Msa_CF_125190	contig09084___0	contig09084___0	Unknown	
5383	66	53	unmapped	0		0	GAACTCAGAGAAAAGTCAGAAAAGCACGTCTTTCAGGCTGAAGTCAACCGTATGATGAAG	5210	0	UF_Msa_AF_102381	contig05750___1rc_nrnt	contig05750___1rc_nrnt	Unknown	
5384	66	54	unmapped	0		0	GAAAAAGGGCTTTGAGCCGAAGGGACGCGGAGATCTCAGGTAACCCAGCTCAAGTCTCCA	5212	0	UF_Msa_CF_118595	contig03487___0	contig03487___0	Unknown	
5385	66	55	unmapped	0		0	TCCAGCTGGGTGGACGAACCTTTGTCTCTAGAGAAAGCCAGCCCCTGCCTATAGCCATCA	5214	0	UF_Msa_CF_121905	contig21572___0rc	contig21572___0rc	Unknown	
5386	66	56	unmapped	0		0	AGGATGTGATGAGTTCAGGTGAGGAGTCTCTCAGCAGTTCTCTGGGCAGCGACGCTGAAG	5216	0	UF_Msa_CF_124743	contig29921___0	contig29921___0	Unknown	
5387	66	57	unmapped	0		0	GAAAGGCTGCTCCTGGGTATCACATGGCGAAGCTAATCATCAAGCTGATCACCTCAGTGG	5218	0	UF_Msa_AF_109011	contig07946___1_nr0nt1	contig07946___1_nr0nt1	Unknown	
5388	66	58	unmapped	0		0	CTTGTCTAGAGAAGCTAATTCAATTGAGATTTTAGCCTCTCGCTGAGGAGATTGTAAATG	5220	0	UF_Msa_CF_124940	contig30114___0	contig30114___0	Unknown	
5389	66	59	unmapped	0		0	AAACTCCTTCATGCACGTCAACACCAACGCTGAGTTCTACGCCGGCACGGGGGTCATCTA	5222	0	UF_Msa_AF_108107	contig19683___1rc_nrnt	contig19683___1rc_nrnt	Unknown	
5390	66	60	unmapped	0		0	TGTGTCAGCATGCTTCGGCCACAATGTTACAGCAACATGCGTTAATGATTGATCAGAGCT	5224	0	UF_Msa_CF_119083	contig00363___0	contig00363___0	Unknown	
5391	66	61		1028	E1A	0		853	1	(+)E1A_r60_a97	E1A_r60_a97	E1A_r60_a97		CONTROL
5392	66	62	unmapped	0		0	ACCAGTGTTTGAATTTGTTTCCACATAATGGACCTTTGCATTCTATTAAAAATCTGCTGA	5227	0	UF_Msa_AF_109030	contig32660___1_nr0nt1	contig32660___1_nr0nt1	Unknown	
5393	66	63	unmapped	0		0	AGAGTTTGAAGTTCCTTGTCCAGCGAGGGAATCATTTACTGAAGTGCATTGCATGTTCGC	5229	0	UF_Msa_CF_127177	LMB_S454.957.C1___0	LMB_S454.957.C1___0	Unknown	
5394	66	64	unmapped	0		0	TGCCCAGGTGACTTCCAGTTTCAACCTCCCCTGCCCCCTGGATCTCCTTGCTTCAGTTCA	5231	0	UF_Msa_CF_127121	contig00041___0rc	contig00041___0rc	Unknown	
5395	66	65		1028	E1A	0		1133	1	(+)E1A_r60_a104	E1A_r60_a104	E1A_r60_a104		CONTROL
5396	66	66	unmapped	0		0	CTTTAGAAAAGGAGTACAAAAGCTTCATTGCCAAACTACGAGTTCTTGATCCCTCCTGCA	5234	0	UF_Msa_AF_107424	contig04203___1rc_nrnt0	contig04203___1rc_nrnt0	Unknown	
5397	66	67	unmapped	0		0	AAATTATGGTAATCTTTACAACGGTAAGCCGTTGTTGTGAGAGCATTTCAAGAACCAATT	5236	0	UF_Msa_CF_124303	contig26496___0	contig26496___0	Unknown	
5398	66	68	unmapped	0		0	AGTGTTTGCACGGATCTGCCAGGTGATGGAGACCTTCTGATTTCTACATTTTCCTCAACA	5238	0	UF_Msa_CF_118320	contig13370___0	contig13370___0	Unknown	
5399	66	69	unmapped	0		0	TATACCTGTACAGTATGCTGGAAATCATTCCGCCACTATTTCCACCTGACGGCACATCAA	5240	0	UF_Msa_AF_108772	contig23993___1rc_nrnt0	contig23993___1rc_nrnt0	Unknown	
5400	66	70	unmapped	0		0	TGAAGACACTCCAGAAAGAAGAGTATGCCAAACTTTGTAACCTTACGGAAAATGAAGGGA	5242	0	UF_Msa_AF_101591	contig19338___1rc_nrnt0	contig19338___1rc_nrnt0	Unknown	
5401	66	71	unmapped	0		0	AAACTTGATGTTGAGGAGGATGAACAGCAGGATTTAGAAGCTGAAGAGGAGGCCTCAGAA	5244	0	UF_Msa_CF_121240	contig07125___0	contig07125___0	Unknown	
5402	66	72	unmapped	0		0	TTTCTTTTTGGTTGTCTTCTGTCCTTACCTTGGAGTTTTCCTGATAGCCCGAAACAGGCC	5246	0	UF_Msa_AF_110283	contig08753___1_nrnt	contig08753___1_nrnt	Unknown	
5403	66	73	unmapped	0		0	CTACCTCTCTAGACTGATCTATGCTTTAAACCTTAAAGGAACTGAGGTACACATTTGAGA	5248	0	UF_Msa_CF_123147	contig17911___0rc	contig17911___0rc	Unknown	
5404	66	74	unmapped	0		0	CAAAGTCTCAGGCTCTATCTGGCTCAGGAAATGCAGACATATGATGCAGATGAATGACTG	5250	0	UF_Msa_AF_107992	contig29380___1_nr0nt	contig29380___1_nr0nt	Unknown	
5405	66	75	unmapped	0		0	AAATCCTTGCAGTTGTTGGGCAGTTTCTCTCACACACATTTTTCACCACAGAGGACGAGA	5252	0	UF_Msa_AF_105261	contig30875___1rc_nrnt	contig30875___1rc_nrnt	Unknown	
5406	66	76	unmapped	0		0	CTGTGCCGAAGTGGCACAGATTTGATTTAATTAATGTAGTGCAAGTTTGTCTAATTTTGT	5254	0	UF_Msa_CF_121867	contig12641___0rc	contig12641___0rc	Unknown	
5407	66	77	unmapped	0		0	AAACGTCCCGAGACTCCATCCAAAGGGTCAAATGGAGAAGAGGCCCCCACAGTTCCCACA	5256	0	UF_Msa_CF_123099	contig23857___0	contig23857___0	Unknown	
5408	66	78	unmapped	0		0	ATCTGAACAGCACCAACAAACCAAACAGCAGCCTCAACAGGAAACGCAACAGCATCACTA	5258	0	UF_Msa_CF_127678	contig23100___0rc	contig23100___0rc	Unknown	
5409	66	79	unmapped	0		0	ATTAAATGGACTGGAACGGAAACTGGACCGTAACCATGATTGGAACTCTGAGACATGGGT	5260	0	UF_Msa_AF_106424	contig07986___1_nr0nt	contig07986___1_nr0nt	Unknown	
5410	66	80	unmapped	0		0	ATGAGGGACATCTGGTTCGGCACCAAGGAGGGTGAGTTCATCTCCATGGGTGTGTACGCT	5262	0	UF_Msa_AF_104838	LMB_S454.201.C1___1rc_nrnt	LMB_S454.201.C1___1rc_nrnt	Unknown	
5411	66	81	unmapped	0		0	GTAATGATACAATGTAAGTTCAGTTATCTCTGAATAGTGGGCTCCTGAGCTTTTTGCCAC	5264	0	UF_Msa_CF_125093	contig10481___0	contig10481___0	Unknown	
5412	66	82	unmapped	0		0	CGGTGCTTCAGACCTCACAGGGAGCTTTAGACTGTACAAGAAGAAGGTGTTGGAGAGTCT	5266	0	UF_Msa_AF_100946	contig16720___1rc_nrnt0	contig16720___1rc_nrnt0	Unknown	
5413	67	1	unmapped	0		0	CACCTCCTCACAGTTCAGATCTCAGCTGTGGACAAATCGCCACATTCCTCCAGTCTTCTC	5267	0	UF_Msa_CF_117827	contig12855___0rc	contig12855___0rc	Unknown	
5414	67	2	unmapped	0		0	ACCTGACCATGGACACAGCACTGCAGAGTGGCAAGATGAACATCCGTGCCTACGTCAGTG	5269	0	UF_Msa_AF_107999	contig19516___1rc_nrnt	contig19516___1rc_nrnt	Unknown	
5415	67	3	unmapped	0		0	TGAGCTCCAACTCACAGCTCGCGCTGTCCATATTCCCACCCGGCCGCCCCGCCTTCGCTC	5270	0	UF_Msa_CF_118427	contig19448___0rc	contig19448___0rc	Unknown	
5416	67	4	unmapped	0		0	GCTGGGATACTGTTTCTTTTTAAAGCCAATTCATGAATAGTTGTGTGTCTTACAATTTCC	5272	0	UF_Msa_AD_200333	LMB_Add_114_rc	LMB_Add_114_rc	Unknown	
5417	67	5	unmapped	0		0	ATGGTTTCAACGGAGCTGATCTGAGAAATGTGTGCACAGAAGCAGGTTTATTTGCCATCC	5274	0	UF_Msa_AF_101317	contig31134___1_nrnt	contig31134___1_nrnt	Unknown	
5418	67	6	unmapped	0		0	CTGCATTATGATGGATGGATGAAAGGTCCATGTGGTTGTACAGATTACATGTATATAAAT	5276	0	UF_Msa_AF_102013	contig30228___1_nrnt	contig30228___1_nrnt	Unknown	
5419	67	7		1028	E1A	0		1133	1	(+)E1A_r60_a104	E1A_r60_a104	E1A_r60_a104		CONTROL
5420	67	8	unmapped	0		0	TAATTACAGTATGGCCACCAGAGGTACATTGCACATGGTGCTTCTGGTGACTACAACCAA	5279	0	UF_Msa_CF_122074	contig11695___0rc	contig11695___0rc	Unknown	
5421	67	9	unmapped	0		0	TTCTCCGTGTGAGGATGCAGATCTGTCGGATGCAGAGAAGGTGTATGCCGAGTGTGGCCA	5281	0	UF_Msa_CF_120882	contig19650___0rc	contig19650___0rc	Unknown	
5422	67	10	unmapped	0		0	TTCACCAGGGACGTACGCTATCACTGCCAGCATGCCAGAGTCACAGCAGCAGACTCAACT	5283	0	UF_Msa_CF_118763	contig27471___0rc	contig27471___0rc	Unknown	
5423	67	11	unmapped	0		0	GACTCTTAAGATGGAGTTGAATGAAGATCACTAACTGTCTATTAGAGTACGTACATTCAA	5285	0	UF_Msa_AF_103246	contig30425___1_nrnt0	contig30425___1_nrnt0	Unknown	
5424	67	12	unmapped	0		0	GGCCATTATACCACCCCAGAGTGGGGAGCGATAATTGCAGGGGGAGAGTACAATCAGGTA	5287	0	UF_Msa_CF_127077	contig06134___0	contig06134___0	Unknown	
5425	67	13	unmapped	0		0	TTTATCTGCAGCAATACTGAATTTGCAGTGATCACCGTGCGAGGCCAGAGCTTTATGTTG	5289	0	UF_Msa_AF_107317	contig30142___1_nrnt	contig30142___1_nrnt	Unknown	
5426	67	14	unmapped	0		0	GATTTCAGAAAGCTGGAGTCAGACTTGACCATGAAGCTGTACAGAACATTATCAGATTTC	5291	0	UF_Msa_AF_103688	contig13710___1rc_nrnt-1	contig13710___1rc_nrnt-1	Unknown	
5427	67	15	unmapped	0		0	GGAATGGTGGCAGTCTGACAGATAAATCAAGGGACGCAGCTACTGGTATCTCAGATGTGG	5293	0	UF_Msa_CF_123394	contig23398___0	contig23398___0	Unknown	
5428	67	16	unmapped	0		0	TTAGAAAGGAAATAGTGCGGCGAAAGATGGGGAAGGACATGCAGGACTTAAAGAAGAAAC	5295	0	UF_Msa_CF_120717	contig17464___0rc	contig17464___0rc	Unknown	
5429	67	17	unmapped	0		0	AAGGGCTTTGCTACATCGCTCTCCATCATCCTGTCAACTCTTATATCGTACTTCTGGCTA	5297	0	UF_Msa_AF_108329	contig25257___1_nrnt0	contig25257___1_nrnt0	Unknown	
5430	67	18	unmapped	0		0	ATTTACTGCTGCCTACAAACCTTGTGGACCCTGCCAGATTAAAGCGTCCTCCTCCTCCTG	5299	0	UF_Msa_AF_105240	contig14197___1rc_nrnt-1	contig14197___1rc_nrnt-1	Unknown	
5431	67	19	unmapped	0		0	TCTGTGTTCCGAGAATGCTTACTTTACCAAGCAGACGACGGCAGTCGACAAAATATGTTG	5301	0	UF_Msa_CF_121225	contig12367___0	contig12367___0	Unknown	
5432	67	20	unmapped	0		0	GCGAAGTCCGTCAGCTCCAGGCATGTACCAGGGCCAGTGGAGGATGTGTACAGCTTCTGG	5303	0	UF_Msa_AF_105975	contig05212___1rc_nrnt	contig05212___1rc_nrnt	Unknown	
5433	67	21	unmapped	0		0	ACTTAAAAAGACAGGTGGAAGATGAAAGACAGCTCAGAGAGGACGCTGTAGACAGAATTA	5305	0	UF_Msa_CF_118665	contig23188___0	contig23188___0	Unknown	
5434	67	22	unmapped	0		0	CCTCAGACTTTTTCTAAGTAAGAGAAGATATTCTCTGCTTTAACTGTACATAACAGACTC	5307	0	UF_Msa_CF_124699	contig13214___0	contig13214___0	Unknown	
5435	67	23	unmapped	0		0	AAGAAGTTTGAGGAGCTACCGATCGCGCACATTAAAGCCACATACAACAACACACACATC	5309	0	UF_Msa_AF_103153	contig10700___1_nrnt	contig10700___1_nrnt	Unknown	
5436	67	24	unmapped	0		0	GAGGGTGTCAGTGCTCAGATCTGCTGTGAGCTTAACAAGTCTTTAACAGAGAGGAACTAT	5311	0	UF_Msa_CF_119985	contig15218___0	contig15218___0	Unknown	
5437	67	25	unmapped	0		0	AGATGAACTACTGCTGATTGAAAACTGCTGTTTTTGGTATGATGGCTCTAAATAAACACC	5313	0	UF_Msa_AF_107735	contig30150___1rc_nrnt	contig30150___1rc_nrnt	Unknown	
5438	67	26	unmapped	0		0	GAGTTCTTGCATCAACAGTGTTTGAACGGAGCTTCTTCCTTCGTCCCGCTTTTATTTCAA	5315	0	UF_Msa_AF_110042	LMB_S454.929.C1___1_nr0nt1	LMB_S454.929.C1___1_nr0nt1	Unknown	
5439	67	27	unmapped	0		0	CCCTGCAGAAGGAAGTGGAGTTAAAGACTCGGATGCTTGAGTCACTCCAGTCAGACTACG	5317	0	UF_Msa_AF_105278	contig25955___1_nrnt	contig25955___1_nrnt	Unknown	
5440	67	28	unmapped	0		0	TGTCAGATGAAGCTGCCAAACACAGCGGGGGTTACTTTGCCGACTGCCGACCACTACTCT	5319	0	UF_Msa_CF_124144	contig18366___0	contig18366___0	Unknown	
5441	67	29	unmapped	0		0	AGAGACACCATAATACCAAAGGATGAAGATTGTGACTGGCCTGCAGTATCCGATCCATCA	5321	0	UF_Msa_CF_119428	contig11500___0rc	contig11500___0rc	Unknown	
5442	67	30	unmapped	0		0	GGGACAGTTGCCGGTAGTTTACATAAACAATGTGGGAAGTTTTACAGTGTCTGACTGCGA	5323	0	UF_Msa_CF_121590	contig21330___0rc	contig21330___0rc	Unknown	
5443	67	31	unmapped	0		0	TGGAGCTGACCCGTCCGAGTGCACTTATTAAGCCATCAGCTAACACAGAGGAGGTGTGTG	5325	0	UF_Msa_CF_121488	contig14941___0	contig14941___0	Unknown	
5444	67	32	unmapped	0		0	TACAGGCAAGAATCTTGTCGTCATGGGTTCTACGGCGCCCATTAAGATTGGAATAATTGG	5326	0	UF_Msa_CF_127736	contig06994___0	contig06994___0	Unknown	
5445	67	33	unmapped	0		0	GCTGACATGGTGATGTTCAAATAGTTTTATTTCTGGTAGACATGTTTGCACAAATTGAAC	5328	0	UF_Msa_AF_102154	contig30471___1_nr0nt1	contig30471___1_nr0nt1	Unknown	
5446	67	34	unmapped	0		0	ATGGGTTCAGAGAAGAGCAAAGAGGACATGAAAGCTACATACACGCAATGCATGAGGGAT	5330	0	UF_Msa_AF_100532	contig29473___1_nr1nt0	contig29473___1_nr1nt0	Unknown	
5447	67	35	unmapped	0		0	GTTTAGAGGCAGTTTACAAAAACACAAAGAAAGACATGCAGACAAAGGAGCACATGCAAG	5332	0	UF_Msa_CF_126571	contig32069___0	contig32069___0	Unknown	
5448	67	36	unmapped	0		0	GACTCCTGACAGTATTAGTGTGACTCTGACAATGTCTTCTAATAGTGCCTTGGAGGTGTA	5334	0	UF_Msa_CF_124175	contig18529___0	contig18529___0	Unknown	
5449	67	37	unmapped	0		0	TATTTACAGTGAAGAGGACGATCTGTACAAACTGGTAAGCGAGGTGTACATGCTGGACAG	5336	0	UF_Msa_CF_124585	contig19657___0rc	contig19657___0rc	Unknown	
5450	67	38	unmapped	0		0	CGAGGAGATTCTGACTGTTGCTAAGTGGCGCATTGCTGAGGCGAAAGGGTATGACACCTG	5338	0	UF_Msa_CF_120157	contig27454___0	contig27454___0	Unknown	
5451	67	39	unmapped	0		0	ATAGCAGGGTATGTTTCAAACCCAGCACACAGGGTGTCTCTCGTTCAGCTATGATAAACA	5339	0	UF_Msa_CF_127572	contig32357___0	contig32357___0	Unknown	
5452	67	40	unmapped	0		0	TGGAAAGTCCAGCGTTCATCAGTTCAGTTCAGTTCGGTGTTTAATGGAAGAGTCACCAAC	5341	0	UF_Msa_CF_117863	contig00857___0	contig00857___0	Unknown	
5453	67	41	unmapped	0		0	ACGAGCAGTTCAACGACGAGAAGACCTACCTAATCAAACAGATCAGGGATCTGAAGAAAC	5343	0	UF_Msa_AF_100424	contig21040___1_nrnt	contig21040___1_nrnt	Unknown	
5454	67	42	unmapped	0		0	TTCACATCAAGTCTTTCACAAACTGCTGAGATTGACCAACCGGTTTCTCCTTTTGTATTG	5345	0	UF_Msa_CF_126953	contig13784___0	contig13784___0	Unknown	
5455	67	43	unmapped	0		0	CAGGAAATCACCTACCTCTTCCTAACACACAGCAAAAGAAATGGACGATGACAGTTGTGA	5347	0	UF_Msa_CF_120359	contig28086___0	contig28086___0	Unknown	
5456	67	44	unmapped	0		0	AATCCGCAGCAGGCCAAGCCAGCGAAGGACCCGGAAGTTTTGTCTGTAGACAAACTGAGG	5349	0	UF_Msa_AF_107370	contig08199___1_nrnt0	contig08199___1_nrnt0	Unknown	
5457	67	45	unmapped	0		0	CGAACAGTGGAGGGCAGCAAAACGCCATCGATGCGTCGAGTCAGCCGAATTGAAGAAGAA	5351	0	UF_Msa_CF_124608	contig23231___0	contig23231___0	Unknown	
5458	67	46	unmapped	0		0	CTCTCAAGGAGCAAAGACCGAAATGCTAATAAAAAAGAGGAGTCAGAATCTGATCATAAT	5352	0	UF_Msa_AF_106422	contig29107___1_nrnt	contig29107___1_nrnt	Unknown	
5459	67	47	unmapped	0		0	GAAGAGCAATGATTTGTAGTTGGTCACATAGCAAAGTTGAAGGAACATGAATAGTAGAGT	5354	0	UF_Msa_AD_200339	LMB_Add_135_rc	LMB_Add_135_rc	Unknown	
5460	67	48	unmapped	0		0	TATGTGTGTGAGCTGGAGCAGCAGCTGAGGTCGGAGAGGTCTGCCTCCTCTGCCTCAGCT	5356	0	UF_Msa_CF_124239	contig22515___0	contig22515___0	Unknown	
5461	67	49	unmapped	0		0	AGGCTCACCAAGGATTCCACTCTCAAGATGAACACCATGCTCAAGGCCCCCTGAGACACG	5358	0	UF_Msa_CF_121940	contig00875___0rc	contig00875___0rc	Unknown	
5462	67	50	unmapped	0		0	TGACCGTCTTCTTTTATGCTTTGTGTTTCTTTTATAATAGAAGTCATTGTGGTACTGTCG	5360	0	UF_Msa_AF_100461	contig25463___1_nr0nt1	contig25463___1_nr0nt1	Unknown	
5463	67	51	unmapped	0		0	AACAGTGCTGACCCCTACAAGAGGCCGTCTACTGCCTGATCGGGAAATGTGACATCAGTG	5362	0	UF_Msa_AF_101056	contig10010___1_nr0nt	contig10010___1_nr0nt	Unknown	
5464	67	52	unmapped	0		0	ACTGGTTCACAAGGAGCAGTAACAGGTAGGGGAGATGAAGCAAATAGCCCAGCAGGAGCT	5364	0	UF_Msa_CF_127391	contig16606___0	contig16606___0	Unknown	
5465	67	53	unmapped	0		0	GGTGGGGGTTACCTTCCACATCCCCAGCTCCTGCCAAGACATGCAGCAGGCATACACACA	5366	0	UF_Msa_AF_106682	contig13009___1_nrnt0	contig13009___1_nrnt0	Unknown	
5466	67	54	unmapped	0		0	AGAAGACGGTCATCATCCTGAAGAAGAAGCTAGCACAGAAAACTGAGGTACTGAACAAAG	5368	0	UF_Msa_CF_122011	contig10636___0	contig10636___0	Unknown	
5467	67	55	unmapped	0		0	GCATGTGAGCCGCTGTACTAGGGCTGGACAATAAAACCATAACAATAATTATCGCAATAT	5370	0	UF_Msa_CF_119159	contig02439___0	contig02439___0	Unknown	
5468	67	56	unmapped	0		0	ATCTTGGACTCTAGCCGGTGCAGCAGGTCCTTGGCCAACCTATTAATGTTTTGAAATAAA	5372	0	UF_Msa_CF_125464	LMB_S454.sd.189.C1___0	LMB_S454.sd.189.C1___0	Unknown	
5469	67	57	unmapped	0		0	TTGAAGTTCCACTGGCCTTTCGGCAAGTTCATGTGTAAGCTGAACAGCACTGTAAGCTTA	5374	0	UF_Msa_AF_102255	contig21308___1rc_nrnt0	contig21308___1rc_nrnt0	Unknown	
5470	67	58	unmapped	0		0	ACCAACTTGTACACTGTCAGATGAAGAATGTATCCGGACTGTGGCAGCCATGCTAAGCAG	5376	0	UF_Msa_CF_124994	LMB_S454.155.C1___0rc	LMB_S454.155.C1___0rc	Unknown	
5471	67	59	unmapped	0		0	ACGCATTGAACGCATGGAGCGTCGCCTGCAGCTCACAAGGAAGGATCCGCCGCGTGACAA	5378	0	UF_Msa_AF_102462	contig17106___1_nrnt	contig17106___1_nrnt	Unknown	
5472	67	60	unmapped	0		0	GACTTAGTGTCGGGGAGCTTCGATCCCATCAGAACAGGACTGCATAGGCGTGGTGAGCTA	5380	0	UF_Msa_CF_119715	contig11618___0rc	contig11618___0rc	Unknown	
5473	67	61	unmapped	0		0	CCCCATGCCCTGCCATTCAAAAACAAGTCTTCTGCTGTCCAGGCGACCAATGGAAACGGC	5382	0	UF_Msa_CF_126603	contig15692___0	contig15692___0	Unknown	
5474	67	62	unmapped	0		0	GATCCAGTGGTGGTACATCAAGGACCACAGAGACTGGCAAAAGAAGCCTGCCCAGATCAG	5384	0	UF_Msa_AF_105567	contig14694___1_nrnt	contig14694___1_nrnt	Unknown	
5475	67	63	unmapped	0		0	CCCTGACTCCAGTAGAGACGCCCGCAGGAGGACCCGGGGCCGACGGCTCAGTGCTGCGCC	5386	0	UF_Msa_CF_127145	contig11279___0	contig11279___0	Unknown	
5476	67	64	unmapped	0		0	GAACCACCGTGTGATCCTGACGCAGGATATTAAATTATAGCTGATTGATTTAATGTTTGG	5388	0	UF_Msa_AF_106076	contig27569___1_nr0nt	contig27569___1_nr0nt	Unknown	
5477	67	65	unmapped	0		0	GAACAAGTCCTTTCACAGCTCTGGTAATGTGCGCCGCCATGTTGCTTTCGATGACGCACT	5390	0	UF_Msa_CF_127555	contig15143___0	contig15143___0	Unknown	
5478	67	66	unmapped	0		0	CACACACCTGTCCTACCTGCAGGAAGAGACAGGTGTGTGATGATGTCAACATTCCTACAA	5392	0	UF_Msa_AF_104296	contig18187___1rc_nrnt-1	contig18187___1rc_nrnt-1	Unknown	
5479	67	67	unmapped	0		0	AAGAGATGACCATACACTGGCAGCCATATCTGGCTATGACTTTTAATAAAAGCCCCTGCT	5394	0	UF_Msa_CF_123733	LMB_S454.18.C1___0	LMB_S454.18.C1___0	Unknown	
5480	67	68	unmapped	0		0	CAAAGACGTGATAGGAGACGAAATCTGCTGCTGGTCCTTTTATGGTCAGGGTCGCAAGCT	5396	0	UF_Msa_AF_100900	contig02587___1_nrnt	contig02587___1_nrnt	Unknown	
5481	67	69		1028	E1A	0		418	1	(+)E1A_r60_a135	E1A_r60_a135	E1A_r60_a135		CONTROL
5482	67	70	unmapped	0		0	TCGGCTCCGTACCTGGACAGTTTGATGACGCAGAGGAGGAGAACAGCGGCCAATCAGAGA	5399	0	UF_Msa_CF_125176	contig02964___0rc	contig02964___0rc	Unknown	
5483	67	71	unmapped	0		0	ATTCAGAGAGCGATGCACAGTAAACAGAGAGACATAGTGGCATGGTTGATGATTGAGGTG	5401	0	UF_Msa_CF_118492	contig19323___0rc	contig19323___0rc	Unknown	
5484	67	72	unmapped	0		0	GATTCTCTTTTGGAAGACGGGAATTGCAAGGTTAAAAGAATCACAGCAACTACAGATGGA	5403	0	UF_Msa_CF_120846	contig18648___0rc	contig18648___0rc	Unknown	
5485	67	73	unmapped	0		0	TAACACACAAAGAGGTCTTGGAAAATGTATCGGGAGAAGACGTGGACATGGAGTCCTCTA	5405	0	UF_Msa_CF_121544	contig30877___0	contig30877___0	Unknown	
5486	67	74	unmapped	0		0	ACCCCACATCCCTCCTTACTGGCAGCTGTGAGCGTGAGTAGGTCTGTGTGTGTAATCCAG	5407	0	UF_Msa_CF_124931	contig17419___0	contig17419___0	Unknown	
5487	67	75	unmapped	0		0	AAATTATGATGAGGAAGGAGCATGGCCTGTCCTCATTGATGACTTTGTGGAGTTTGCACG	5409	0	UF_Msa_AF_104109	contig32545___1_nrnt	contig32545___1_nrnt	Unknown	
5488	67	76	unmapped	0		0	ATTAAGACTTTGCGGGAGAACCCGGCAAACTGGCCAAAAAAGAAAGGAAAAAACCAAAGG	5411	0	UF_Msa_CF_127779	LMB_Sanger.24.C3___0	LMB_Sanger.24.C3___0	Unknown	
5489	67	77	unmapped	0		0	CTGCTGAAAAAGACGGAGGTGGACATGTGCTTACATCCACTGCTGCAGGAGATCATGAAG	5413	0	UF_Msa_AF_101384	contig28896___1_nrnt	contig28896___1_nrnt	Unknown	
5490	67	78	unmapped	0		0	GAGGGATCGTGGAGCATTCCAATAGTGCTTGCAGTGAACTGGCAACTTCGTCCGGGGTTA	5415	0	UF_Msa_CF_118313	contig18720___0	contig18720___0	Unknown	
5491	67	79	unmapped	0		0	GTAGAATTTGGACGTTCTCTGCGAAAGACATCCGCTGCCTCCCATCATCCCCTGCCATCG	5417	0	UF_Msa_CF_118798	contig08635___0rc	contig08635___0rc	Unknown	
5492	67	80		0		0		485	1	RC5	RC5	RC5		CONTROL
5493	67	81	unmapped	0		0	ATGAAAATGGCTGCTATCCATTGGATGGTAGGATACCTGTGTATGAAGTGCCATACCAAG	5420	0	UF_Msa_AF_100433	contig23698___1rc_nrnt0	contig23698___1rc_nrnt0	Unknown	
5494	67	82		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
5495	68	1	unmapped	0		0	AATCTCAAATTTTCACCTTTTTTCTATCACATTTGTAAAATTGAAATTAGTTTCCAGTCT	5268	0	UF_Msa_AF_108139	contig09130___1_nr0nt1	contig09130___1_nr0nt1	Unknown	
5496	68	2		1028	E1A	0		799	1	(+)E1A_r60_n9	E1A_r60_n9	E1A_r60_n9		CONTROL
5497	68	3	unmapped	0		0	AGAGCTACACAAAACACAGGAGGAGAAGGCCGCTCTCCTCTCGGATCTGGCATCTGTCAG	5271	0	UF_Msa_AF_105457	contig14725___1rc_nrnt0	contig14725___1rc_nrnt0	Unknown	
5498	68	4	unmapped	0		0	CTTACATGCTGCCGTTCGCGGGCTGCATGCACGCAGCGGTCCACATGGATGTGATCTTCA	5273	0	UF_Msa_AF_106049	contig14194___1rc_nrnt0	contig14194___1rc_nrnt0	Unknown	
5499	68	5	unmapped	0		0	ACTAACTGGACGGGCCACGGTGGAAATGTCTCCTCTTCATCCTACAATGCTTAAGGACCA	5275	0	UF_Msa_AF_109460	contig17706___1rc_nrnt	contig17706___1rc_nrnt	Unknown	
5500	68	6	unmapped	0		0	AATTACCAGAATGGAGGTATCAAGGAGAAGAATTCTCCAGAAACATCTGGAGCCTGCGAG	5277	0	UF_Msa_AF_108986	contig25656___1_nr0nt	contig25656___1_nr0nt	Unknown	
5501	68	7	unmapped	0		0	TCTTAGTGGAGGGAGGGACTAGACGTAGTCTTGGACATGGACTCTGAATGGTCAGGTGGC	5278	0	UF_Msa_CF_125019	contig03226___0rc	contig03226___0rc	Unknown	
5502	68	8	unmapped	0		0	ATGGGAGCTGGGGGAGCAAAGGGCGACAGCAACGACCCAGCTCACCTCTACACAGTAGTG	5280	0	UF_Msa_AF_105181	contig05200___1_nrnt	contig05200___1_nrnt	Unknown	
5503	68	9	unmapped	0		0	TGTGCGTCTTTACTAAATTCCACCTAGAGATGGCGACCACCATCAGATTTGGAACCACTA	5282	0	UF_Msa_AF_101508	contig28770___1_nr0nt	contig28770___1_nr0nt	Unknown	
5504	68	10	unmapped	0		0	GTGGCCTGTTTGTCCGGAAAGTTTCAAAGAACGCCATCATCCCCTTCCTCACGTTGCTAC	5284	0	UF_Msa_CF_124128	contig14217___0rc	contig14217___0rc	Unknown	
5505	68	11	unmapped	0		0	CAACTCTTTTCAGGGTTTCTTTGTGTCCATTATCTATTGCTACTGCAACGGAGAGGTCCA	5286	0	UF_Msa_AF_102434	contig04977___1_nrnt	contig04977___1_nrnt	Unknown	
5506	68	12	unmapped	0		0	TTTTAATCAAGTGGGAAAAGAGTGAAGAGAGATTCGGGGAGCATCAGGAGAACACAAGTA	5288	0	UF_Msa_CF_127025	contig28564___0rc	contig28564___0rc	Unknown	
5507	68	13	unmapped	0		0	TGTACCAAGAGAAAGCTCTCTGATACTGCAGCCGTGACCGAGTGTGATGCCAAGTTATCT	5290	0	UF_Msa_CF_126365	contig31419___0	contig31419___0	Unknown	
5508	68	14	unmapped	0		0	TACACTGAGGGTTAAAGTTGTGGACTGGATGAAAGGACAGACTTGTGGACTCTGTGGAAA	5292	0	UF_Msa_AD_200180	AF169287	AF169287	Unknown	
5509	68	15	unmapped	0		0	CCTAAGGCTAACAAAATCATAGAGCACAGACGCAAATATGAGCGCAAAAGGGAAGAGAAG	5294	0	UF_Msa_AF_107947	contig14399___1_nrnt	contig14399___1_nrnt	Unknown	
5510	68	16	unmapped	0		0	CATTTGCGACTAAGAAGAACAGCTGAAATGATGAGCTGATTAGTTGATTGACATTAACGT	5296	0	UF_Msa_CF_120261	contig04927___0rc	contig04927___0rc	Unknown	
5511	68	17	unmapped	0		0	TTTTCAGAGTTGGCCTATGCTCAGTTAGCTTATGGTGCTTCCATTGTTTCCTTCCTGGGT	5298	0	UF_Msa_AF_102253	contig01454___1rc_nr1nt0	contig01454___1rc_nr1nt0	Unknown	
5512	68	18	unmapped	0		0	TACCATCACTGACAGAGAGCCGGCCTTGGACTTCCTCTCTGCCAACGTGAAGGCAAACCT	5300	0	UF_Msa_AF_102212	contig30763___1rc_nrnt-1	contig30763___1rc_nrnt-1	Unknown	
5513	68	19	unmapped	0		0	TACTACGGGGTGATCAGCATCGGCACCCCTCCACAGGACTTCACTGTGCTTTTTGACACC	5302	0	UF_Msa_AF_104850	contig07093___1_nrnt	contig07093___1_nrnt	Unknown	
5514	68	20	unmapped	0		0	GACTGTCTCTACAGCACCGAGGTACTCCAATCAAACACCAGCCACATGAACGGCAAAGCC	5304	0	UF_Msa_AF_103448	contig10845___1rc_nrnt0	contig10845___1rc_nrnt0	Unknown	
5515	68	21	unmapped	0		0	TCTACGGAGTCAGAAAAGCATGAAGTTACTGATGTTGAACAACTGAAAAGGACGAGCCCA	5306	0	UF_Msa_CF_121988	contig15456___0rc	contig15456___0rc	Unknown	
5516	68	22	unmapped	0		0	AGTATATCCCACTTTCTCTGCCCAAAAGATTCACTGCCTCAGCACTTTAAAGAGTACCTG	5308	0	UF_Msa_AF_109573	contig11793___1_nrnt0	contig11793___1_nrnt0	Unknown	
5517	68	23	unmapped	0		0	TTGTCTCTGGCCGCCTTGGCCGTGCTCTACGAGCTACTGGACTGTGGGTGCTGTGCCAAA	5310	0	UF_Msa_CF_121190	contig06266___0rc	contig06266___0rc	Unknown	
5518	68	24	unmapped	0		0	GGGGACGATCAGAAAACGTTTAGAAGACTTTTCTCGGAATGTTTTATTTGACCAGAGTCG	5312	0	UF_Msa_CF_123397	contig17834___0rc	contig17834___0rc	Unknown	
5519	68	25	unmapped	0		0	CTGCGCACATGGTCGACATTGTTACCGAGGAGATGCCAGAGAATGCCTTACCCAGTGACG	5314	0	UF_Msa_AF_108587	contig25562___1rc_nrnt	contig25562___1rc_nrnt	Unknown	
5520	68	26	unmapped	0		0	ATTGTAATCCAGCAAGATGATGAGATTCGGCTGAAGATTGTGGGAACAAGAGTGGACAAG	5316	0	UF_Msa_AF_102148	contig22328___1rc_nr0nt1	contig22328___1rc_nr0nt1	Unknown	
5521	68	27	unmapped	0		0	ATTTTAAAATTAAGATGAAGCAAAATGACAGACAGCAAGTTACTTCTTGTAGGTAGTTGG	5318	0	UF_Msa_AF_108793	contig21945___1_nr0nt	contig21945___1_nr0nt	Unknown	
5522	68	28	unmapped	0		0	ACAACAAGCTCTCGCGCTGCCAGCCCATCTCTGTTGGATCTTGTGGAGATCGAGAAAAAA	5320	0	UF_Msa_CF_121381	contig06002___0	contig06002___0	Unknown	
5523	68	29	unmapped	0		0	TAAAATGATCCCATGCCTCTTTGCAACTTCTGGGAATGATGGCATGTAATCAGAGGCCAC	5322	0	UF_Msa_CF_127574	contig07529___0rc	contig07529___0rc	Unknown	
5524	68	30	unmapped	0		0	CATCCTGCCAACACGCATCCTGCCAACACGCATCCAGCCAACACGCATCCTGCCAACACG	5324	0	UF_Msa_CF_119695	contig01747___0	contig01747___0	Unknown	
5525	68	31		1028	E1A	0		643	1	(+)E1A_r60_a22	E1A_r60_a22	E1A_r60_a22		CONTROL
5526	68	32	unmapped	0		0	GACATCACACAGTTGAAGATAGATCAACAACCCATTTGCAAAAGGCTTCCGAGACAACTA	5327	0	UF_Msa_AF_104022	contig22377___1rc_nrnt	contig22377___1rc_nrnt	Unknown	
5527	68	33	unmapped	0		0	AGAGAGCCCCTGGCAGGGAGCCCATACTACTGGGAGGTGGAGTGGACTGGCCAGAAGATT	5329	0	UF_Msa_AF_109841	contig22040___1rc_nrnt0	contig22040___1rc_nrnt0	Unknown	
5528	68	34	unmapped	0		0	ACTAGTCAGTACATCAAGTTCATCACTGACACACAGCTTCGATTGGAGAACGAGGAGATG	5331	0	UF_Msa_AF_103590	contig00540___1_nr0nt1	contig00540___1_nr0nt1	Unknown	
5529	68	35	unmapped	0		0	CTTTGAAGAAGCAGCACTTGAGAAAACTGGAGAGAGATACTGAAAGTCAGACAGAAATAG	5333	0	UF_Msa_CF_124316	contig12013___0	contig12013___0	Unknown	
5530	68	36	unmapped	0		0	TCATCACCATTCCTGAGTACACAGCCGACAACAAGAGCATGATCATATCTTTGGATGTTT	5335	0	UF_Msa_AD_200140	AY517845	AY517845	Unknown	
5531	68	37	unmapped	0		0	TTTCACAAGAAAAAGGACTCTTTGCCGAGGAAATGACTCCTCATCAAGAGGGACTCAGCA	5337	0	UF_Msa_CF_118223	contig11845___0rc	contig11845___0rc	Unknown	
5532	68	38		1028	E1A	0		643	1	(+)E1A_r60_a22	E1A_r60_a22	E1A_r60_a22		CONTROL
5533	68	39	unmapped	0		0	TTCTGGCAGAAGTCAAGCCATCATGACGGAGGTTTTGCGTGAATACTCAACGATCCGGCC	5340	0	UF_Msa_CF_124271	contig15002___0rc	contig15002___0rc	Unknown	
5534	68	40	unmapped	0		0	TTAGCGCGCTGCTAACTCTAGCTCCTATTAGCTAGTTAGCTCAGTTAGCGGTCTTATTAG	5342	0	UF_Msa_AF_106770	contig22936___1_nr0nt	contig22936___1_nr0nt	Unknown	
5535	68	41	unmapped	0		0	GTTACATGACGGCAGAGAACATGCTAAAGGGTAGAGCCATCTCTAAACACGACCTGGGAC	5344	0	UF_Msa_AF_108079	contig32456___1_nrnt	contig32456___1_nrnt	Unknown	
5536	68	42	unmapped	0		0	CTGCAGAGGCGCACAGAGGAGCTTCTAGCGGACGTTGGATTCACAGTTTGGAACATGCTA	5346	0	UF_Msa_CF_121515	contig14665___0	contig14665___0	Unknown	
5537	68	43	unmapped	0		0	ACTGTCGGCCAGCAGACACCTGCAGAAACTAGAACACGCAGTATCGGAATCACGGGCAAC	5348	0	UF_Msa_CF_124881	contig23082___0rc	contig23082___0rc	Unknown	
5538	68	44	unmapped	0		0	TGTGTCAGCTGTGCAAGGGAGACTGCTCCAGGTCCCACAAGGAGCCTTACTATGACTACG	5350	0	UF_Msa_AF_110278	contig31464___1rc_nrnt	contig31464___1rc_nrnt	Unknown	
5539	68	45		1028	E1A	0		571	1	(+)E1A_r60_a107	E1A_r60_a107	E1A_r60_a107		CONTROL
5540	68	46	unmapped	0		0	CCAGGGTTGTGGTTATGAATCATAACAGAAGGTAACAATCATGAAGAAGGTGTTTGTGGG	5353	0	UF_Msa_AF_100660	contig04657___1_nr0nt	contig04657___1_nr0nt	Unknown	
5541	68	47	unmapped	0		0	TGGAAATGGCTGAGCTGAGGAGGAAAAGACAGAAAGAGGAGGGTGTTTTTCCATTTTTTG	5355	0	UF_Msa_AF_104019	contig06833___1rc_nrnt-1	contig06833___1rc_nrnt-1	Unknown	
5542	68	48	unmapped	0		0	GAAAAACTACTGATATCCGCACAGTTGGTGCGTAGAAGACCTTAAAGGACACCATGAGGT	5357	0	UF_Msa_CF_125875	contig30792___0rc	contig30792___0rc	Unknown	
5543	68	49	unmapped	0		0	GCTGTCAAAGCCACTATGCACAGTGTGGACACCTACAAGGCCTTCTACAAGAGTTACGTT	5359	0	UF_Msa_AF_107962	contig18579___1rc_nrnt	contig18579___1rc_nrnt	Unknown	
5544	68	50	unmapped	0		0	ACTGGCAGAAGTACTACAGGGTTGAGCCACTCAACTTCAACGGAACTGAAGAACAAAAAA	5361	0	UF_Msa_AF_103668	contig03726___1_nrnt	contig03726___1_nrnt	Unknown	
5545	68	51	unmapped	0		0	CTACCGGGTGGAGAACCCCTTCGACTTCATGGAGAACATCTCTCTGGAGGGAAAGACCAA	5363	0	UF_Msa_AF_103114	LMB_S454.397.C1___1rc_nrnt	LMB_S454.397.C1___1rc_nrnt	Unknown	
5546	68	52	unmapped	0		0	TGGATCTAAATGATTAGTTTTATGTTCAAGGCTTTAATGGTACTGACTTTTGGAGTGATT	5365	0	UF_Msa_AF_101401	contig24433___1_nr0nt1	contig24433___1_nr0nt1	Unknown	
5547	68	53	unmapped	0		0	AGTCAGATGAGTGTGAGCGGGCAGGACGGTTTACCTATAAGTAATGGAAAGATGTCCAAA	5367	0	UF_Msa_CF_125793	contig23819___0	contig23819___0	Unknown	
5548	68	54	unmapped	0		0	TGTAAAGTCACTAATAGCCAAAGCGTGTTGGTTCTGGTGCTGACTTAACTGCAACACACC	5369	0	UF_Msa_CF_124095	contig00893___0	contig00893___0	Unknown	
5549	68	55	unmapped	0		0	AAACCCAAGCAATCCCAAGATAGATTTCTCCTGAGATATAAAATAAAATGTGTGTACTGG	5371	0	UF_Msa_CF_122398	contig32243___0rc	contig32243___0rc	Unknown	
5550	68	56	unmapped	0		0	TGTAGGAGATCTGGGCGTCGGGAACGACACGCACGTAGTTGTGTATGACACCAGCGACTT	5373	0	UF_Msa_AF_100604	contig24793___1_nrnt	contig24793___1_nrnt	Unknown	
5551	68	57		0		0		5375	1	DCP_22_9	DCP_22_9	DCP_22_9		CONTROL
5552	68	58	unmapped	0		0	TTCTAAAACTCTGCAGAACAAGGATGAATACCCCAAAGATGAAACACGGCGGGTTGACTG	5377	0	UF_Msa_CF_118915	contig23877___0rc	contig23877___0rc	Unknown	
5553	68	59	unmapped	0		0	AATCATGACGCTTGCAATATCGAGCGTCCCGAGTGAATTTGTCAGTACGACATCACCTAT	5379	0	UF_Msa_CF_125915	LMB_S454.sd.575.C1___0	LMB_S454.sd.575.C1___0	Unknown	
5554	68	60	unmapped	0		0	GAAATACCTCCACCATAAAACAACTACGCCCAAAAACATGTTGTCTCAATTGTATTTGAT	5381	0	UF_Msa_CF_120399	contig28419___0rc	contig28419___0rc	Unknown	
5555	68	61	unmapped	0		0	TGATCAAGTGCTGCATTACAAAGTTAACGAGCTGTGCAGTAGTGAACTCGCAAAGTGGAG	5383	0	UF_Msa_AF_102696	contig11871___1rc_nr1nt0	contig11871___1rc_nr1nt0	Unknown	
5556	68	62	unmapped	0		0	AGTCTGGAGACGACTTGACTGCAAGAGAAGTTCACAGGCAACAAACTAAACAGGAAACAA	5385	0	UF_Msa_CF_124478	contig14961___0	contig14961___0	Unknown	
5557	68	63	unmapped	0		0	GGCACAGAGAGGGACACTGTCGCACTTCAGTCTTTCTATAACGTGGTCCACCACAACCTG	5387	0	UF_Msa_CF_120646	contig26839___0	contig26839___0	Unknown	
5558	68	64	unmapped	0		0	AAGATGATGGTAGAAGATTATCATCTGAAAGCTATCATCCAAAAAGCTGCGTGTCACAGG	5389	0	UF_Msa_CF_119880	contig18672___0rc	contig18672___0rc	Unknown	
5559	68	65	unmapped	0		0	TGGAAGGGAAACGCAGCACCTACCAGGTCTACAAACCCGGGCACACCATCCGTCCAAAAA	5391	0	UF_Msa_AF_105515	contig23943___1rc_nrnt0	contig23943___1rc_nrnt0	Unknown	
5560	68	66	unmapped	0		0	AACAGATTCGGTACCATTCGTCCCAGTTATACATTTGCAGTACATGCAGTCCACATTACG	5393	0	UF_Msa_CF_123136	contig31174___0rc	contig31174___0rc	Unknown	
5561	68	67	unmapped	0		0	AATCTAAAGTGAACGCGTACCAAATGAATGGAAGCTTTCCTGCTACTGAGTGCCCCTAAT	5395	0	UF_Msa_CF_124848	contig01988___0rc	contig01988___0rc	Unknown	
5562	68	68	unmapped	0		0	TCACTTCGATACGCCTGGAATATGTAATCAATCACATAAACACACAGATGTTTGCCAGCC	5397	0	UF_Msa_CF_120718	contig11162___0rc	contig11162___0rc	Unknown	
5563	68	69	unmapped	0		0	GGGATTTTGGTACAGTTGTGTCGTATTTGTATGTTTCCAGTGTTATTCATACAGTAATGA	5398	0	UF_Msa_AF_102366	LMB_S454.sd.190.C1___1_nr0nt1	LMB_S454.sd.190.C1___1_nr0nt1	Unknown	
5564	68	70	unmapped	0		0	TTAGGTGAATCATGAGTCCCATCTCCCTGTCCCGGTGCTCGACTCTGTCCCATACCATGC	5400	0	UF_Msa_CF_119272	contig17901___0rc	contig17901___0rc	Unknown	
5565	68	71	unmapped	0		0	AGGGGGTGCGGGAGGTGTCTACCCTCCTCTCACATCACCTCCGCCAAATTATCATGCTAA	5402	0	UF_Msa_AF_107894	contig26853___1_nrnt0	contig26853___1_nrnt0	Unknown	
5566	68	72	unmapped	0		0	AGGTCTACTTGCTTAGCATCGGGGCGCTGCCAAAACTTCTGCAGCTGACAGACTCAGACC	5404	0	UF_Msa_AF_100256	contig30628___1_nrnt	contig30628___1_nrnt	Unknown	
5567	68	73	unmapped	0		0	GTATTGCTGTATTTTTCTGTGCATTAAGAGACATGATAGACGCTGCAACTCAACATGACC	5406	0	UF_Msa_AF_106208	contig17509___1_nr0nt1	contig17509___1_nr0nt1	Unknown	
5568	68	74	unmapped	0		0	AAGTTTGTACTGAAGGGCTTTTCCCAGGAAGGCAGAGATCTGACTGACGCTGAGACAAAA	5408	0	UF_Msa_AF_100021	contig14497___1rc_nrnt	contig14497___1rc_nrnt	Unknown	
5569	68	75	unmapped	0		0	TTCAGAAGAACAAGAAGAAGGTCTTCCTGCCAGAGACTATCATTTGTGCCAGTCCGCAAT	5410	0	UF_Msa_CF_126682	contig15936___0rc	contig15936___0rc	Unknown	
5570	68	76	unmapped	0		0	TCATTCTCCTGCGGGTTGAGAACGACCGTGTAATTGATTACGCTTTGATGGCATGTATCA	5412	0	UF_Msa_CF_119060	contig16975___0	contig16975___0	Unknown	
5571	68	77	unmapped	0		0	TACATAGGGTTTCTCAGCACGTACACATACATTCATGGAAGTGGCGACTGGAGAACTACA	5414	0	UF_Msa_CF_126292	contig01600___0rc	contig01600___0rc	Unknown	
5572	68	78	unmapped	0		0	TCTTAACTGGAAAGAGAAAAGCCATTTCCAAGTTCAACAGCGGTTTAGTGTTTCTCACAC	5416	0	UF_Msa_CF_120899	contig27588___0	contig27588___0	Unknown	
5573	68	79	unmapped	0		0	TTTGATCTGCCAGCCTATATTCAAGAACGTGACAAAGACCAAGTATCCCACTCAAATGGG	5418	0	UF_Msa_AF_102861	contig09929___1rc_nr1nt0	contig09929___1rc_nr1nt0	Unknown	
5574	68	80	unmapped	0		0	TTTGCTTTGTGAGGATCCTGTGTTCTGTATGTGAAAATGGACGGTGCAGAGCATGTGCAT	5419	0	UF_Msa_CF_118058	contig08976___0	contig08976___0	Unknown	
5575	68	81	unmapped	0		0	AAGTGAGGGCCGAGCTCTGCTTCTGAAGGAGTGGAGCCGATACAAACAGGAGCAGCACAT	5421	0	UF_Msa_AF_103647	contig30020___1_nrnt	contig30020___1_nrnt	Unknown	
5576	68	82	unmapped	0		0	TGTAGTAGCACCGAGTAAGAACACTGGTGGAGAATCAGCAGTAAACAATTTCTTCCCTCT	5422	0	UF_Msa_CF_124245	contig00655___0	contig00655___0	Unknown	
5577	69	1	unmapped	0		0	ATAGATGGCCACAGTGGTGCCTGTTTCGCCTTTGGGGTGTTCGTCGATGGACACTTCCTG	5423	0	UF_Msa_AF_106043	contig24228___1_nrnt0	contig24228___1_nrnt0	Unknown	
5578	69	2	unmapped	0		0	CAGAGAATCGTACGTTTCAATGTCAATGTGGCTTTTTCCTAGGTCTGCTGCTAGACATCA	5425	0	UF_Msa_CF_120229	contig04446___0	contig04446___0	Unknown	
5579	69	3	unmapped	0		0	TTTACGGCACTTCGCAAATACAGCGCTTTAGTTCATGATACCGAGAGGCTCGGAACAATA	5427	0	UF_Msa_CF_120047	contig00094___0	contig00094___0	Unknown	
5580	69	4	unmapped	0		0	TCCCAAGGTGCCCTCTTCTCACAAGCCTCACACTGTAGTGATTTCCTGCGAGGAGGACCT	5428	0	UF_Msa_AF_109395	contig04334___1rc_nrnt0	contig04334___1rc_nrnt0	Unknown	
5581	69	5	unmapped	0		0	ACCGCACAGCGCATCGCCTGGGCACGTTTTCACAATGCTGGGCAGAACTTGGTGGCTCCT	5430	0	UF_Msa_AF_100052	contig05229___1rc_nrnt0	contig05229___1rc_nrnt0	Unknown	
5582	69	6	unmapped	0		0	AACAAATAGAAGAAGTACAGCAGGGCAGCAATGGCACAGAGTCACAGACTACCATCATTC	5432	0	UF_Msa_AF_102837	contig03575___1rc_nrnt	contig03575___1rc_nrnt	Unknown	
5583	69	7	unmapped	0		0	GGCACAGACAAGTACAAGACAATCCACAATCAGATACTTCAAGAGTATCGTAAAATAAAA	5434	0	UF_Msa_AF_102606	contig13331___1_nrnt	contig13331___1_nrnt	Unknown	
5584	69	8	unmapped	0		0	TTTCTAGTTGGAGATCTTAATCCAAGATTCGCCATCTGTTGTCTACAGCAACCGCAGGAC	5436	0	UF_Msa_CF_119460	contig19260___0rc	contig19260___0rc	Unknown	
5585	69	9	unmapped	0		0	CCCGGTGACGTTTGGACCAGAACCCTTTGTTTTATGTTATTAACTTTATAAAGTTTTCTT	5438	0	UF_Msa_CF_125475	LMB_S454.sd.191.C2___0rc	LMB_S454.sd.191.C2___0rc	Unknown	
5586	69	10	unmapped	0		0	TTACACTCAGTGAACACACTGAACACGATGGAAAACAGTGATCTGTCTGGCAGTGTTACC	5440	0	UF_Msa_CF_119430	contig25598___0rc	contig25598___0rc	Unknown	
5587	69	11	unmapped	0		0	GTGAATTCAAATCTTTACTAATGAGTGAAGAGAAATGTGGTGATTATCTATGTGGTATCT	5442	0	UF_Msa_AD_200102	LMB_Add_125	LMB_Add_125	Unknown	
5588	69	12	unmapped	0		0	GACCATCCGCATTGAAGGAGGAGCTGGTATTGTTGGTAGCCAGAATCAAGATCCGCCTGG	5444	0	UF_Msa_CF_121732	contig10405___0	contig10405___0	Unknown	
5589	69	13	unmapped	0		0	CATACCATTTCTCTGAACTGTCAGCAGGAAACACATACTCAAATATCAAATCATTACATG	5446	0	UF_Msa_CF_123877	contig29513___0rc	contig29513___0rc	Unknown	
5590	69	14	unmapped	0		0	TGGCTTGCAGAGCAAATGCTGAATACATGTCACCTTCTGGTAAGATTCCCTTTATCCACG	5448	0	UF_Msa_AF_104495	contig12983___1rc_nrnt	contig12983___1rc_nrnt	Unknown	
5591	69	15	unmapped	0		0	CCTGTCTGCTCTGCAGCTTGAAGCCATCACGTATGCAGTTCAGCAACATGAGACATTCCT	5450	0	UF_Msa_AF_101890	contig04717___1_nrnt	contig04717___1_nrnt	Unknown	
5592	69	16	unmapped	0		0	CAAACCTTACTTCTTTTGTTGATCTAGATCAGACTTCAGTGACAAAGAATCCAAGTCAAT	5452	0	UF_Msa_AF_101684	contig27658___1_nr0nt1	contig27658___1_nr0nt1	Unknown	
5593	69	17	unmapped	0		0	CAAGGTGGTCATCACCAGGCTAAAGCTGGATAAGGACCGCAAGAAGATCCTGGAACGCAA	5454	0	UF_Msa_AF_101324	contig19138___1rc_nrnt-1	contig19138___1rc_nrnt-1	Unknown	
5594	69	18	unmapped	0		0	GTGGGGGACGAGGATGGAGAACCCAACGCCGCAGAGCTGAGGCGCCGCCGCCTTCGCAAG	5456	0	UF_Msa_CF_125100	contig22643___0	contig22643___0	Unknown	
5595	69	19	unmapped	0		0	CCCCGGAGATCCTGCTGGGACAGAAATCAACCATCACTTCAGTAACTTCCACAGCTACAG	5458	0	UF_Msa_CF_120163	contig19913___0	contig19913___0	Unknown	
5596	69	20	unmapped	0		0	TGACTTCTTTTAACTTAACCTGAACTAACTTGCATAACCATGATGACGAAGGTCCGGTAC	5460	0	UF_Msa_CF_120765	contig01341___0	contig01341___0	Unknown	
5597	69	21	unmapped	0		0	TAGGATAACATGCACAGATGAAACTGAATACACAATCCTGAGACACGCAACGGGGATAGG	5462	0	UF_Msa_AF_102514	contig06356___1rc_nrnt-1	contig06356___1rc_nrnt-1	Unknown	
5598	69	22	unmapped	0		0	ACTGTGGCTTTGATAGAGTTCTGCTATAAGTCACGGCAAGAAACTAAAAAACTGAAGCTG	5464	0	UF_Msa_AF_109228	LMB_S454.sd.447.C1___1rc_nrnt	LMB_S454.sd.447.C1___1rc_nrnt	Unknown	
5599	69	23	unmapped	0		0	TGACACAGATGACAGCTGATTGGCAGCCAACCAGGTCCAGGCTTCGTTCTGAGTCTCCTC	5466	0	UF_Msa_CF_118711	contig24075___0rc	contig24075___0rc	Unknown	
5600	69	24	unmapped	0		0	AAGTCTCCAAAGCTGCTCTTGCCTTTGGACTTCTTGGCCACTGCTCCTCCGCTGGTGGAA	5468	0	UF_Msa_CF_124080	contig20952___0rc	contig20952___0rc	Unknown	
5601	69	25	unmapped	0		0	ATCCTCTGCTGACCGCACTGTCACACTCTGGACACACAACCCATAGCACATGCACGCACA	5470	0	UF_Msa_AF_108701	contig14828___1_nr0nt1	contig14828___1_nr0nt1	Unknown	
5602	69	26	unmapped	0		0	ATCTACTGTGTTAGTGGAGATAAAGAGATCACTTCTGCAGACTGTCCCTCCTTGTCACAT	5472	0	UF_Msa_CF_127189	contig28555___0	contig28555___0	Unknown	
5603	69	27	unmapped	0		0	TTGGAGCAGTTTGCCCGGCATCAGAGAATCTCCAGTTGCCCCTCTTTCCACCTCAGCATC	5474	0	UF_Msa_CF_126722	contig14485___0rc	contig14485___0rc	Unknown	
5604	69	28	unmapped	0		0	TACACAGTCCAGTTTACAACATCATTCAAGAGAGAAAACTGCAGTATGGTAACTTTATAC	5476	0	UF_Msa_AF_109580	contig14360___1_nr0nt1	contig14360___1_nr0nt1	Unknown	
5605	69	29	unmapped	0		0	TGGTTCAACATTCAACAGTATACGTCACCAATGACGATGAGTTTTGACATCACAAAAGCC	5478	0	UF_Msa_CF_123644	contig21950___0rc	contig21950___0rc	Unknown	
5606	69	30	unmapped	0		0	ATGATGGATTCACTTTGCCCCCAGAACAAGTAACAGTAGGATGGAGATATGACCAGACTG	5480	0	UF_Msa_AF_108301	contig09560___1_nrnt	contig09560___1_nrnt	Unknown	
5607	69	31	unmapped	0		0	AAGGTGACTCCTCTGTCTCTCTTTCCTGTCTGCCCCACGCTGTCTTCTGGCTACTACTTT	5482	0	UF_Msa_CF_122314	contig23500___0rc	contig23500___0rc	Unknown	
5608	69	32		0		0		5484	1	DCP_22_6	DCP_22_6	DCP_22_6		CONTROL
5609	69	33	unmapped	0		0	CGGACGCGGCAGAGGACAGCAGCCTCAGTAAATTTCACTCACTCTTTCTGTACAATAAAG	5486	0	UF_Msa_AF_109391	contig15576___1_nr0nt1	contig15576___1_nr0nt1	Unknown	
5610	69	34	unmapped	0		0	GGCAAGCAAAAGATTTATTTTGCTGATCAGGCCCAGTTCAAAGAAGTGAAGGATGTAGAC	5488	0	UF_Msa_AF_109108	contig12934___1rc_nr1nt0	contig12934___1rc_nr1nt0	Unknown	
5611	69	35	unmapped	0		0	TAATGAAGAGCTTTAAGGAGTTCCTGCTGTCCTTGGATGATTCTGTGGATGAGACTGAGG	5490	0	UF_Msa_AF_102582	contig26862___1rc_nrnt	contig26862___1rc_nrnt	Unknown	
5612	69	36	unmapped	0		0	ATTACAATTTAAGGGCCAAAACCCTTCCATCAGAAATCGCAATGTGTGCTGCTTCACCCC	5492	0	UF_Msa_AF_103755	contig14641___1rc_nrnt-1	contig14641___1rc_nrnt-1	Unknown	
5613	69	37	unmapped	0		0	GGCCAACGAGCCTTGATGCCACAGAGGTGGGTACCAAAGAAATGCCTGTGATCCACACAG	5493	0	UF_Msa_CF_122787	contig18553___0rc	contig18553___0rc	Unknown	
5614	69	38	unmapped	0		0	GTCTGGCAACCTCTACGAGTTCTATGTCTTTGATTTCTACTTGGAGCAAATCTCTAGTGG	5495	0	UF_Msa_CF_124561	contig30173___0	contig30173___0	Unknown	
5615	69	39		0		0		5497	1	DCP_1_0	DCP_1_0	DCP_1_0		CONTROL
5616	69	40	unmapped	0		0	GTGGTGCCCGATGAGCCGCTGGATACAAGTCCTCTGCTCACCCCCTTGTCTCAAACTTCC	5499	0	UF_Msa_CF_124174	contig18328___0rc	contig18328___0rc	Unknown	
5617	69	41	unmapped	0		0	TATTTTGTACACTGCACATTTGGGAATGTTCCCAGCTTGTTAGCTTGGACAGTTATACGT	5501	0	UF_Msa_AF_105313	contig06109___1_nr0nt1	contig06109___1_nr0nt1	Unknown	
5618	69	42	unmapped	0		0	AGAAACTGAGGGTTTGTGCACACAGGAGCCGTCTCGACCCGTTACCCCCATGAGTTCCAG	5502	0	UF_Msa_CF_120708	contig18109___0rc	contig18109___0rc	Unknown	
5619	69	43		1028	E1A	0		390	1	(+)E1A_r60_3	E1A_r60_3	E1A_r60_3		CONTROL
5620	69	44	unmapped	0		0	CTGGATGCACGAGTAACTTCACCGTACAGAACCGCCAACAGGCCTGCATCGAAGAGATAA	5505	0	UF_Msa_CF_122243	contig26567___0	contig26567___0	Unknown	
5621	69	45	unmapped	0		0	CGTGGGAACACCTCTTAACAACTTCTGTAATACAGTGTTTTCATCACTTTCTTTTGTATT	5507	0	UF_Msa_CF_121810	contig32859___0	contig32859___0	Unknown	
5622	69	46	unmapped	0		0	ATCTAGACCGTTTTCGTTTTGACAAGAAGGCAGCGACAACAACAAGCAAAGGCGAGGAAA	5509	0	UF_Msa_CF_126692	contig07183___0	contig07183___0	Unknown	
5623	69	47	unmapped	0		0	CACACATGGAACGTTCACTGCAAGGCAAACATTTTCATGAATGAGTATTAAATCTTAATG	5511	0	UF_Msa_AF_105860	LMB_S454.sd.99.C1___1_nrnt	LMB_S454.sd.99.C1___1_nrnt	Unknown	
5624	69	48	unmapped	0		0	CAAGGGCCAGACATCAAGAACGGAAATGTTTGTCGTATCAATTACCAGTTTGGCTGTTCA	5513	0	UF_Msa_CF_123632	contig05827___0	contig05827___0	Unknown	
5625	69	49	unmapped	0		0	AGTCTGTCGACAAGAGGCCCACTGACAGCTCAGCGTCTCCCAGTCCGGATGAGAAGAGGC	5515	0	UF_Msa_CF_124314	contig16458___0rc	contig16458___0rc	Unknown	
5626	69	50	unmapped	0		0	ATGACACTTAAAAATAAGGAGGAGAGGAAAAATGAGGAAGAGGAAAGAGGATAATAGAGA	5517	0	UF_Msa_CF_120473	contig13181___0rc	contig13181___0rc	Unknown	
5627	69	51		130	HybridizationNegative	0		461	1	(+)eQC-41	EQC	EQC		CONTROL
5628	69	52	unmapped	0		0	TATATTTGAGGGACACCATCTCAATCTTCTGGGGAGGGAGGGTAACTTGACAGAAGGAAT	5519	0	UF_Msa_CF_124330	LMB_S454.1085.C1___0	LMB_S454.1085.C1___0	Unknown	
5629	69	53	unmapped	0		0	AATACCAAAATCGCAGAGCCCTGGAGCACCAGAAAAAGGAAGTTTGTGAAATACTCCAAA	5521	0	UF_Msa_AF_102292	contig22970___1_nrnt	contig22970___1_nrnt	Unknown	
5630	69	54	unmapped	0		0	ACAGACCACTGATGGACCCAGGAACCGCTTACGCCAAATAGGAACACGGAGACCCCACTG	5523	0	UF_Msa_CF_118421	contig23991___0rc	contig23991___0rc	Unknown	
5631	69	55	unmapped	0		0	TTTAGGAGGAAGTGTCAATCAAACAGCTCTGCAGCTCCTGGTGAGGGGAGGAGGGAAGGA	5525	0	UF_Msa_CF_118504	contig16174___0rc	contig16174___0rc	Unknown	
5632	69	56	unmapped	0		0	CCTAGAAAATAGAAATGTAATTTTAAACTATCAATAAAGCTGGAGGAGCACGAGGACTTC	5527	0	UF_Msa_AF_104981	contig05394___1_nrnt	contig05394___1_nrnt	Unknown	
5633	69	57	unmapped	0		0	ACTGGCACGTGCATGCCCAGTGTACATGAACGGCCACTAGATGTGCATTTTCAGTCGATT	5529	0	UF_Msa_CF_123806	contig26873___0rc	contig26873___0rc	Unknown	
5634	69	58	unmapped	0		0	TCTTACTGTAAAACCGTGAAGTTTCTTAGGTGGTGAAGAGTGGAGGAAGAAAAACGTACG	5531	0	UF_Msa_AF_109420	contig31836___1rc_nrnt	contig31836___1rc_nrnt	Unknown	
5635	69	59	unmapped	0		0	TGAGTTTATCGGCCTGTTTTTTAAGACAATGATTAACCCTGACATTGCAAAGGATGGAAA	5533	0	UF_Msa_AF_104607	contig30245___1rc_nrnt-1	contig30245___1rc_nrnt-1	Unknown	
5636	69	60	unmapped	0		0	ACTGTGACACCTAAGAACAGTGACACTTGTATCTCCACGTCTTCAAGCCTACTTTGATCG	5535	0	UF_Msa_CF_120275	contig22387___0rc	contig22387___0rc	Unknown	
5637	69	61	unmapped	0		0	ATCACCTTCTCTCCTGCGGGAGTCCTGCTCTTCAAACAGAGGAACGATGGCATCCAGGAC	5537	0	UF_Msa_AF_100738	contig11929___1rc_nrnt0	contig11929___1rc_nrnt0	Unknown	
5638	69	62	unmapped	0		0	TCAGTCTGCGAATTATTGCTGAGTGCCCAGTGTACAAAAGCAAGAGCTTGTGATCTAATA	5539	0	UF_Msa_CF_120367	contig12726___0rc	contig12726___0rc	Unknown	
5639	69	63	unmapped	0		0	GAGGATAAATATAAAAACGTTAGAGGGAGAGTAAGGGTCAGGGGGAAGAAAAAGGATAGG	5541	0	UF_Msa_CF_121778	contig03419___0rc	contig03419___0rc	Unknown	
5640	69	64	unmapped	0		0	ACTTCTACCTGCTGATAATGAACGGATTGAGAGTGTTGTTCACCAAAAGTCTGGCCTTCC	5543	0	UF_Msa_CF_118085	contig22866___0rc	contig22866___0rc	Unknown	
5641	69	65	unmapped	0		0	TGACAGACCTGCAAGCTGCAGTGGTCTACTTGGCATCTGACGCCTCCGACTACATGACAG	5545	0	UF_Msa_AF_102399	contig23526___1rc_nrnt	contig23526___1rc_nrnt	Unknown	
5642	69	66	unmapped	0		0	CACCCTGAAGAAGAAAGTAGAAGAGCTGACTGTGGAGGAATTCTTCAAACTACAGAAGGA	5547	0	UF_Msa_AF_109349	contig00726___1_nr0nt1	contig00726___1_nr0nt1	Unknown	
5643	69	67	unmapped	0		0	AGACTGGATGGGCGCAGCAGGAACAGGAGCAGAGCCAGCACCATCCATCACATCATGACC	5549	0	UF_Msa_CF_121153	contig16891___0rc	contig16891___0rc	Unknown	
5644	69	68	unmapped	0		0	GCATCAACAAAATCTAAAACGCCTACAGACCTTACATAAACAACACATTTGTATCCATTG	5551	0	UF_Msa_AF_101344	contig30886___1_nrnt	contig30886___1_nrnt	Unknown	
5645	69	69	unmapped	0		0	AGATCACTTCATGAAGATATGCGACTTCTCTTCTGGGCTTTCCTTAGCAGGTGGACAAGA	5553	0	UF_Msa_AD_200208	LMB_Add_90_rc	LMB_Add_90_rc	Unknown	
5646	69	70	unmapped	0		0	ACGGAAATTCCATCCTCCCAGGCCCGCCAACAAACGACAACTACCCTCATTACAGCGCTA	5555	0	UF_Msa_AF_108330	contig20053___1_nrnt0	contig20053___1_nrnt0	Unknown	
5647	69	71	unmapped	0		0	TATGACGTCAGGTTGATTGACCAATATGTAGAGGCCTCACTACACTTGTGGGAACTGCTT	5557	0	UF_Msa_AF_106564	contig07296___1rc_nr1nt0	contig07296___1rc_nr1nt0	Unknown	
5648	69	72	unmapped	0		0	ATAAACAGAGGATCAAACAAACTCCTAGCAGACACACGCTGACTTCCAACAGATGCTGCA	5559	0	UF_Msa_CF_125172	contig09486___0rc	contig09486___0rc	Unknown	
5649	69	73	unmapped	0		0	TGAGCAGTGCAGCGATGCGCCTGGTGCAGTTTCATCGCCATGGAGGTGGCATCAGAGTGG	5561	0	UF_Msa_CF_121473	contig32197___0	contig32197___0	Unknown	
5650	69	74	unmapped	0		0	ATATCATTCCAGGAATTCCAAACAATATTCCAGCAGTTTAGAACATTCTAGCATGTGATG	5563	0	UF_Msa_CF_124887	contig01890___0	contig01890___0	Unknown	
5651	69	75	unmapped	0		0	ACATCTGCCGAGCTGCTATAAGCAGCTGCACCACCTATGATGGCATTAACATGCTTCCCA	5565	0	UF_Msa_AF_104175	contig14331___1_nrnt	contig14331___1_nrnt	Unknown	
5652	69	76	unmapped	0		0	CACAATCGGCGAGCAGAGGAGGAGAAAACTATATATACACATACACACGCCTACAAAAAA	5567	0	UF_Msa_CF_122716	contig03571___0rc	contig03571___0rc	Unknown	
5653	69	77	unmapped	0		0	TGATGTCGATCTTTTGGACACCAGAAGGAATTGTGATAAGAGTAACCTGAGGGTGAAGCC	5569	0	UF_Msa_AF_102168	contig30490___1rc_nrnt-1	contig30490___1rc_nrnt-1	Unknown	
5654	69	78	unmapped	0		0	AGCAGCGAATCCAGCCAAAAGCCTCAGGAAAGTCTCAAGAAGAAGAAGCACAATGGCCAA	5571	0	UF_Msa_AF_102518	contig28207___1_nrnt0	contig28207___1_nrnt0	Unknown	
5655	69	79	unmapped	0		0	GCACAACAAGCTTGTGATACACAAGTTGAAAGTGAACAATCTCAATAAAACATTTCACTG	5573	0	UF_Msa_AF_103941	contig29068___1_nr1nt0	contig29068___1_nr1nt0	Unknown	
5656	69	80	unmapped	0		0	TCTTTCTGTACAGTGGTGATCACCACAGAAGAGGCAGTCTACATGGAGATAATGACAAGG	5575	0	UF_Msa_CF_125234	contig11548___0	contig11548___0	Unknown	
5657	69	81	unmapped	0		0	CGGCGTGTTTCAGTGGGTCAGAGGCTGATCCAGGATCAGAACGAGGAGGAGTACCAAAGA	5577	0	UF_Msa_AF_101876	contig00932___1rc_nrnt0	contig00932___1rc_nrnt0	Unknown	
5658	69	82	unmapped	0		0	GAACACTGGCATCATTACTGTGCAGAACTATGCCTCCCATGCCCCTCCCAAGGTGTCACA	5579	0	UF_Msa_AF_104001	contig19504___1_nrnt	contig19504___1_nrnt	Unknown	
5659	70	1	unmapped	0		0	ACAGAGTGCACTTTCCCCCGGCTGGGATTCTTGGAGAAGTCGAGTGACACGCAGGACATA	5424	0	UF_Msa_AF_101247	contig02534___1rc_nrnt-1	contig02534___1rc_nrnt-1	Unknown	
5660	70	2	unmapped	0		0	TTTGAAGAAGAAGGATGATGACATGAGGGCCATGGAGGAAAGGTACAAAATGTACCTGGA	5426	0	UF_Msa_AF_101665	contig06042___1rc_nrnt	contig06042___1rc_nrnt	Unknown	
5661	70	3		1028	E1A	0		643	1	(+)E1A_r60_a22	E1A_r60_a22	E1A_r60_a22		CONTROL
5662	70	4	unmapped	0		0	AGCAGTAAATGACGGTGTCAAGTATTACAACCTGGCTGAACCACAAGGATCTGAAGGACA	5429	0	UF_Msa_CF_118384	contig22972___0rc	contig22972___0rc	Unknown	
5663	70	5	unmapped	0		0	GGGATCTTGCTTTGCGAGAACATGCCCATGTCAATAAAAAAGGATTGTATGATGAGGCTC	5431	0	UF_Msa_AF_105736	contig14656___1_nrnt	contig14656___1_nrnt	Unknown	
5664	70	6	unmapped	0		0	GCTCGTCAGGTGGTCCTGGCCTGGGCCGTGCTCAACGTGTCTCTAGCTGGCATGATTTAC	5433	0	UF_Msa_AF_103864	contig09694___1rc_nrnt0	contig09694___1rc_nrnt0	Unknown	
5665	70	7	unmapped	0		0	CTATACTCTGTAGTTCTTTAGACCCTGGACTCTTTAACTATTTGCACTTACACTATGTAT	5435	0	UF_Msa_AF_105481	contig01621___1_nr0nt1	contig01621___1_nr0nt1	Unknown	
5666	70	8	unmapped	0		0	AGGTATTTTCTGGAGAGTTAGCCCAAATGCCCGAACAACAGGACTTCTCTTACCCCTCTA	5437	0	UF_Msa_CF_126936	contig07007___0	contig07007___0	Unknown	
5667	70	9	unmapped	0		0	AGAAGAAGCGGAGAAACTGGCCGCTTACGCCTCCGTGGACAACCACGTCCAGAATAACCA	5439	0	UF_Msa_AF_102207	contig24855___1_nr0nt	contig24855___1_nr0nt	Unknown	
5668	70	10	unmapped	0		0	GTGGAAAAGGCACCTATTCAAGAGCAGCAAGCTATGCAGTCACCTGAAACAACAGAATCT	5441	0	UF_Msa_CF_125868	contig01031___0	contig01031___0	Unknown	
5669	70	11	unmapped	0		0	AGCGGGGCCGAGGCCGCTGTGATCTGGGACAACTGACCAGTCGAGGGGTCGAGGACAGCG	5443	0	UF_Msa_CF_120617	contig03705___0rc	contig03705___0rc	Unknown	
5670	70	12	unmapped	0		0	ACCAACTTGTATAATACAATGCATTATGTTAGAGCTATTCAAATATTACATTTTTGGCAG	5445	0	UF_Msa_AF_102645	contig21542___1_nr0nt1	contig21542___1_nr0nt1	Unknown	
5671	70	13	unmapped	0		0	TATGACCCTGATTCGAAATACCCACTTAAAGTTCTTTACTGTGGAGTTTGCTCTCTGCCT	5447	0	UF_Msa_AF_108593	contig28549___1rc_nrnt	contig28549___1rc_nrnt	Unknown	
5672	70	14	unmapped	0		0	TGAGATGGATGCAGCTGACAACACAGCAGGGGAGCAGCTACTTGAAATTTTTGGAAGGAC	5449	0	UF_Msa_CF_125495	contig18030___0	contig18030___0	Unknown	
5673	70	15	unmapped	0		0	GATAGACTTGCAAACATGCAGCTTTTACTTTTTGCAGGGAAGCGCTTTAGATGGTGATTT	5451	0	UF_Msa_AD_200144	AB218777	AB218777	Unknown	
5674	70	16	unmapped	0		0	CATCCCCTTCCACGGGGGTGTAGACGAGGAGGTGGAGATGTGTGGCAGTAGACGAGATGC	5453	0	UF_Msa_CF_118894	contig03282___0rc	contig03282___0rc	Unknown	
5675	70	17	unmapped	0		0	GGCCGAGCACCCTGGCGGCTGGAACACAGATCGCTCCCACAGACGTAAAGTGAGATCCTA	5455	0	UF_Msa_AF_105744	contig05575___1rc_nrnt0	contig05575___1rc_nrnt0	Unknown	
5676	70	18	unmapped	0		0	AACACACAGAGCGTCTCCTCAGGACCTTATGACTCTGGTCGATTCCCAGCTACAGCAGCA	5457	0	UF_Msa_CF_123366	contig28168___0rc	contig28168___0rc	Unknown	
5677	70	19	unmapped	0		0	TTCATGTCACGATTTGTACACAACAGCTGGCGGCGGCTTCATTCCCCGCATCCAGCAGCT	5459	0	UF_Msa_CF_125502	contig09896___0	contig09896___0	Unknown	
5678	70	20	unmapped	0		0	GGTGTCTCTTCCTGAAGAGGGCGAGTGCCCAAACCCAAGAGAGACTTAGACCATACAATG	5461	0	UF_Msa_AD_200343	LMB_Add_17	LMB_Add_17	Unknown	
5679	70	21	unmapped	0		0	AAGAAAAACCGCTGCCAGCCCACCATGGTAGCCGCCGGAGGGCAGGAAAAACAAACCAAT	5463	0	UF_Msa_CF_123693	contig08974___0	contig08974___0	Unknown	
5680	70	22	unmapped	0		0	GAGTGATTTAGTCAGGCTACACCCAAGCGCCTGTCCGATTGCAGCGGCTTCTCTTCTTTG	5465	0	UF_Msa_AF_100748	contig03920___1_nr0nt	contig03920___1_nr0nt	Unknown	
5681	70	23	unmapped	0		0	TATGTCTGCTGCTGTAAGTAAAGCTGCTGGAAGGAAGGAAGGGACGGCCGGCCGACTTTC	5467	0	UF_Msa_CF_122936	contig30907___0	contig30907___0	Unknown	
5682	70	24	unmapped	0		0	TAATCGCACCTATAAGGGAGGCCCCTAATTTAATCTTAGCCGGAAAACCTGGCAAACTGT	5469	0	UF_Msa_CF_120324	LMB_Sanger.24.C1___0	LMB_Sanger.24.C1___0	Unknown	
5683	70	25	unmapped	0		0	GACGAGGACGCGCCCAGCTCCGACGACCTGGAGACAGTTCGCCAAGCAGTTCAAGCAGCC	5471	0	UF_Msa_AF_106439	contig23557___1rc_nrnt	contig23557___1rc_nrnt	Unknown	
5684	70	26	unmapped	0		0	TAGGAAAATCTGAGGGGTGGCCCAAATATCATCTCGCTGTTAGATATCGTCAAGGATCCA	5473	0	UF_Msa_AF_101808	contig29300___1_nrnt	contig29300___1_nrnt	Unknown	
5685	70	27	unmapped	0		0	GTGGGAAGGAATTCAAGAGTAAAGACACCCTTCGCTTTCATCAGATGGTTCACACGAATA	5475	0	UF_Msa_AF_104099	contig04824___1rc_nrnt0	contig04824___1rc_nrnt0	Unknown	
5686	70	28	unmapped	0		0	TCCATTAAGGTGGAAACACAAGCGGAGAATGTGAGTTTTGAAACTAGTGCAAAAAAGAAG	5477	0	UF_Msa_CF_119372	contig31998___0rc	contig31998___0rc	Unknown	
5687	70	29	unmapped	0		0	AGAAGGAGGAGCTGAGGCAGATGGTGGGGGAGCGGTACCGGGACCTGATCGACGCCGCGG	5479	0	UF_Msa_AF_106161	contig13898___1_nr0nt1	contig13898___1_nr0nt1	Unknown	
5688	70	30	unmapped	0		0	GTTGTGTATCTGAACGGTAAACGAAGCTGCTAAGATAAGCTGTCCACTGTACAATTGCGT	5481	0	UF_Msa_CF_125199	contig03039___0rc	contig03039___0rc	Unknown	
5689	70	31	unmapped	0		0	TAGTGAGGAAGGAGTTGTTATGTGGTGCTCTTGAGTGTTGTGATAGTGTTCATATTGCAG	5483	0	UF_Msa_CF_119016	LMB_S454.sd.116.C1___0	LMB_S454.sd.116.C1___0	Unknown	
5690	70	32	unmapped	0		0	TGACCAGTGGCTTGTCATCAATAGAAAGGTTTACAACATCACGCAGTGGGCCAAAAGACA	5485	0	UF_Msa_AF_101616	contig08865___1rc_nrnt	contig08865___1rc_nrnt	Unknown	
5691	70	33	unmapped	0		0	TTAAATAAAGTTGGCTCGGTGAGGATGAAGAGCAGAGCAAGAAATGAGGAAGACTACTGG	5487	0	UF_Msa_CF_122906	contig04868___0rc	contig04868___0rc	Unknown	
5692	70	34	unmapped	0		0	TATAACGCCTGTAAGCAGGTATAATCTGTGCGAGATCTTCCTTGTATTGCTCCAGTGCTG	5489	0	UF_Msa_CF_125887	contig32737___0rc	contig32737___0rc	Unknown	
5693	70	35	unmapped	0		0	CCGGCAGTGAGGGTGCCCTTATTCTCTCCGGAAGACCCTCAGGGGGCTCCAACAGTCGTG	5491	0	UF_Msa_AF_108170	contig02881___1_nr0nt	contig02881___1_nr0nt	Unknown	
5694	70	36		0		0		669	1	ETG10_13482	ETG10_13482	ETG10_13482		CONTROL
5695	70	37	unmapped	0		0	AGGCAGCTAAATGCGTAAGACAAAAGCAAGTAAGGACAGGTTGTGCACTGTAGATAGCAT	5494	0	UF_Msa_CF_127527	contig05770___0rc	contig05770___0rc	Unknown	
5696	70	38	unmapped	0		0	AAGAAGGTTTTACATTAGGAACCAATGGGATGACAGGATGGGACATGGATGGTTGGGTCT	5496	0	UF_Msa_CF_122244	LMB_S454.395.C1___0	LMB_S454.395.C1___0	Unknown	
5697	70	39	unmapped	0		0	AACCTTTCACTCTATAGTTTTAGATTCTGCAGAGTTCTACCAATCACCCCGATGGACGTG	5498	0	UF_Msa_CF_118199	contig20328___0	contig20328___0	Unknown	
5698	70	40	unmapped	0		0	ATATACAATAAGCCTGGAGATGGCATAGTCTTAATGGCTGAGGCGCTAGAGAAGGCTTTC	5500	0	UF_Msa_AF_101593	contig17537___1_nrnt	contig17537___1_nrnt	Unknown	
5699	70	41		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
5700	70	42	unmapped	0		0	ACCAACATTTCATTAACAGCATTCAGATGAAGCCGTCGCTGCTACTGGAAATTTAAAAGC	5503	0	UF_Msa_CF_126816	contig03967___0rc	contig03967___0rc	Unknown	
5701	70	43	unmapped	0		0	TTTATTTCACCGTCAAAGAAGAAGAGCGACGATTGGCTCAACAGAGTCAGACTTTCCAGC	5504	0	UF_Msa_AF_100428	contig24606___1_nr1nt0	contig24606___1_nr1nt0	Unknown	
5702	70	44	unmapped	0		0	AAGTGTTGGAGTAAAGAGAAGTTCCTGTTCAGCTGTGAAGCCTCTTCCCAAAATCATCCC	5506	0	UF_Msa_CF_123902	contig20194___0rc	contig20194___0rc	Unknown	
5703	70	45	unmapped	0		0	TTTTGTTAGAGCTGCCTGTCTTTGGGTTTTTTAAGCTGGCGTACGTGAAGGGGGAAGTTT	5508	0	UF_Msa_AF_104043	contig14225___1_nr0nt	contig14225___1_nr0nt	Unknown	
5704	70	46	unmapped	0		0	GGACAGATTCCGTTGACATTGCTGCCGCTGCTGAGAGGAGGAGGAGGAGGTGGGGACTTG	5510	0	UF_Msa_AF_106203	contig14581___1_nr0nt	contig14581___1_nr0nt	Unknown	
5705	70	47	unmapped	0		0	TTCACAGGAGCTCCCATCTCCGCCCATGATGCTTTGTTGCACGGTCTGGTCAGTAAGGTG	5512	0	UF_Msa_AF_107040	contig09656___1rc_nr1nt0	contig09656___1rc_nr1nt0	Unknown	
5706	70	48	unmapped	0		0	TTTTCATCGCAACAGACTACTGTCCTTCTACCTCTCTCTAACAATCTGCGCTTAACACCA	5514	0	UF_Msa_CF_122790	LMB_S454.292.C1___0rc	LMB_S454.292.C1___0rc	Unknown	
5707	70	49	unmapped	0		0	TGAAAGCAAAACTGTAGAAAAGGAGGAGAGGATTGTGAAAGACCTGAAGCAGATGTCCCA	5516	0	UF_Msa_AF_108393	contig32694___1_nrnt	contig32694___1_nrnt	Unknown	
5708	70	50	unmapped	0		0	CTGTCAGACTGTATCTGGGCACAGAAGCACATAGAGAGGAAACATGGTCATTGACTACAA	5518	0	UF_Msa_CF_123359	contig23060___0rc	contig23060___0rc	Unknown	
5709	70	51		0		0		5484	1	DCP_22_6	DCP_22_6	DCP_22_6		CONTROL
5710	70	52	unmapped	0		0	ATACAATCATACAATCACCAACCAATCGATCAGCAAGCTAGCTATTAAACTAATCACTTG	5520	0	UF_Msa_AF_105062	contig29015___1_nr0nt	contig29015___1_nr0nt	Unknown	
5711	70	53	unmapped	0		0	GACGAAGTTGAAGGTGACCTGGATGAAGATGAAGAGTATGACTCGGATAAGAAAGAGAAG	5522	0	UF_Msa_CF_118719	contig23421___0rc	contig23421___0rc	Unknown	
5712	70	54	unmapped	0		0	TCTGCCGGTGTAAATTCTGTTCCTGAGCACAACTATGGGAGGGAGGTGGTGTCGGATGCC	5524	0	UF_Msa_CF_119766	contig31682___0	contig31682___0	Unknown	
5713	70	55	unmapped	0		0	CTTCTGTCTGAGCCACATGCAAAACACCATTTTGAAGACAAAAAGTATACAAACCAAAAA	5526	0	UF_Msa_CF_117997	LMB_S454.sd.165.C1___0	LMB_S454.sd.165.C1___0	Unknown	
5714	70	56	unmapped	0		0	TCCAAGATAGAGGAAATCTATCCTCCCAAAATCTACGAGTTTGCCTACGTCACAGATGGC	5528	0	UF_Msa_AF_110254	contig09766___1rc_nrnt0	contig09766___1rc_nrnt0	Unknown	
5715	70	57	unmapped	0		0	GAATCAGATAAAGATAAAATATTGCGTACGGCCAATCAGATTAGGGCGAGTTACTTTACG	5530	0	UF_Msa_CF_123133	contig01762___0rc	contig01762___0rc	Unknown	
5716	70	58	unmapped	0		0	CTGGAGCTGGTGGAACACAGAGACTCCCCAAAATGGTTGGTCTACCCAGTGCCTTTGACA	5532	0	UF_Msa_AF_104206	contig22261___1_nrnt	contig22261___1_nrnt	Unknown	
5717	70	59	unmapped	0		0	ATCACTTCTTTGACGGCAGCTGTGCTTCAAGAACCTTTATGGCCTATCGTCAAGAGTATC	5534	0	UF_Msa_CF_126557	contig07453___0	contig07453___0	Unknown	
5718	70	60	unmapped	0		0	AACAGAGGCAGTCACGGCCCTTCTTCCATTTAAGCACACTGCAAAACATCGACAAAAACA	5536	0	UF_Msa_CF_126049	contig19183___0	contig19183___0	Unknown	
5719	70	61	unmapped	0		0	CTGTGACAAGATCAGCCCGTACTGTTTTGTAGGGACCGCCATCTTCCTCTACTGACTGTC	5538	0	UF_Msa_CF_125911	contig17218___0rc	contig17218___0rc	Unknown	
5720	70	62	unmapped	0		0	TTTCCTCAGGATCTGTGCGGTAAGAAGGTAACAAAAAGGAAAAGCAGGAAAGCAGAGACA	5540	0	UF_Msa_CF_122840	contig02646___0	contig02646___0	Unknown	
5721	70	63	unmapped	0		0	CAGCACCCAGGCCAGCATTGAAATCGACTCTCTGTACGAGGGAGTCGACTTCTATACCTC	5542	0	UF_Msa_AF_103856	contig01594___1rc_nrnt	contig01594___1rc_nrnt	Unknown	
5722	70	64	unmapped	0		0	TGGCAGAAATGTTGGTACCCATATTTCAAGATCAACAGCACTACAGTATCTGCAGGCCTG	5544	0	UF_Msa_CF_127679	contig14806___0	contig14806___0	Unknown	
5723	70	65	unmapped	0		0	ATCTCACAGAACACAGGGAGCGAGCAGCTCGGTAACTCTGTCGGCTTCACAATGCTGTGC	5546	0	UF_Msa_CF_119506	contig26160___0	contig26160___0	Unknown	
5724	70	66	unmapped	0		0	TGTCGCGACCTTGGAGTGTGACGTACAGCAGCATGGCGAGCAAGGAGCCCAATCGCTTCG	5548	0	UF_Msa_CF_127409	contig31264___0	contig31264___0	Unknown	
5725	70	67	unmapped	0		0	TTAGTTCTTCGTGTTGACGACAAATCAGTACGTCCCCGTTACGTGTCCGTTAGCAACATA	5550	0	UF_Msa_CF_119226	contig21494___0rc	contig21494___0rc	Unknown	
5726	70	68	unmapped	0		0	TTAAAGGGAGACGAGAAGAACTTGCCACATCAGGATGAGACGAGTTGGTTTGTTGGTGAA	5552	0	UF_Msa_AF_108988	contig32692___1_nrnt	contig32692___1_nrnt	Unknown	
5727	70	69	unmapped	0		0	AAGAAAGAAAATGCTGATCTCTCCTACATCCTACTGGGCCCTAAGAGTCACACCTCTGTT	5554	0	UF_Msa_CF_123151	contig19012___0rc	contig19012___0rc	Unknown	
5728	70	70	unmapped	0		0	CAGGTCGACAACAAAGTCCCACAGAAACAGAAGGCGTTTCAGGAGGATAACGGGATGCCA	5556	0	UF_Msa_AF_105505	contig15670___1_nrnt	contig15670___1_nrnt	Unknown	
5729	70	71	unmapped	0		0	CGACTTTCAACACTTTATCACTTGTTGGTTAGCCCAAACCGCTAAAGAAGCTTTGTATTG	5558	0	UF_Msa_CF_118153	contig07371___0	contig07371___0	Unknown	
5730	70	72	unmapped	0		0	CTGTTTATCAGAATCTTCTTGCACTGCTACATTGACTACAAAACCACCTCATGTGGATGG	5560	0	UF_Msa_CF_122933	contig19387___0	contig19387___0	Unknown	
5731	70	73	unmapped	0		0	CTGATCTAATCCGCAGGCAAAGAGCTGAGGGGCTGAAATGAACACACCAAAACGTATTTA	5562	0	UF_Msa_CF_121015	contig00198___0	contig00198___0	Unknown	
5732	70	74	unmapped	0		0	ATCTGCTTAAAGTACAGCCCTGCTCATCCCACACCACCTCTACTCTCTCTGGAGACCACA	5564	0	UF_Msa_CF_119439	contig20488___0	contig20488___0	Unknown	
5733	70	75	unmapped	0		0	AGACTGCAAACCTTAAGTGCACCAACACCAAAACCTCCACTAGTCACTCAGCAGCAAATC	5566	0	UF_Msa_CF_118107	contig10425___0rc	contig10425___0rc	Unknown	
5734	70	76	unmapped	0		0	CTGGCTTCAGCCTTGGAGTGGGATTATTATGACCCCTGCTATGTCAAACAGAATAATGTG	5568	0	UF_Msa_CF_117968	contig21757___0	contig21757___0	Unknown	
5735	70	77	unmapped	0		0	TGAAGCGAAGGTGGCGACTCAGCCGGATTGTTTTCCGTCATTTAGCTGACCACAACCAGA	5570	0	UF_Msa_AF_108863	contig11352___1_nrnt	contig11352___1_nrnt	Unknown	
5736	70	78	unmapped	0		0	TCTGGTCAAAATGATGTTTGAGGCTGTGGAGGATATCAAGAAGAATAACAAAGTGCGCAG	5572	0	UF_Msa_AF_104543	contig02911___1rc_nrnt	contig02911___1rc_nrnt	Unknown	
5737	70	79	unmapped	0		0	CCTGGCTGCCTGGAGGGGCGAGTGGGCAACAGCATGACACGAAACCCCCGAGTAGCGAGG	5574	0	UF_Msa_AF_107919	contig20896___1_nrnt0	contig20896___1_nrnt0	Unknown	
5738	70	80	unmapped	0		0	TATATGAGAACATTGCAGTTTCTGTGGGTCCAGTGAGCGGTGTTGAGAGCCAACTGGATG	5576	0	UF_Msa_CF_123328	contig15925___0	contig15925___0	Unknown	
5739	70	81	unmapped	0		0	AACGTCTGTGGCGCGAGTACCTGTCTGATGAGGGTGAACGGCTGTAGGAGCGAGACTGGG	5578	0	UF_Msa_CF_124238	contig02296___0rc	contig02296___0rc	Unknown	
5740	70	82	unmapped	0		0	ATTTACAGATGATTGTGATTGGCTCTCAGATCTCTGGTACATTAACGACCCAGCCCTGGT	5580	0	UF_Msa_CF_125722	contig20471___0rc	contig20471___0rc	Unknown	
5741	71	1	unmapped	0		0	AAGAGATCTTCGGCAGTGACGATGACAGCGACGACAATGAACCCAAGAACTCGGCCAGGA	5581	0	UF_Msa_CF_122719	contig10609___0	contig10609___0	Unknown	
5742	71	2	unmapped	0		0	GCAGGAGCCAGACGACAAGCTGACACGAGGTTTTCTGCTGAAGTGAGCCTCAATTACAGG	5583	0	UF_Msa_CF_122979	contig04326___0	contig04326___0	Unknown	
5743	71	3	unmapped	0		0	ACAAATCCTTCAGAGTTGAGTAGACTTCCCTCCATGTGCCAATCTCCTCCTCTGTGTATT	5585	0	UF_Msa_AD_200229	LMB_Add_3_rc	LMB_Add_3_rc	Unknown	
5744	71	4	unmapped	0		0	AGGAATATGAGGAGATCGTTTTTCTTTCAAAGCAGGAGATCGAGCATCAGCGACAACTGG	5587	0	UF_Msa_CF_121943	contig18872___0rc	contig18872___0rc	Unknown	
5745	71	5	unmapped	0		0	TCCAGTCCTCCAGCAGCAGAGAAACCTCCATCTTTCCTGGAGGTGTGGCAGAGTGATGAG	5589	0	UF_Msa_CF_122989	contig25917___0	contig25917___0	Unknown	
5746	71	6	unmapped	0		0	GTAGGAATCTGTAGCTGATTCAGTCTGGTCTCAGAGCCATGGAGGCCAAAGGAGGACTAT	5591	0	UF_Msa_CF_120109	contig22398___0	contig22398___0	Unknown	
5747	71	7	unmapped	0		0	GAAAAACCATCAAAGACACAACCACTCGTGCACCAGACAAAAGACTGTGGTGGATTCTGT	5593	0	UF_Msa_CF_120488	contig15452___0rc	contig15452___0rc	Unknown	
5748	71	8	unmapped	0		0	TGAACAGAACAAAGATCCAGAGCCTATGAAAACTGAAGCTGATGGAGAGGACTGCATTTA	5595	0	UF_Msa_CF_118593	contig23440___0rc	contig23440___0rc	Unknown	
5749	71	9	unmapped	0		0	CAGCGCTCTGTCACTTCTGCGTAGACATGCTGAATGCAAAACTTGCTGTGCAGAAGTACG	5597	0	UF_Msa_AF_105363	contig17507___1rc_nrnt	contig17507___1rc_nrnt	Unknown	
5750	71	10	unmapped	0		0	GATTTCAGGTGACTAATAATATTTTGTTTTCACATGGATTTATGGACTGGTGAGGCAGGG	5599	0	UF_Msa_AF_102447	contig14455___1_nr0nt	contig14455___1_nr0nt	Unknown	
5751	71	11	unmapped	0		0	TTAATGTGTCACCTCTTAATGGGGCTATTCTGTAGTTTTTGAGGTGACTCGTAGGAGTGT	5601	0	UF_Msa_CF_119778	contig32309___0	contig32309___0	Unknown	
5752	71	12	unmapped	0		0	ACGGTCGCACACGGACGATGGTTTTACTGAAAAGCCTCCGTCCTCCCACCGATGGCGTGC	5603	0	UF_Msa_CF_122533	contig10543___0	contig10543___0	Unknown	
5753	71	13	unmapped	0		0	ATGAAGGTGTCACCTCCCCCAAGACCAAGAAGACCAAGGCTCTGATGTTGCTGGAGGGTC	5605	0	UF_Msa_AF_102072	contig07526___1_nrnt0	contig07526___1_nrnt0	Unknown	
5754	71	14	unmapped	0		0	TACATGCGTACTTTGGGACACAGGCACATCATATCTATGCACACAACCAGCACAACTCCA	5607	0	UF_Msa_CF_127627	contig04335___0rc	contig04335___0rc	Unknown	
5755	71	15	unmapped	0		0	TTCGTCTTCAGCGACTGCCACTTCAGCGTCCTGCAGAAACTGAGGAACAACGTCCAGCTG	5609	0	UF_Msa_AF_106940	contig22229___1_nrnt	contig22229___1_nrnt	Unknown	
5756	71	16	unmapped	0		0	AGATGTCCGCTGTCGCCAACCTCTCAACGCGCAGCAGCACAAGCAGAATTATTTCCACTC	5611	0	UF_Msa_CF_121900	contig28094___0rc	contig28094___0rc	Unknown	
5757	71	17	unmapped	0		0	GCTTAGTTGCCGCCATCTAGTGGAGGCTTTAAACTACCACAGTAGAGAATGGAACGGGAT	5613	0	UF_Msa_CF_121089	contig00758___0rc	contig00758___0rc	Unknown	
5758	71	18	unmapped	0		0	GACTCTGTTTTGTAAAAACCCAAGGCGGGAGGGAAAAAATGTAGATTTCTTGTAGATGTT	5615	0	UF_Msa_CF_121583	contig31468___0	contig31468___0	Unknown	
5759	71	19	unmapped	0		0	TTTTTGGCAGATTGTCGTTCTCATCTCAGTTTCCAAACTCACAGAAAGCCGGTTGGTGTC	5617	0	UF_Msa_CF_121539	contig30845___0	contig30845___0	Unknown	
5760	71	20	unmapped	0		0	GTCGACACAAGAACATTCAGTAAGAATCACCCTCGGCTGGGTCGCTGCCGTTCAACTGTC	5619	0	UF_Msa_AF_102323	contig11405___1_nr0nt	contig11405___1_nr0nt	Unknown	
5761	71	21	unmapped	0		0	TGAGCAACCAATGTCCAGATCAGACACAAAATCATCCACAGACAAAGTCCTGTTGCCTTC	5621	0	UF_Msa_CF_119040	contig30740___0rc	contig30740___0rc	Unknown	
5762	71	22	unmapped	0		0	AAGACGTCATTCTTTTCCTGGCAAAAAAGAACATTCAGGTCAACGGAGAGCTGCTCTTTA	5623	0	UF_Msa_CF_124981	contig12130___0rc	contig12130___0rc	Unknown	
5763	71	23	unmapped	0		0	GGTGGATAAGTTCAGTGAGCTGACAGACAACTTCACCTCCCCTCATGCGCGACGGAAAGT	5625	0	UF_Msa_AF_103540	contig04102___1_nr0nt1	contig04102___1_nr0nt1	Unknown	
5764	71	24		0		0		692	1	RC1	RC1	RC1		CONTROL
5765	71	25		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
5766	71	26	unmapped	0		0	TTTCTATCTGGACGTTTTGTTTCCAACCAATTCCCTGATGTTCGACTTGTCTCGCTGTGC	5629	0	UF_Msa_AF_100325	LMB_S454.sd.469.C1___1rc_nrnt0	LMB_S454.sd.469.C1___1rc_nrnt0	Unknown	
5767	71	27	unmapped	0		0	ACTGGCACTGAGCCATCATGGCCTGTAAACAACAACAGCGTCAAGTTGAAGTAAACGGGA	5631	0	UF_Msa_AF_108420	contig05495___1_nr0nt	contig05495___1_nr0nt	Unknown	
5768	71	28	unmapped	0		0	TTCTCTTGCCACCTGGTAGCCATCCATATGACCAGTGCTGGGACAGGGTGACCTGAACCA	5633	0	UF_Msa_AD_200385	LMB_Add_17_rc	LMB_Add_17_rc	Unknown	
5769	71	29	unmapped	0		0	AGTCTGACCGGCTGTCGGCAGCAGCAATCTCCAGCTACATGCCTCAGCTGGGTGCTACAG	5635	0	UF_Msa_CF_125334	contig21081___0	contig21081___0	Unknown	
5770	71	30	unmapped	0		0	AAGTCCGGACATCCAGCACTCGTCCAGCACACCCCCCTACCTGAGCTGTCCCTTCAAGAG	5637	0	UF_Msa_CF_121869	contig08728___0	contig08728___0	Unknown	
5771	71	31	unmapped	0		0	AAACCACTTCACAGAAATTTTGGTTTGCACCCAGTTTGAGAGGCTGGAGAGAGAAAGGAG	5639	0	UF_Msa_CF_122625	contig07057___0	contig07057___0	Unknown	
5772	71	32	unmapped	0		0	TGATTGGACTTTCAAACATCACACAGGGTGGAATCTATGTGTTCAAACTGTTTGACTAAT	5641	0	UF_Msa_AF_108966	contig10181___1rc_nr0nt	contig10181___1rc_nr0nt	Unknown	
5773	71	33	unmapped	0		0	ATAATGAATCAGGCAGTCAATAGTTGTGGCCCATGGTTTCGACTCACCAGACGTAGCTAT	5643	0	UF_Msa_CF_126127	LMB_S454.314.C1___0	LMB_S454.314.C1___0	Unknown	
5774	71	34	unmapped	0		0	AGAAATGTTCAACATCAGAACTCATTATCGCTTTTTCCATGTTCTTTTCTGTGACACACA	5645	0	UF_Msa_AF_104910	contig22576___1_nr0nt	contig22576___1_nr0nt	Unknown	
5775	71	35	unmapped	0		0	AATCATTGCCGTCACACTTCGCAACAACTGGAAGACCCTATTCCACCGGGATGGCGGCAC	5647	0	UF_Msa_AF_101148	contig13640___1_nrnt	contig13640___1_nrnt	Unknown	
5776	71	36	unmapped	0		0	TCATTATCACCGTCTTCATCAGTACTTGGAGTCCGGCGCTGCTTCACACACATCCATCCG	5648	0	UF_Msa_CF_127500	contig07828___0	contig07828___0	Unknown	
5777	71	37		0		0		2578	1	RC4	RC4	RC4		CONTROL
5778	71	38	unmapped	0		0	CCTGTGCTTCAACAACAAGCTTCCGCAAAACTTGCAACCAGCTGTTAAAAGATGGCAAGA	5651	0	UF_Msa_AF_104355	contig31313___1_nr0nt	contig31313___1_nr0nt	Unknown	
5779	71	39	unmapped	0		0	TAAATAAGTCAATAAAGTGACGGCGCAGAGTCTGGAGCAGAGCATGGTGTCAGAAGTTCT	5653	0	UF_Msa_CF_122421	contig31017___0rc	contig31017___0rc	Unknown	
5780	71	40	unmapped	0		0	GGATGCATTTGTGTTTAAGAACTCTGATGTTCAGAGAACCTTTGAATTTTAAACCCAAAC	5655	0	UF_Msa_AF_103265	LMB_S454.71.C1___1_nrnt	LMB_S454.71.C1___1_nrnt	Unknown	
5781	71	41	unmapped	0		0	TTCACAGCGGCAGCAGCTCCGCCTGGAAGTTAAACACGTGATGGCAGCACCGAAGAAAGT	5657	0	UF_Msa_CF_126148	contig05799___0rc	contig05799___0rc	Unknown	
5782	71	42	unmapped	0		0	ATGCTGTCTGTGAATATGCTGTCCACACCGTCAGCCATCACTGTGTATTTTTCCTCCAGG	5659	0	UF_Msa_AF_106633	contig18054___1_nr0nt	contig18054___1_nr0nt	Unknown	
5783	71	43	unmapped	0		0	TTGTACAGAGCGGACAACCCCCGCCCCAGGGTCCCATTCTACGCCTTTCAAACCCAGGAG	5661	0	UF_Msa_CF_126782	contig23974___0rc	contig23974___0rc	Unknown	
5784	71	44	unmapped	0		0	GTCCGGAGGAGCAGAACACTGTTCCTCTCTCCACGCTTCTTGAAGTGGTCAACACAGTAC	5663	0	UF_Msa_AF_109904	contig14803___1_nrnt0	contig14803___1_nrnt0	Unknown	
5785	71	45	unmapped	0		0	TACTACGAAATCCTCAACTCGCCCGAGCAGGCCTGCGCTCTGGCCAAGCAGGCTTCCGAT	5665	0	UF_Msa_AF_109148	contig01013___1_nrnt	contig01013___1_nrnt	Unknown	
5786	71	46	unmapped	0		0	TTTACGTAAGGCGACAGTCTGCAGATCGAGGAGTTAATCATCGGAATCTTCGCTCTTTAC	5666	0	UF_Msa_CF_120238	contig14789___0rc	contig14789___0rc	Unknown	
5787	71	47	unmapped	0		0	GGACACACTGCTCCGTCACCTTCACACAACCTGAGACACACAAACACCGTCAGGGAGGAA	5668	0	UF_Msa_CF_122800	contig19853___0rc	contig19853___0rc	Unknown	
5788	71	48	unmapped	0		0	GAGGTTTGGGGAGCCTGGATGGGATGTGCTCCACGTTACAAAGACTTCCTGCGGTTGTAT	5670	0	UF_Msa_AF_109438	contig24271___1_nrnt0	contig24271___1_nrnt0	Unknown	
5789	71	49	unmapped	0		0	GATGCCATCTAGAACATTTCTGAACAGGGGCCTACACATGGAATGCAAAAGAGCAATACA	5672	0	UF_Msa_AF_109571	LMB_S454.sd.298.C1___1_nr0nt1	LMB_S454.sd.298.C1___1_nr0nt1	Unknown	
5790	71	50	unmapped	0		0	ATCAAAACATCCACCAGTGTGCGCACCACCGAGATCAACTTCCACATTGGTGAAGAATTT	5674	0	UF_Msa_AF_104428	contig20448___1_nrnt	contig20448___1_nrnt	Unknown	
5791	71	51		0		0		490	1	RC12	RC12	RC12		CONTROL
5792	71	52	unmapped	0		0	TCAAGACGGCAGCTACTGAAGTGAGCCTGTTAGCTGGAACAGATGAGTTTAATGCCACAG	5677	0	UF_Msa_AF_107980	contig11026___1_nrnt	contig11026___1_nrnt	Unknown	
5793	71	53	unmapped	0		0	ATAGATGGGAAATAAAGCGGGTATTTGTCTTTCAATGTATGGCGCTCACAGCACAAAGGG	5679	0	UF_Msa_CF_121463	contig31830___0rc	contig31830___0rc	Unknown	
5794	71	54	unmapped	0		0	CATCCTCAGTCATTACCTAAAACAGCTGGGCACTGTAGGTTTTAGCAAACGTTACTCAAA	5681	0	UF_Msa_AF_110245	contig11705___1_nr0nt	contig11705___1_nr0nt	Unknown	
5795	71	55	unmapped	0		0	TCTGGGGGACCGCTGTGCCTTTGCTCCTGCAGACGTTACGTCGGAGGCAGACGTACAGTC	5683	0	UF_Msa_AF_108348	contig01593___1rc_nrnt-1	contig01593___1rc_nrnt-1	Unknown	
5796	71	56	unmapped	0		0	GAAGTGGACAGAAGGGGTGAGTCTGAGGAGTCTGGTGATGATGAGACCAGGAGGAGGAGT	5685	0	UF_Msa_AF_100465	contig21948___1_nr0nt	contig21948___1_nr0nt	Unknown	
5797	71	57	unmapped	0		0	GTCCCTGAGCTTCCCCAGAGAGCCGCTGCGCTGGAGGGCTCCACTGCCGTCCTACCCCGA	5687	0	UF_Msa_CF_123617	contig15095___0rc	contig15095___0rc	Unknown	
5798	71	58	unmapped	0		0	TCTAGAGTGGCTTTACTGATTACACCACAGTCACAAAGCTGGTGGGCTGTGACTTTGTGG	5689	0	UF_Msa_AF_104810	contig06623___1_nr0nt1	contig06623___1_nr0nt1	Unknown	
5799	71	59	unmapped	0		0	TGAAGACAAATAATTACGTTGAATCAGTCTCTCTGTCTTTTGTCATCGCTGACCTAGAAA	5691	0	UF_Msa_AF_106277	LMB_S454.sd.623.C1___1rc_nrnt-1	LMB_S454.sd.623.C1___1rc_nrnt-1	Unknown	
5800	71	60	unmapped	0		0	TATACTCATTGCTTTCTGGCGGAGAAGATCGACACCACTCTCATGTCTGTCCGTTACATA	5693	0	UF_Msa_CF_118356	contig19279___0	contig19279___0	Unknown	
5801	71	61	unmapped	0		0	ATTCAAATCTACGGGGAAGACCAGGACCAGGGCGACAAGAAAGGTATAAACGAAAGTAAA	5695	0	UF_Msa_CF_119741	GP3-1D1.g___0rc	GP3-1D1.g___0rc	Unknown	
5802	71	62	unmapped	0		0	AGGGTTTATGCAACAATCAGGGACAAAAAGGTGAAGGCTGTGTTTCAGATGGAAACAAAA	5697	0	UF_Msa_CF_118063	contig23813___0	contig23813___0	Unknown	
5803	71	63	unmapped	0		0	TGGTATGTTTTGGCTGGATCTGCATGCAAACTGAAAATCCGGTATTTAACCCTGTGCAGC	5699	0	UF_Msa_CF_121059	contig08957___0	contig08957___0	Unknown	
5804	71	64	unmapped	0		0	TTCAGATCTACTACACAGTCCCTTCATTCCATAAGGCTGAATGAGGTCGCCATGATCCTT	5701	0	UF_Msa_AF_102958	contig25443___1_nr0nt1	contig25443___1_nr0nt1	Unknown	
5805	71	65	unmapped	0		0	CTGTTCCCTGGCAAAAAATAGAGGCAGAGGGACTAGACTGCGATTATGCTCTGCTGTTCT	5703	0	UF_Msa_AF_108226	contig07026___1_nrnt0	contig07026___1_nrnt0	Unknown	
5806	71	66	unmapped	0		0	ACGGCTCGCTACCTGAGCATCATAGAGGGTCGGGAGAGTGCAGACCCCCTCCGTATACGT	5705	0	UF_Msa_AF_106944	contig07813___1rc_nrnt	contig07813___1rc_nrnt	Unknown	
5807	71	67	unmapped	0		0	TGGATTAACCAGGGGAATGAGGCTTGGGTAGTTGTGGTAGCGTGCTAGATACGGTATTAG	5707	0	UF_Msa_CF_120398	contig10563___0	contig10563___0	Unknown	
5808	71	68	unmapped	0		0	AAGCTAACACAAATATTTGACCTCCTCCACAATACCATGAAGGTGCCGCACCATACTGAT	5709	0	UF_Msa_AF_101777	contig22312___1_nr1nt0	contig22312___1_nr1nt0	Unknown	
5809	71	69	unmapped	0		0	TTATGCACCTGGTGTCCAGTGGGTGGTTCATCCTCTCTCTGTTAGTTTGCAGTAGTTATT	5711	0	UF_Msa_CF_126401	contig16669___0rc	contig16669___0rc	Unknown	
5810	71	70	unmapped	0		0	CCTCAACATCATGGAGGAGGATCCAGATATTTTCACTGTCCTGAAGGAAAAGTGCAAACA	5713	0	UF_Msa_AF_105164	contig21708___1_nrnt	contig21708___1_nrnt	Unknown	
5811	71	71	unmapped	0		0	CAGGACTACTGTATTTATTTTCCAGCTTGACCTGCATCAAACAATAAACCTTCCTGGTGT	5715	0	UF_Msa_CF_127485	contig31721___0	contig31721___0	Unknown	
5812	71	72	unmapped	0		0	CACGTCAACATGCGCTGGTCCTCGTAAAGTCCCAGGATCACTAAAGCGTGATCAAAACAC	5717	0	UF_Msa_CF_122985	contig00854___0rc	contig00854___0rc	Unknown	
5813	71	73	unmapped	0		0	CGATGCCACTTCCATTCTGGCCTCTGTTCTGCAGAAATTTGGAGAGGATGTGTATGGTCT	5719	0	UF_Msa_CF_124360	contig05054___0	contig05054___0	Unknown	
5814	71	74	unmapped	0		0	TTGTCGAAGGATGCTCCTATCACATGTGGATCTTATTGAGAAATTGTTGAATTATGCTCC	5721	0	UF_Msa_AF_100643	contig16226___1rc_nrnt	contig16226___1rc_nrnt	Unknown	
5815	71	75	unmapped	0		0	CCTCAACCATCCCCCCTCCATCCATTCCTCCACCTCTGTACATCCATCCACCCTCATCCT	5723	0	UF_Msa_CF_117917	contig09731___0rc	contig09731___0rc	Unknown	
5816	71	76	unmapped	0		0	GGTAGATTTGTCAAACATCACAGAGTGAGAGATGGCAGGGTTTGACAATTTCAACACAGA	5725	0	UF_Msa_AF_108407	contig05304___1_nr0nt	contig05304___1_nr0nt	Unknown	
5817	71	77	unmapped	0		0	GGTCAGCTGTGTCGGGGCAGCAGCAGCGCTGCTACCTGAAGCCTTCTTTAATTCCCTTTA	5726	0	UF_Msa_AF_107087	contig19282___1_nr0nt	contig19282___1_nr0nt	Unknown	
5818	71	78	unmapped	0		0	AAACTCATCCTAGAGAGCATCCTGAAACTGACGGACCCAGGCTCCCACTCAATTTTAAAT	5728	0	UF_Msa_AF_109342	contig19557___1rc_nrnt-1	contig19557___1rc_nrnt-1	Unknown	
5819	71	79	unmapped	0		0	TTGTCTTTCATGGAGGGGGCAATCATTTATGTCATCAAGAAGAACGATGACGGCTGGTTC	5729	0	UF_Msa_AD_200203	LMB_Add_44_rc	LMB_Add_44_rc	Unknown	
5820	71	80	unmapped	0		0	GCCACTGCAGGAGCAGCCATTGAGGAGAAGAAGAAGACCAAGAGCAGATTCATGTTCAAC	5731	0	UF_Msa_CF_117714	contig09883___0	contig09883___0	Unknown	
5821	71	81		0		0		3751	1	ETG08_142674	ETG08_142674	ETG08_142674		CONTROL
5822	71	82	unmapped	0		0	GGTAAATGGTTGATGCAACATACAGTTCAAATGACGTGAAATGATATTCATGTATGGTTG	5734	0	UF_Msa_CF_122705	contig29429___0rc	contig29429___0rc	Unknown	
5823	72	1	unmapped	0		0	CGCACGCCAGAGCCACGCAACAGCCAGAGACCATCTCTGAGTCCCCAGCCTATGGAGGAG	5582	0	UF_Msa_CF_127060	contig21588___0	contig21588___0	Unknown	
5824	72	2	unmapped	0		0	AAAGGAAAGGATAAAAACTGTCCCTCCATCCGCTGTCAGCTCCTACTCCAGTCCTTATAT	5584	0	UF_Msa_CF_123107	contig03958___0	contig03958___0	Unknown	
5825	72	3	unmapped	0		0	ACATTTTAGACAGAGAAGATGGATGGTTTGAAAGAGGTGTCAAGGAAGCCATCTACACCC	5586	0	UF_Msa_CF_124291	contig22103___0rc	contig22103___0rc	Unknown	
5826	72	4	unmapped	0		0	ATTCTGAGGCAGATCACCATGAACGATCTTCCAGTAGGTAAGATCAGTGGATGAGACTCT	5588	0	UF_Msa_AF_101969	contig10307___1_nr0nt1	contig10307___1_nr0nt1	Unknown	
5827	72	5	unmapped	0		0	TCGGCAAATCGTTCCTCGTCTTGTGAAACTCTGAAGGATAATCTGGCCGTGGTATTGACT	5590	0	UF_Msa_CF_125140	contig13618___0	contig13618___0	Unknown	
5828	72	6	unmapped	0		0	ACTGATGAGTCCAAATATCTGACGAGAGTTTAAAGGGGTCCGTAAATCTGACGAGGAGGA	5592	0	UF_Msa_CF_125336	contig02484___0rc	contig02484___0rc	Unknown	
5829	72	7	unmapped	0		0	ATATGGAAAATCATGCCAAGTTTCAGGGGCTATCAGCAGCAGGATGCCCATGAAGTTACA	5594	0	UF_Msa_AF_106872	contig21087___1_nr0nt	contig21087___1_nr0nt	Unknown	
5830	72	8	unmapped	0		0	CACAGCAAAGACAGCATCCTGTAACAAAGTGTCACTGCAGCCTGTCATCACATCCCTGGT	5596	0	UF_Msa_AF_100810	contig13945___1rc_nr0nt1	contig13945___1rc_nr0nt1	Unknown	
5831	72	9	unmapped	0		0	TAGAGATCGACAGCAGACCTGATTTGGTCCAGCTGGGAGGGTGCATCAGCCTGGAGGAAA	5598	0	UF_Msa_AD_200001	LMB_Add_89	LMB_Add_89	Unknown	
5832	72	10	unmapped	0		0	ATCAGAGCACTTGGTTCCAGACGTCCTCCTTTTCCACTCCGTCTCGGAGCTCGAGTCCAA	5600	0	UF_Msa_AF_101781	contig05838___1_nr0nt1	contig05838___1_nr0nt1	Unknown	
5833	72	11	unmapped	0		0	CCCATTTTTATATTTATTATGTACAACTACCTTGTTATTCCAGATGGGGGAGGGGCCAAC	5602	0	UF_Msa_CF_120843	contig31006___0rc	contig31006___0rc	Unknown	
5834	72	12	unmapped	0		0	CACACAGAACCTAAAAGAAGTCAAGGATGCATTAGCAGAAGTGGAGGAGAAGTATCGTAA	5604	0	UF_Msa_CF_121860	contig11076___0rc	contig11076___0rc	Unknown	
5835	72	13	unmapped	0		0	CGTCGACAAGAAGGACGAACCTGCAGTTTACCAACGGGTCGTGTTGAAGAACTCCTCGCC	5606	0	UF_Msa_CF_118045	contig13324___0	contig13324___0	Unknown	
5836	72	14	unmapped	0		0	GGCTGGAATGTTAATAGAACAGACAGCAACATTATTATTTTTGCTTAATAACCGCTTGTC	5608	0	UF_Msa_CF_119725	contig30016___0	contig30016___0	Unknown	
5837	72	15	unmapped	0		0	AACAGAACTTATGTCGCAGGAACAGCAGACAAGCAAGATCCTAATGCAGTATCAGAACCG	5610	0	UF_Msa_AF_106069	contig22728___1_nrnt0	contig22728___1_nrnt0	Unknown	
5838	72	16	unmapped	0		0	GAGTCTCGTCAAGAACTCCACCAGACCACCATCATGAAATTCGTGGCTCTCGCTCTTGCC	5612	0	UF_Msa_AF_100561	contig14848___1_nr0nt1	contig14848___1_nr0nt1	Unknown	
5839	72	17	unmapped	0		0	TTAAACAGGCCTTTAAAATGTCCCACACAAGGCAAACCGTATGGGGAAGTCCAACGTAAC	5614	0	UF_Msa_CF_119338	GP3-1H3.g___0rc	GP3-1H3.g___0rc	Unknown	
5840	72	18	unmapped	0		0	GGTGGAGTGACCGTAGATGACATGCGATATGCTGAATACACTCCTAAAACAACCGTGAGG	5616	0	UF_Msa_CF_124043	LMB_S454.650.C1___0	LMB_S454.650.C1___0	Unknown	
5841	72	19	unmapped	0		0	AGTTTGCAATACACAAGCAACAGAACAAGACCTAAGAAATAACCGTTTATTGGATGACTT	5618	0	UF_Msa_AF_105546	contig17032___1rc_nr1nt0	contig17032___1rc_nr1nt0	Unknown	
5842	72	20	unmapped	0		0	ATGCTAAAAAGTGGCAGTAGTGTTACAACTCTTGCACACTATTCAGGTCCCATTATTGGT	5620	0	UF_Msa_CF_125995	contig20122___0rc	contig20122___0rc	Unknown	
5843	72	21	unmapped	0		0	GATACATAAACGGGTCCAGAATGACAGCAGCCCTCCTGTGTTTCCTCCTCGCTGGTCCAG	5622	0	UF_Msa_CF_126636	contig09928___0	contig09928___0	Unknown	
5844	72	22	unmapped	0		0	CTTGCATTTGCTCCAAAGACTTGAGGTAGTCTCGAGCCAAGATCTTCTTGGGCAGGATAT	5624	0	UF_Msa_AF_101596	contig00170___1_nr0nt	contig00170___1_nr0nt	Unknown	
5845	72	23	unmapped	0		0	TTACCGGTATCTCTGCCACAACAAAGGAGACTACAGGACCACGAGGCTGGCTCCAGGAGA	5626	0	UF_Msa_AF_107921	contig32256___1_nrnt	contig32256___1_nrnt	Unknown	
5846	72	24	unmapped	0		0	ACCTGCTGTCTGAGAGTCCAGAGTTCAGCTGTACTCCTCCGGAAACCAGACGAAACAAAT	5627	0	UF_Msa_CF_118258	contig04207___0	contig04207___0	Unknown	
5847	72	25	unmapped	0		0	AAAGTACCATGAACAGAAGCTGTTGAAGAAGGTGGACTTCATCAACTGGGAGGTGGACAA	5628	0	UF_Msa_AF_109817	contig32062___1rc_nrnt	contig32062___1rc_nrnt	Unknown	
5848	72	26	unmapped	0		0	GTCCAAACCTGAACATCACAGGGCAGACCTTTTGTGTCACCGGACGGCCGTTACATTGTG	5630	0	UF_Msa_AF_104703	contig23009___1rc_nrnt0	contig23009___1rc_nrnt0	Unknown	
5849	72	27	unmapped	0		0	GTCAGTTAGCTACAGAGGAGACAGTTTGTGAGTAAAAGAATGATGAAGAGAAGATGACGG	5632	0	UF_Msa_CF_121804	contig18615___0	contig18615___0	Unknown	
5850	72	28	unmapped	0		0	ATCCACAGCTCCCTGACTCTCCTGTTTCAGTTCAGCCACTCGTCTGAGGATCCTCTGAAA	5634	0	UF_Msa_CF_126855	contig02373___0rc	contig02373___0rc	Unknown	
5851	72	29	unmapped	0		0	GTTTATCATTGAAGAGTTTGTTCCTGGAAACTGATGGCACAGCATCCAGTTACAGGTGGA	5636	0	UF_Msa_CF_121714	contig30113___0rc	contig30113___0rc	Unknown	
5852	72	30	unmapped	0		0	AGAAAAGGCTAATCAGAAGCTTCCATGGACAGAGGGAATACATGATGGCTGAAGCACAGA	5638	0	UF_Msa_CF_127341	contig24258___0	contig24258___0	Unknown	
5853	72	31	unmapped	0		0	TTACATGGTGGACCGTTCTGTCAGGGAAAAACGCTCCGCGGTGGGACTTCACGGAAGATG	5640	0	UF_Msa_CF_120517	contig09079___0	contig09079___0	Unknown	
5854	72	32	unmapped	0		0	AGAGAACACAAGTAAACAGAAAGACAGCAGAGGCCCAAGCTTTGAGACAATCTCTGCAAG	5642	0	UF_Msa_CF_125776	contig06418___0	contig06418___0	Unknown	
5855	72	33	unmapped	0		0	TGTGCTTTGCTGTCTGTGGTTGATGATACATACTGTAAGCAGTTCACAATGATGCGTGCA	5644	0	UF_Msa_CF_125050	contig00806___0rc	contig00806___0rc	Unknown	
5856	72	34	unmapped	0		0	AACATACGCTTTATAGTCACTTTGAGTACTACGATTCACTGGTGGTACGTCTACAGAGCC	5646	0	UF_Msa_AF_100679	contig18507___1rc_nrnt0	contig18507___1rc_nrnt0	Unknown	
5857	72	35		130	HybridizationNegative	0		578	1	(+)eQC-40	EQC	EQC		CONTROL
5858	72	36	unmapped	0		0	ATGAATATCTGACTAAACAGTGGCGTTACCCCATCGAGCTGCATGGTATTGGGAAGTATG	5649	0	UF_Msa_AF_105015	contig07130___1_nrnt	contig07130___1_nrnt	Unknown	
5859	72	37	unmapped	0		0	TCAGCAGGCACTGGTGGCATGTGGCGCTTCTACACAGAAGACTCGCCAGACCTCAAAGTT	5650	0	UF_Msa_AF_101145	LMB_S454.784.C1___1rc_nr0nt1	LMB_S454.784.C1___1rc_nr0nt1	Unknown	
5860	72	38	unmapped	0		0	CCATCGCCAACGCAGGTTTCCTGATGTCCCACAGGTTGATTATGCCCCATGAGTCACAGG	5652	0	UF_Msa_CF_126449	contig15897___0rc	contig15897___0rc	Unknown	
5861	72	39	unmapped	0		0	CACCCACCTGTCTCCACTGAGATCTTGCGCAAGATTCAGGGCTAAGAGCCCATGGTCAAA	5654	0	UF_Msa_AF_100667	contig10913___1_nrnt	contig10913___1_nrnt	Unknown	
5862	72	40	unmapped	0		0	AATGAAAGAGAAACTTAAGTCCATTTACTTCCACTTGCCACCCTACACCAAATTTGCTCC	5656	0	UF_Msa_AF_105120	contig32580___1_nr0nt1	contig32580___1_nr0nt1	Unknown	
5863	72	41	unmapped	0		0	CTCCTGCCTAAACATGGCTTAACCAGAGAGGATGTGTTCATAACCAGTAAGCTGGGCCCC	5658	0	UF_Msa_AF_104634	contig19822___1rc_nrnt-1	contig19822___1rc_nrnt-1	Unknown	
5864	72	42	unmapped	0		0	TCAGACAGTGCTAAGCTGAAGAAGGTAGGGCTAGAAGATGAGTGTAGGGATGAAGAAGTG	5660	0	UF_Msa_CF_119227	contig31209___0	contig31209___0	Unknown	
5865	72	43	unmapped	0		0	CCTGCGACGACATCAAAGACATCTACCGGAGGATGACGGGCTCAGACTTTGACTTTGCCG	5662	0	UF_Msa_AF_103210	contig32166___1rc_nrnt	contig32166___1rc_nrnt	Unknown	
5866	72	44	unmapped	0		0	GTAAAGATAATGGATGCCGATCTGGATCCGGCGCTGGTGTTCAGAGCACATCAAGCAGTG	5664	0	UF_Msa_CF_122915	contig24335___0	contig24335___0	Unknown	
5867	72	45		0		0		2362	1	RC10	RC10	RC10		CONTROL
5868	72	46	unmapped	0		0	ACGAAGAAAGTGGTGGCGACCGGGTAAGTAAAGGCAAAACTGTGAAAAAGTTGGAAGACA	5667	0	UF_Msa_AF_105937	contig03352___1_nr0nt	contig03352___1_nr0nt	Unknown	
5869	72	47	unmapped	0		0	GAGCAAGTGTAAATTGCTGTAACATAATTGTTTGAGCTGTTGATTTAAAAAGCCAAATTA	5669	0	UF_Msa_AF_107970	contig09424___1_nr0nt	contig09424___1_nr0nt	Unknown	
5870	72	48	unmapped	0		0	TTTGTGGCAGCCAAACCGGAATCAGTATTAGAAAAGTGGAGCCAGTGAAAGAGGAGAAGA	5671	0	UF_Msa_CF_122080	contig23271___0	contig23271___0	Unknown	
5871	72	49	unmapped	0		0	ATGAAAAGAACAATGTAGTCAGCTTAGCATTTTCACCTCTGGTACGTGGTCTATACAGGG	5673	0	UF_Msa_AF_110103	contig21743___1_nr0nt	contig21743___1_nr0nt	Unknown	
5872	72	50	unmapped	0		0	CGACATGTCCTCTTCCCTGTGCTCCGAGAGCACCTGGGACGACATGTTCGCTAATGAACT	5675	0	UF_Msa_AF_107870	contig13001___1_nr0nt1	contig13001___1_nr0nt1	Unknown	
5873	72	51	unmapped	0		0	TTTATGTGCATGTGTGCACAATACAATATTAAAATCATTGGTAATTTATTAATGAAAAAA	5676	0	UF_Msa_AF_108150	contig17713___1_nr0nt1	contig17713___1_nr0nt1	Unknown	
5874	72	52	unmapped	0		0	GAGAATCTGCCCTCACGAATCGGCAATAATGGAAACCATAGTATTTGCACTTTGTACTTT	5678	0	UF_Msa_CF_121151	contig23820___0	contig23820___0	Unknown	
5875	72	53	unmapped	0		0	TGTCCGGACGGGTCGGCTGTTCTGGGCTTTGTTTTCCTGCTACGCCGACATGCTGATCGA	5680	0	UF_Msa_CF_123450	contig11748___0	contig11748___0	Unknown	
5876	72	54	unmapped	0		0	AACTACTGCCGCAACCTAGACATAAAGACGGCCATCACTGTAGGTGTTGTAGGTTTTCCC	5682	0	UF_Msa_AF_108826	contig17656___1rc_nrnt-1	contig17656___1rc_nrnt-1	Unknown	
5877	72	55	unmapped	0		0	ACACAACGACAACGAGGACCGATTTCTCAACAAGAAGACTATTTAATAACGTTAAGTTAG	5684	0	UF_Msa_CF_126778	contig13197___0	contig13197___0	Unknown	
5878	72	56	unmapped	0		0	AAAGGGGCGAAGATCATGAAAGAGGTTCTTCTGGAAGCTCAGGAGATGGCAGTCAAAAAT	5686	0	UF_Msa_AF_105963	contig31114___1rc_nrnt	contig31114___1rc_nrnt	Unknown	
5879	72	57	unmapped	0		0	ATTTCTGTGACAGGAAGGTTTCTGTAAACAAAGTGCAGCGCAAAGGGAATGTGGAGGAAG	5688	0	UF_Msa_AD_200075	LMB_Add_134	LMB_Add_134	Unknown	
5880	72	58	unmapped	0		0	AACACTTGGAGGTCCGACACCAACGCTCAGGACGTGCCTCTGATCAACCCGACAAGAAGA	5690	0	UF_Msa_AF_100006	contig16886___1rc_nrnt	contig16886___1rc_nrnt	Unknown	
5881	72	59	unmapped	0		0	TGTCGCGTCCCAGCCTGCTGACGAAAAGGAAGAGCCTGGTCTACAGTGCCTTGGAGAGGG	5692	0	UF_Msa_AF_108696	contig22429___1_nrnt	contig22429___1_nrnt	Unknown	
5882	72	60	unmapped	0		0	GCTCCTCCTCTACTACCCCACTCAACACCACAGCTGCCGGCAAACCATGGCCCCAGGCCC	5694	0	UF_Msa_CF_119667	contig13652___0rc	contig13652___0rc	Unknown	
5883	72	61	unmapped	0		0	TGTACAACTCTGCAAAGAACTTACAGAGAAAAGAGATCATGGAAGTGAGATTAGAGATGT	5696	0	UF_Msa_AF_109779	contig00373___1rc_nrnt	contig00373___1rc_nrnt	Unknown	
5884	72	62	unmapped	0		0	ATGGGACTTGAGGCCTATGAAATCTAGGGGCCACAGACATTGATGCTGTTTTCTTGTCTT	5698	0	UF_Msa_CF_120480	contig11297___0	contig11297___0	Unknown	
5885	72	63	unmapped	0		0	TATGAACAGTTTGAGCAAAGCAACCTCGTATGAAGAGAATCTGCAGAAACTGAGCGGGGT	5700	0	UF_Msa_CF_123223	contig16773___0rc	contig16773___0rc	Unknown	
5886	72	64	unmapped	0		0	AGAAGGCGCTGCTTGATCTGGATTGGAAGTGCCCTCCCTGTCGTGGCATTTGCAACTGCA	5702	0	UF_Msa_AF_106977	contig07495___1rc_nrnt	contig07495___1rc_nrnt	Unknown	
5887	72	65	unmapped	0		0	CAGATGGCTCAGTAGACTTGCTGACAGCAACGTCAGCAGCCCACTGGTTTGATCAGTCGA	5704	0	UF_Msa_AF_103004	contig10173___1rc_nrnt0	contig10173___1rc_nrnt0	Unknown	
5888	72	66	unmapped	0		0	AAACGAGTGTCATTGTGGTCAGTGGAAGAAGTGCTGGAGTGGGTGCAGGCTCAGCACCCA	5706	0	UF_Msa_CF_124668	contig30462___0rc	contig30462___0rc	Unknown	
5889	72	67	unmapped	0		0	ACGAGTGGTCTGCGGGAGATGGAACAGTTGGAGCGATGAGCGAGTGACAGGGAATTCAAC	5708	0	UF_Msa_CF_121065	contig02414___0rc	contig02414___0rc	Unknown	
5890	72	68	unmapped	0		0	ACCAGAAGGACAAACCTACAGCACTTAATCGTAATGGATTGTTTCGACCCTCTTCTTAAA	5710	0	UF_Msa_AF_101565	contig22469___1rc_nrnt	contig22469___1rc_nrnt	Unknown	
5891	72	69	unmapped	0		0	CTCTACAGATGACCGGGTCCATACCCTTTGGAAACATCGCTGCTCCACCAGCTGTTCCAA	5712	0	UF_Msa_AF_101196	contig12455___1rc_nrnt-1	contig12455___1rc_nrnt-1	Unknown	
5892	72	70	unmapped	0		0	AGTACCCTCAGAATGGGAGGCCGTGGCACAGAGAAGGCGAGACTGGCATGGGTTAACATA	5714	0	UF_Msa_AF_101110	contig03038___1_nr0nt	contig03038___1_nr0nt	Unknown	
5893	72	71	unmapped	0		0	ATTGTGGTGAAACACAAGGAGGTGTCTGAGGAGTCAAAGAAAAGGAAAGAAGCCCTCCTT	5716	0	UF_Msa_AF_107453	contig00870___1_nr0nt	contig00870___1_nr0nt	Unknown	
5894	72	72	unmapped	0		0	AATTGAGTCAGAAATCTCAAAGACGGATGTCTCCAAACCTGGACAAATTAAACCAAATCT	5718	0	UF_Msa_CF_125083	contig02635___0	contig02635___0	Unknown	
5895	72	73	unmapped	0		0	ACATTTCCACGGCAGAGACACATTTCAGCTGGAAGTCTCTCAACGTCTCAAGAAAGAGGG	5720	0	UF_Msa_CF_127368	contig23016___0	contig23016___0	Unknown	
5896	72	74	unmapped	0		0	GCTCGGTTGCGTACGAAATATTCTTTATGATATGATTTAAAATTAAACCCACCCAACACA	5722	0	UF_Msa_CF_119520	contig02799___0rc	contig02799___0rc	Unknown	
5897	72	75	unmapped	0		0	ATGAAATCTACATGAACATATCAGACAAGATGGGTCCTGGTAATGCGAGCTGCAGGGACA	5724	0	UF_Msa_CF_119836	contig15968___0	contig15968___0	Unknown	
5898	72	76		1028	E1A	0		571	1	(+)E1A_r60_a107	E1A_r60_a107	E1A_r60_a107		CONTROL
5899	72	77	unmapped	0		0	TTAAGTGTAATGACCACGGTGTGTGTGTGGCTCCCCCTGGTGGCGGTGTCGATTTGGTGT	5727	0	UF_Msa_CF_121693	contig23536___0	contig23536___0	Unknown	
5900	72	78		0		0		4169	1	ETG09_48764	ETG09_48764	ETG09_48764		CONTROL
5901	72	79	unmapped	0		0	AACCAACAGATCCAGACACAGGGATAAGCAAGCATCCAGCCAGAAATGTGAACTCTATTA	5730	0	UF_Msa_CF_121509	contig29777___0	contig29777___0	Unknown	
5902	72	80	unmapped	0		0	TATCACCAAGCACACTCATGATAGTATGTATAAGTTTGAGCAGAGGGCGGGGCTTACTGA	5732	0	UF_Msa_CF_121926	contig08398___0	contig08398___0	Unknown	
5903	72	81	unmapped	0		0	AGTAAAGCCAGTCACAGAACCTGGAAAGTTGAGCGCTCCTTGGGGAGCCAGTTTGAGCGG	5733	0	UF_Msa_AF_108345	contig03142___1_nrnt	contig03142___1_nrnt	Unknown	
5904	72	82	unmapped	0		0	TGGACTTCCTGAAAGGGGTTTTGGATGGCAGTATCCAGAGACAGGGAGGAAACGACATCG	5735	0	UF_Msa_CF_119352	contig23541___0rc	contig23541___0rc	Unknown	
5905	73	1	unmapped	0		0	ATATGCCACGTTGATGCACTACGCTGTAGCCTATGTGATGTGCTATACATTGGCAGTAAG	5736	0	UF_Msa_AD_200130	AF462345_rc	AF462345_rc	Unknown	
5906	73	2	unmapped	0		0	TGGCTCAGCTTCTAGCGATGAAGTCCTGCAGGAGGCACTGACAGTGATTAGTCTGCTAGA	5738	0	UF_Msa_CF_118571	contig10554___0	contig10554___0	Unknown	
5907	73	3	unmapped	0		0	CAGAGAATTATGGTGGCAAATATTGAGGAAGTTCTGCAAAGAGGAGAAGCTCTTTCTGCT	5740	0	UF_Msa_AF_102743	contig18409___1_nr0nt	contig18409___1_nr0nt	Unknown	
5908	73	4	unmapped	0		0	ATTTTTATCAGGTCATGGGGAATTCGAAGTATATCCCTACCACCAACAGGCAGGAGGAGT	5742	0	UF_Msa_CF_126481	contig03565___0rc	contig03565___0rc	Unknown	
5909	73	5	unmapped	0		0	AAATGTGACAGTGTATAGTTAGCCATTTCTTGTTTATTTCTTACAGAAGAATGGGCTCCT	5744	0	UF_Msa_AD_200107	LMB_Add_121	LMB_Add_121	Unknown	
5910	73	6	unmapped	0		0	AGACTTCGAGTGCAGAGACTGAGGGGAAACACAAACACATGCACAGAGGCAATACTGAAA	5746	0	UF_Msa_CF_118535	contig15399___0rc	contig15399___0rc	Unknown	
5911	73	7	unmapped	0		0	GATACAGTTTCAGTTTAAGCTTCAACTCTATTCAGATGAACTTTCGAAAATACAGCACCC	5748	0	UF_Msa_CF_123481	contig12409___0rc	contig12409___0rc	Unknown	
5912	73	8	unmapped	0		0	TATCTTCCAAGAGTTTAAGAACACAGACATGAAATACAAGAACCGTGTGCGAAGCCGAAT	5750	0	UF_Msa_AF_102162	contig01810___1_nrnt	contig01810___1_nrnt	Unknown	
5913	73	9	unmapped	0		0	TGTCTGAACAACGACTTCACTATGGATCTGTTCCGGAAGAACGTTGAAAAGCCCCAAAGA	5752	0	UF_Msa_CF_124570	contig10487___0	contig10487___0	Unknown	
5914	73	10	unmapped	0		0	CCACATGCTTTGACATTGTCTTGATTTAAAATGCAATTTGGTTTCTGTTTCTATGAGTGC	5754	0	UF_Msa_AF_108752	contig29038___1_nrnt	contig29038___1_nrnt	Unknown	
5915	73	11	unmapped	0		0	ATGGCTACCGCTTTGGCCTAGGAGCTGAGGTTGGTATCAGTACGGCACGGATACATGCCA	5756	0	UF_Msa_AF_101727	contig03823___1_nr0nt	contig03823___1_nr0nt	Unknown	
5916	73	12	unmapped	0		0	ACCTAGCGAAGACCCAGAATGTGATGTATGACCTGGTGTCAGAGCTGCAGGAGCGCAGTG	5758	0	UF_Msa_AF_104105	contig04416___1_nrnt	contig04416___1_nrnt	Unknown	
5917	73	13	unmapped	0		0	TCGTCGTAACAGATTATCCCATGATGCTGTCCGTGTTTTCCAACATGCTGTCCAAAGAGT	5760	0	UF_Msa_CF_126054	contig02430___0	contig02430___0	Unknown	
5918	73	14	unmapped	0		0	CAAAATGTACAGGTGTCCAAGCTTCCAAACGGTCTGGTGATAGCATCACTGGAGAGCTAC	5762	0	UF_Msa_CF_119798	contig03061___0rc	contig03061___0rc	Unknown	
5919	73	15	unmapped	0		0	ATGAGGTCTGGTCAGCGTTGTCTACGCTGTGGCCTGCTGCCCAGACACAGACTGCCAGCA	5764	0	UF_Msa_CF_120679	contig25727___0	contig25727___0	Unknown	
5920	73	16	unmapped	0		0	TCTTACAGAATACCCACAGTACTTTGGGTGATCCGGGAGATTCATCTGGTTCCCTTTGAT	5766	0	UF_Msa_CF_118848	contig03358___0rc	contig03358___0rc	Unknown	
5921	73	17	unmapped	0		0	TTCTAGGAACATGGTATGACGTTGCCGTGGCAAGTACATGTCGCCATATTCAAAGTCACA	5768	0	UF_Msa_AF_107460	contig00333___1_nrnt0	contig00333___1_nrnt0	Unknown	
5922	73	18	unmapped	0		0	GAATCTGCAGTAGCAAATAGCTCAGTGGTCCAGTTTTCTGGTAATGCCTTTGAATGAAAA	5770	0	UF_Msa_CF_119329	contig30924___0	contig30924___0	Unknown	
5923	73	19	unmapped	0		0	TCTTTTATTATTAACAGACATAATGAAAATGTCAACAGTAACAAAATTTTTAGTTCATTT	5772	0	UF_Msa_AF_106789	contig07377___1_nr0nt	contig07377___1_nr0nt	Unknown	
5924	73	20	unmapped	0		0	TCACAGGCTTGTTTTTTGGTCGGGCTTTTTACGTCTGGAGGCCTCATCAGAGGAGGAGAC	5774	0	UF_Msa_CF_124829	contig06467___0	contig06467___0	Unknown	
5925	73	21	unmapped	0		0	GATAAAATATGACGCAGACCTGGTCCACAGCCTCCTCCAGTATGTGCTGGGTGTCCTCCC	5776	0	UF_Msa_CF_124548	contig26254___0rc	contig26254___0rc	Unknown	
5926	73	22	unmapped	0		0	GGCTAAGTCCAGACAAGACAGAATTTTTGGTTGACATTCGGTCATATGCAGGAAGGAAGA	5778	0	UF_Msa_CF_121954	contig01939___0rc	contig01939___0rc	Unknown	
5927	73	23	unmapped	0		0	CAACGGATGGGTGGTGGTGGTGCATGTCAAGGATGGAAAATATGGCTCACCAAAGAAGAA	5780	0	UF_Msa_CF_118981	contig21676___0rc	contig21676___0rc	Unknown	
5928	73	24		1028	E1A	0		42	1	(+)E1A_r60_n11	E1A_r60_n11	E1A_r60_n11		CONTROL
5929	73	25	unmapped	0		0	TGACACAGGAGAGCTGGAGAACAGGCCGGAGCTGCGAGGTGATTGGAAGCTGAAGGAGTG	5783	0	UF_Msa_CF_120836	contig02248___0rc	contig02248___0rc	Unknown	
5930	73	26	unmapped	0		0	TGCTGTATCTGGAGGTCCTTCTTCGTGCTCAATGCTCAGTCAAGTCCAAGAGGGTTTGAG	5785	0	UF_Msa_CF_120171	contig22637___0	contig22637___0	Unknown	
5931	73	27		1028	E1A	0		799	1	(+)E1A_r60_n9	E1A_r60_n9	E1A_r60_n9		CONTROL
5932	73	28	unmapped	0		0	CCCTTTGTGGGACAAAAGTTTGAATGCAAGACATTGTCATTGTTGAATACTATAAACATG	5788	0	UF_Msa_AF_109352	contig16993___1_nr0nt1	contig16993___1_nr0nt1	Unknown	
5933	73	29	unmapped	0		0	TATCATGGTCCAAGTTGAGAGCTAGGATCCGAGGCTACCATCCATCAGCGGGGCAGCGAA	5789	0	UF_Msa_CF_120352	contig14816___0rc	contig14816___0rc	Unknown	
5934	73	30	unmapped	0		0	AACAGTGTGTTTGCAGTGGAGATCAATGGCTTCGTGTCCCACATCTATGGAAGCAAGTTT	5791	0	UF_Msa_AF_100322	contig27819___1_nrnt	contig27819___1_nrnt	Unknown	
5935	73	31	unmapped	0		0	TCTGTCACCAATTGGAAAGGTCATGCCCAAAGAGTGGAGAGAGGCCGAGGAGTGAAGAGT	5793	0	UF_Msa_AF_105147	LMB_S454.sd.578.C1___1_nrnt	LMB_S454.sd.578.C1___1_nrnt	Unknown	
5936	73	32	unmapped	0		0	TTACGGCGACAGCAGCTTCAAGATGGTGCAGCGCCTGACTTACCGTCGCAGGTTGTCCTA	5795	0	UF_Msa_AF_104233	contig10135___1_nr0nt1	contig10135___1_nr0nt1	Unknown	
5937	73	33		1028	E1A	0		571	1	(+)E1A_r60_a107	E1A_r60_a107	E1A_r60_a107		CONTROL
5938	73	34	unmapped	0		0	CAAGTTGAGCTGGAGCTCCTTACAGGAATGGCTGAGGTGTTTGGTTCTGAGCTGAACCGC	5798	0	UF_Msa_CF_125409	contig21245___0	contig21245___0	Unknown	
5939	73	35	unmapped	0		0	CAAAAAGAAAGTGGTCCTCCTTTTGGCATACTCTGGAAAAGGATACTATGGCATGCAGAG	5800	0	UF_Msa_AF_101717	contig26720___1rc_nrnt0	contig26720___1rc_nrnt0	Unknown	
5940	73	36	unmapped	0		0	ATGGTATGTCCGGCTGTAGAGTGCTGGTAACCTTGTTGCACGCACTTCAGAGGACCGGAG	5802	0	UF_Msa_AF_102825	contig12112___1_nrnt0	contig12112___1_nrnt0	Unknown	
5941	73	37	unmapped	0		0	ACCACCCTCCCTACAAGTCACTGAGAGGACTAACTGTGGGAAAACACAAATAAACTTGGA	5804	0	UF_Msa_CF_121467	contig13390___0rc	contig13390___0rc	Unknown	
5942	73	38	unmapped	0		0	CTCCCAAAACATCTGTGCTCCTTCAACAGAATACATCGATCGAAGGACAAAATTGGAGTA	5806	0	UF_Msa_CF_119559	contig32481___0rc	contig32481___0rc	Unknown	
5943	73	39	unmapped	0		0	GCCACAGCTGCTGGAGCTGCCCATCGAGGAGGTGCTCATAGTGGATCTGTGTGCAGACAA	5808	0	UF_Msa_CF_118245	contig29287___0rc	contig29287___0rc	Unknown	
5944	73	40	unmapped	0		0	CGTTACTGGAGCAGCATATATACTGACCACATTATGAGAAACAGTCTGAGCTCGTTCTTT	5810	0	UF_Msa_CF_124913	contig31766___0rc	contig31766___0rc	Unknown	
5945	73	41	unmapped	0		0	AAGGCATTCTTCACTCCAGGAAAGCCCAAGTCTGCTAACGTTTTGGGTGCAGTAAACAAA	5812	0	UF_Msa_AF_106748	contig04831___1rc_nrnt	contig04831___1rc_nrnt	Unknown	
5946	73	42	unmapped	0		0	ACTTTCCCAGGCAGAATATCACCCTGACTCAAACAAACGGGATGCAGACAACCATAACTA	5814	0	UF_Msa_CF_124682	contig19401___0	contig19401___0	Unknown	
5947	73	43	unmapped	0		0	GGCAGGGCTTGAGAAAGTACAGAACCTTGTGGACAGACGGCTACAGGTGAATAGAGGCAA	5816	0	UF_Msa_AF_106039	contig26349___1rc_nrnt-1	contig26349___1rc_nrnt-1	Unknown	
5948	73	44	unmapped	0		0	AGGAGGAAGTGTCAATTAAGAATCATATTGTTGCTGTCGAACCCATCAAGGATGAAAAAG	5818	0	UF_Msa_AF_107005	contig31525___1rc_nrnt0	contig31525___1rc_nrnt0	Unknown	
5949	73	45	unmapped	0		0	AATTTTACAGCACACAAGCGCTTTGCCAAGGTCCCAAAAATCTTTGAAAGAAGTCCATTT	5820	0	UF_Msa_CF_127530	contig16611___0	contig16611___0	Unknown	
5950	73	46	unmapped	0		0	GAAACGTGCGAAAGAGGCCTGGAGATTCTCGCCAGCATGGACCAAGAGGACAACAGATGT	5822	0	UF_Msa_AF_106275	contig00918___1rc_nrnt0	contig00918___1rc_nrnt0	Unknown	
5951	73	47	unmapped	0		0	GAAAGAAGAAAGCACATCCTATGCTGAATAAAGGGCTGATGGACTGGTTTCTCTGTGGTT	5824	0	UF_Msa_AF_108402	contig07868___1_nr0nt	contig07868___1_nr0nt	Unknown	
5952	73	48		1028	E1A	0		42	1	(+)E1A_r60_n11	E1A_r60_n11	E1A_r60_n11		CONTROL
5953	73	49	unmapped	0		0	TACAGAGAGAACGGAGCCACGCTCAGCAGAGAGCGGCTGCAGACGGACGTTTTTGTGGAG	5827	0	UF_Msa_CF_121821	contig08932___0	contig08932___0	Unknown	
5954	73	50	unmapped	0		0	CGGAGAAACAGCTCCTCTGTGACCGCACCAGCGGCTACAAGCCCTTTTACATTCAAATCC	5829	0	UF_Msa_CF_124035	contig09934___0rc	contig09934___0rc	Unknown	
5955	73	51	unmapped	0		0	AAACCCATCCAGATGAAATGCAGCCGCTAAGCAGTGTACCACCAGAGAGTGACTGGGACA	5831	0	UF_Msa_AF_100705	contig21154___1rc_nrnt0	contig21154___1rc_nrnt0	Unknown	
5956	73	52	unmapped	0		0	TAAAAGGCTACACGCGTAAAGGAGCTGCCTTGGAGGCCATGAAAGATTATTCAAAAGCCA	5833	0	UF_Msa_AF_109057	LMB_S454.sd.484.C1___1_nrnt	LMB_S454.sd.484.C1___1_nrnt	Unknown	
5957	73	53	unmapped	0		0	CGTCACATCACAATTCCAACCAGCGTGCCTCAGCAGCAACTCGTTCGATGAAGCTCTGGG	5835	0	UF_Msa_AF_106864	contig01804___1_nrnt	contig01804___1_nrnt	Unknown	
5958	73	54	unmapped	0		0	TGATGCTTGTTAAGACTGACCATTGCAGAAATCACGCCGGGAGAAGTTAAGAGAAGCTGT	5837	0	UF_Msa_CF_121959	contig30466___0	contig30466___0	Unknown	
5959	73	55	unmapped	0		0	GGAGCTCCGTCATGCTGCGTAAAGGGAGCAGATGTGGTGTCATGGTGCTCTCTGTCAACA	5839	0	UF_Msa_AF_104060	contig15917___1_nr0nt	contig15917___1_nr0nt	Unknown	
5960	73	56	unmapped	0		0	ACATTTACCGGCAGAAGGACCTGGATCAGTCGGGGACCATGAGCTCTGCAGAGATGAGGT	5841	0	UF_Msa_AF_106758	contig05562___1_nrnt	contig05562___1_nrnt	Unknown	
5961	73	57	unmapped	0		0	GGGACGAGGCCGGGGCGGCCCGAGGAGATGATCACCAGGCCGTACATTTGCTGGCCACCA	5843	0	UF_Msa_CF_124514	contig06379___0	contig06379___0	Unknown	
5962	73	58	unmapped	0		0	TTCTACAGCAGAGAGGATTGAATGAAATGTGAATTCACGGGAAGGCTTCATCCTCCCTCT	5845	0	UF_Msa_AF_101949	LMB_S454.sd.183.C1___1_nrnt0	LMB_S454.sd.183.C1___1_nrnt0	Unknown	
5963	73	59	unmapped	0		0	GCTGATCTCAAACCTCAGTCTCATGCTGATCCTCAGCCAGCTGCACAGTGCAACCCTGAA	5847	0	UF_Msa_CF_121989	contig14896___0	contig14896___0	Unknown	
5964	73	60	unmapped	0		0	TCTCAACAGTTAAAGTCAGTCCTCATAATCCCAAAGCAGAGGGAAAGCATGTAATTTGTG	5849	0	UF_Msa_CF_121739	contig23871___0	contig23871___0	Unknown	
5965	73	61	unmapped	0		0	TAGAGGAAAAGTGTAGTACATGGAGCAGACGAAGACAGGGGAACTAATGAGCTAGAATTC	5851	0	UF_Msa_CF_121351	contig01463___0	contig01463___0	Unknown	
5966	73	62	unmapped	0		0	AACATCATGGATATGGTGAAGGAAGAATAAACCTGACGTGGTCTCAATTAATTTCAGGGC	5853	0	UF_Msa_CF_119701	contig03412___0rc	contig03412___0rc	Unknown	
5967	73	63	unmapped	0		0	CCACAACGCCCCTCTTCCTAGGTTTGACAAGAATGTAAAATGTTAAGATTTTTATTTCTT	5855	0	UF_Msa_CF_119855	LMB_S454.52.C1___0	LMB_S454.52.C1___0	Unknown	
5968	73	64	unmapped	0		0	TGGCCATCTCTGCTCCTTATGGAGGCACCGGCCATCTGGGCGTGGTCTACATCCACAACG	5857	0	UF_Msa_CF_125237	contig21536___0	contig21536___0	Unknown	
5969	73	65	unmapped	0		0	GCCGCAGCAGAAGCCGGGTCCATACCTTCAGGACGCCATGGTCAGAGTAACAGAATCACT	5859	0	UF_Msa_CF_124432	contig20315___0rc	contig20315___0rc	Unknown	
5970	73	66	unmapped	0		0	AACGAAATGGAACAGCTCCCTGTTTACACAGACCTGACCCTCACAATCCCACACAAATAC	5861	0	UF_Msa_CF_125298	contig10766___0rc	contig10766___0rc	Unknown	
5971	73	67	unmapped	0		0	ATAAAGGCCTCAATTAAACAGCAGGACCAGAAAACCAAGGACAGACAGACACAACGCAAG	5863	0	UF_Msa_AF_109376	contig29630___1_nrnt	contig29630___1_nrnt	Unknown	
5972	73	68	unmapped	0		0	TCTGATGGACCATTCTGGTTTTGATACAAACTCTGAGTCCAGAAGCTTGTGAGGAGCAGA	5865	0	UF_Msa_CF_125327	contig08717___0rc	contig08717___0rc	Unknown	
5973	73	69	unmapped	0		0	GTCAGTCCTGCCGAGCTGTGCCAGCTGTCAAGTGCTGACAATAAAAGTGTACATAAAGAC	5867	0	UF_Msa_AF_106538	LMB_S454.sd.188.C1___1_nrnt	LMB_S454.sd.188.C1___1_nrnt	Unknown	
5974	73	70	unmapped	0		0	GTGATTTGGTGCTCTTCTGCCAACAAGGGAAGACCAATATAGTACATAAGATTTTAAAAA	5869	0	UF_Msa_CF_118054	contig31914___0	contig31914___0	Unknown	
5975	73	71	unmapped	0		0	CGTGATGGAGCAGCTGACTCACATGGAAGCCAACCTACAGCGGGTGAAGAAAGGTGACAC	5871	0	UF_Msa_AF_109754	contig01857___1_nrnt	contig01857___1_nrnt	Unknown	
5976	73	72		1028	E1A	0		479	1	(+)E1A_r60_1	E1A_r60_1	E1A_r60_1		CONTROL
5977	73	73	unmapped	0		0	GGCCATGGAGGAAGGTATACCCATCACTGATCCAAAGCACTTCTCTCAGATGAGTTTGGA	5874	0	UF_Msa_AF_100468	contig26888___1rc_nrnt-1	contig26888___1rc_nrnt-1	Unknown	
5978	73	74	unmapped	0		0	AGCGTGCCCTTGAGCTGAAGCAGCAGCACGAGGAGGATATGACAGTCGGCGGCTACGCCA	5876	0	UF_Msa_CF_125913	contig02102___0	contig02102___0	Unknown	
5979	73	75	unmapped	0		0	TTCATCAGCTGGGAGTCGGACAGGAAGGAGTAACACACTCTCGCAACAGGAAGATGGGGG	5878	0	UF_Msa_CF_121962	contig25890___0	contig25890___0	Unknown	
5980	73	76	unmapped	0		0	GGACACCCAGCGCCAGAGCTGCCTCTTCTCCTTCCTCTACCGTGGAACCCAGTTCATCTT	5880	0	UF_Msa_CF_118694	contig21226___0	contig21226___0	Unknown	
5981	73	77	unmapped	0		0	TGAGTCCACCTCCAGTTTAGCCCGCTTCTCACCCCTCAGCCCATTTCAGGAGGTCAAGCC	5882	0	UF_Msa_CF_119300	contig14662___0rc	contig14662___0rc	Unknown	
5982	73	78	unmapped	0		0	CTCTATAATTACATTGTCAACCTTATCCTCTCTGCCTGTACATTTAATTCTGTGTGATAG	5884	0	UF_Msa_AD_200240	DQ786404	DQ786404	Unknown	
5983	73	79	unmapped	0		0	AATCAACACACTGCAGGAGTGGTGTACAGGGTGTGAGGCGGTGCTGTGTGGTATTGAGGA	5886	0	UF_Msa_AF_106861	contig29152___1rc_nrnt	contig29152___1rc_nrnt	Unknown	
5984	73	80	unmapped	0		0	TCCATAAAGGAGCGTTTTAGCTGGCTAATGCTAGCTTGGTGTTTCAGAACCTCTTCTTAG	5888	0	UF_Msa_CF_124905	contig06124___0	contig06124___0	Unknown	
5985	73	81	unmapped	0		0	CATCCAGGGTAAGCAGCAGGACAAGGAGAAGCTCGGTCAGACAACCAAATCTTGGGGAGA	5890	0	UF_Msa_CF_118938	contig02270___0	contig02270___0	Unknown	
5986	73	82	unmapped	0		0	AAACCAGAACTGCCAGGGAACAGCTGAGGTAAGTGATGTGAACAGAGAATCCAAAATGGA	5892	0	UF_Msa_CF_121751	contig00464___0	contig00464___0	Unknown	
5987	74	1	unmapped	0		0	AACGCAGAGAAGAGGATGCTGATGTTGCCGCCCTGCTGCAGCAAACTCAGTCAGCACTGG	5737	0	UF_Msa_CF_120028	contig21813___0	contig21813___0	Unknown	
5988	74	2	unmapped	0		0	GAGAAAAATTGCTGATATCCCCATTGACCACCCTTCCTGCTCCAAGCAACATGCAGTATT	5739	0	UF_Msa_AF_105570	contig25112___1_nrnt	contig25112___1_nrnt	Unknown	
5989	74	3	unmapped	0		0	TGTGGTCGACCTGACCAACAACGACTCAGTACTGCTGGTGGACGAAGGTCCTCAGAACAG	5741	0	UF_Msa_AF_106972	contig27563___1rc_nrnt-1	contig27563___1rc_nrnt-1	Unknown	
5990	74	4	unmapped	0		0	TTTGATCACATCATTGTTCCTATGCACACAGACTTCTCAAGCTGAGTTAGTGAATGAGGG	5743	0	UF_Msa_CF_120588	contig20550___0	contig20550___0	Unknown	
5991	74	5	unmapped	0		0	TCTCTGGTCCGTGCTGGATCTCGGGCTCTGTACAGACCACTCTCTGCAGCAGTAGTCTCC	5745	0	UF_Msa_AF_103761	contig08517___1rc_nrnt	contig08517___1rc_nrnt	Unknown	
5992	74	6	unmapped	0		0	GTGTGTGGTCTAAACGTCCAGTAGCGCTGACCAGTCGAGATGGCTGACAACCGAGATAAA	5747	0	UF_Msa_AF_104635	contig12244___1rc_nr0nt	contig12244___1rc_nr0nt	Unknown	
5993	74	7	unmapped	0		0	GGTGCTCTCATCTCTGATCGCTGGGTTTTGACAGCTGGAAGGAACCTTTTTGTCAAAAAA	5749	0	UF_Msa_AF_107283	LMB_S454.sd.385.C1___1_nrnt	LMB_S454.sd.385.C1___1_nrnt	Unknown	
5994	74	8	unmapped	0		0	GCCATGGATGCAAGAACCCAATCACAGGGTTTGGCCACGGCACCAATGTGGTGAACTACG	5751	0	UF_Msa_AF_103554	contig24187___1_nrnt	contig24187___1_nrnt	Unknown	
5995	74	9	unmapped	0		0	TGAAGTTGTGCTGGAGTGGGTCTGGTGCTATGCTAACGGGCTAACAGCAGGACTTCAGGG	5753	0	UF_Msa_CF_118359	contig02550___0	contig02550___0	Unknown	
5996	74	10	unmapped	0		0	GTGTTACAGCTGTCAGCTGACCATCAAAGACATGTCGTCATTGGAACGTCTCCCGCAGTA	5755	0	UF_Msa_CF_119357	contig07174___0	contig07174___0	Unknown	
5997	74	11	unmapped	0		0	TTCAAACTCTTCAAATGACAGCCCTAAAAGACATTGTCCAGCTATGAACTACAGAGCATG	5757	0	UF_Msa_AF_102950	contig13804___1_nrnt0	contig13804___1_nrnt0	Unknown	
5998	74	12	unmapped	0		0	AAGAAGGATGCCGGGTTTGCTTACAGAGATTATGAGAACAGAGATCGATATTATGCTAAA	5759	0	UF_Msa_AF_108693	contig24076___1_nr1nt0	contig24076___1_nr1nt0	Unknown	
5999	74	13	unmapped	0		0	AGCACTGCTGTTCATTTCAGTCAAGCTTTTCGCCCTCTTCTACACAACTAGGGAATGTTG	5761	0	UF_Msa_CF_127108	contig24373___0rc	contig24373___0rc	Unknown	
6000	74	14	unmapped	0		0	AATCCAACCTCTTGAAATCCAGGGAAGAAGAAGAAAAACAGTTGCTGGGCAAGTGGATGC	5763	0	UF_Msa_CF_126245	contig18061___0rc	contig18061___0rc	Unknown	
6001	74	15	unmapped	0		0	CAAACAGCCCTCCCTTCACAGAACCTGCAGAGAGGACTAGGTTCTCATTCAAGAATGTGG	5765	0	UF_Msa_AF_103406	contig08807___1_nr0nt1	contig08807___1_nr0nt1	Unknown	
6002	74	16	unmapped	0		0	ATCATACCCCCCTCTAATGGAGACACCAAACAGGTGACAGCCCCCTGTACACAGGGAAAT	5767	0	UF_Msa_CF_124801	contig26497___0rc	contig26497___0rc	Unknown	
6003	74	17	unmapped	0		0	GCCACAATGGAAGAGGAAGACTGTCGATTTAACTGATGTAGGCCCATTAGAGGATAAAGT	5769	0	UF_Msa_AD_200060	LMB_Add_68	LMB_Add_68	Unknown	
6004	74	18	unmapped	0		0	ATTAGACAGGAACCAGGTTCATCAGAGGCGACACAACAGACCCAGAGAAGAGCGAGCAAG	5771	0	UF_Msa_CF_124734	contig29370___0rc	contig29370___0rc	Unknown	
6005	74	19	unmapped	0		0	ACTAGCGCTGACAGTGGTTTTAAAGAAGAAGAGCTAATAAAACAAATCCTCAGTTCGAAG	5773	0	UF_Msa_AF_100502	contig21423___1rc_nrnt0	contig21423___1rc_nrnt0	Unknown	
6006	74	20	unmapped	0		0	AAAGGTGTAGTGATCTTCTCTCGACTGCTGGACTTTAAAATCGACCCTCGTTGGATGGAA	5775	0	UF_Msa_CF_124831	contig22851___0	contig22851___0	Unknown	
6007	74	21	unmapped	0		0	ATGAACTGAGAGGGAGGTGGAATATTTCAAAAGGTTTTGCTTGGATTCTGCTCGGCAGAC	5777	0	UF_Msa_AF_102874	contig09064___1rc_nrnt	contig09064___1rc_nrnt	Unknown	
6008	74	22	unmapped	0		0	TCAGAGGGGCTTGAGAAGAGATGAGAGTAGAAGAGAAAATCGAGATGCTGGCAGTCCTCG	5779	0	UF_Msa_CF_124775	contig03794___0	contig03794___0	Unknown	
6009	74	23	unmapped	0		0	GGGACTGTGGGGATCCATGGAGACTCGCAGCACTACTTCCTGTCCTCAGCCTTCATGACG	5781	0	UF_Msa_AF_101376	contig17953___1_nrnt	contig17953___1_nrnt	Unknown	
6010	74	24	unmapped	0		0	CGACCGAATCATTAAAGATGACTACACGCTGTGCGACACTGACACAGACAGTCTGCAGCA	5782	0	UF_Msa_CF_121646	contig14288___0	contig14288___0	Unknown	
6011	74	25	unmapped	0		0	CCACAACCTCATTCAACTTATGTCATCTCACAGAGACCATTACGATTATGCAAAATAAAG	5784	0	UF_Msa_AF_108360	contig24850___1_nr0nt	contig24850___1_nr0nt	Unknown	
6012	74	26	unmapped	0		0	AGAAGACATGTCCTCTAAAGGCTGGAAAGCTGTGATAGACACCAACTTGACTGGAACCTT	5786	0	UF_Msa_AF_108689	contig28681___1rc_nrnt	contig28681___1rc_nrnt	Unknown	
6013	74	27	unmapped	0		0	ACTAATCGGAAATTCCAAGATGACAGTCGCTCAACAGTCATTCATCCCTTGCAGACAGCT	5787	0	UF_Msa_CF_122249	contig24174___0rc	contig24174___0rc	Unknown	
6014	74	28		0		0		1286	1	ETG05_66023	ETG05_66023	ETG05_66023		CONTROL
6015	74	29	unmapped	0		0	TTACATCTTCAGCGGTGCCTACGTCCCTCTGAGCTGCAAACTCATCGAGCAGGTGTTGGA	5790	0	UF_Msa_AF_103927	contig12997___1_nrnt	contig12997___1_nrnt	Unknown	
6016	74	30	unmapped	0		0	GTTTCAAACATGTGTCATCAGGACGCATACTTGTGTAAGTGGACATAAATCGAAATAAAT	5792	0	UF_Msa_AF_103229	LMB_S454.129.C1___1_nrnt	LMB_S454.129.C1___1_nrnt	Unknown	
6017	74	31	unmapped	0		0	ACACAACAGCCAGATCCAGCAGACTTTCTCTGAGCGGATGGAGGGAGCGTTCAGCGACTT	5794	0	UF_Msa_CF_125055	contig25981___0	contig25981___0	Unknown	
6018	74	32	unmapped	0		0	CAACGAGATCGCCATGCTGATATACAGGAATGGTTTGGTTTTTGATGTGAAGACAGATTC	5796	0	UF_Msa_CF_123537	contig15993___0rc	contig15993___0rc	Unknown	
6019	74	33	unmapped	0		0	TTTCAACCCAGCACGCTTCTTGGACGATGAGGGAAAGTTGATCAGGAAAGAGTGCTTTAT	5797	0	UF_Msa_AF_109439	contig24052___1_nrnt	contig24052___1_nrnt	Unknown	
6020	74	34	unmapped	0		0	TGTGTGTCGAGTCTCCTCAGTCTCAAGACCCCTACCCTCTCCTGGCCCTCCATGTTGTCA	5799	0	UF_Msa_CF_124617	contig09216___0rc	contig09216___0rc	Unknown	
6021	74	35	unmapped	0		0	CTGTTAGTGGAGAGAAAAGCGAAAATAAAGACTGATGGCATAATTCTTAGGTATTATAGG	5801	0	UF_Msa_AF_107752	contig19453___1rc_nr0nt	contig19453___1rc_nr0nt	Unknown	
6022	74	36	unmapped	0		0	TTATTGCTTGGGGTTCAGCCCTGTGGCAAAGACACCAACAACAATGGCAACTACAGTGAA	5803	0	UF_Msa_CF_123128	contig11045___0rc	contig11045___0rc	Unknown	
6023	74	37	unmapped	0		0	TATTATTCGGCCCTACGTGCGGGCCCAAAAGGAAGAAGACTTGGAGAAGCAGCGGGAGAG	5805	0	UF_Msa_AF_104134	contig23364___1_nrnt	contig23364___1_nrnt	Unknown	
6024	74	38		0		0		5807	1	DCP_20_1	DCP_20_1	DCP_20_1		CONTROL
6025	74	39	unmapped	0		0	ATTTGTGTGCTGTACACTCAAGGAATAGCCAACAGGGAATGGAGAGAGTTTGGCAGAACA	5809	0	UF_Msa_AF_108297	contig21288___1rc_nrnt	contig21288___1rc_nrnt	Unknown	
6026	74	40	unmapped	0		0	AATAAGAAGCCAATGCCTAAGTGATGCCCTTCTTTGCAACAAAATGCCGGGACTCTTGCT	5811	0	UF_Msa_AD_200176	LMB_Add_100_rc	LMB_Add_100_rc	Unknown	
6027	74	41	unmapped	0		0	GAAAACGGGGGTTTATGCATAATGCTCCTCTTCTTTCACTCAAAACAACCCATGACTCCC	5813	0	UF_Msa_CF_124002	LMB_S454.977.C1___0rc	LMB_S454.977.C1___0rc	Unknown	
6028	74	42	unmapped	0		0	AACCCCAGTGACGTGCTGGAGAAGAGGAACAAAATCAGAGAGCAGAACCGTTTTGATGTG	5815	0	UF_Msa_AF_105770	contig18468___1rc_nrnt	contig18468___1rc_nrnt	Unknown	
6029	74	43	unmapped	0		0	AAAGAAGATAGCTAACATGAAGCCTGCAGACTTAGGAGTAGCGCTCACATCACAGTTGGA	5817	0	UF_Msa_AF_105177	contig31454___1_nr0nt	contig31454___1_nr0nt	Unknown	
6030	74	44	unmapped	0		0	CAAAAAGGTGCCTGTCGCTGTGATAAAGTCTTTCAACATCCTCCCAGTGAAATTATCTAG	5819	0	UF_Msa_AF_108038	contig19348___1_nr0nt	contig19348___1_nr0nt	Unknown	
6031	74	45	unmapped	0		0	AGTCACCAACAATCAGCTTTTGCGAGTCAAGTACCTGCTTGTTTACTCTCAAAGGAGGCA	5821	0	UF_Msa_AF_109756	contig14048___1rc_nrnt	contig14048___1rc_nrnt	Unknown	
6032	74	46	unmapped	0		0	GTCCGTAAAGTTTTGAAAATGGTGCAACAACTCTCCAAATCTGGAGCGAAGGAGACTCCT	5823	0	UF_Msa_CF_117745	contig03691___0	contig03691___0	Unknown	
6033	74	47	unmapped	0		0	ACACATTGGTGTGTGGATTCGAACACAGGTCTCTCACACCAAAGGCATGTATCTTATCCA	5825	0	UF_Msa_AF_102385	contig18887___1_nr0nt	contig18887___1_nr0nt	Unknown	
6034	74	48	unmapped	0		0	TGATCTACCTGACAGTGGAGGATGTCTTCCAGCTCATCAACTACTACAGCTTTAGCTACT	5826	0	UF_Msa_AF_106320	contig24522___1rc_nrnt	contig24522___1rc_nrnt	Unknown	
6035	74	49	unmapped	0		0	TCTGGAAAAAGAGTGCAGAGCTTGAGACACACATTAGGCAGTGGACGCGGACGAAACGGC	5828	0	UF_Msa_AF_101610	LMB_S454.309.C1___1_nr0nt	LMB_S454.309.C1___1_nr0nt	Unknown	
6036	74	50	unmapped	0		0	CGCTATTTATGTTTATTTTTAGCATGTCTTGGAATGCCATGTTCTTAGTACTTCTGACAC	5830	0	UF_Msa_AF_100379	contig32841___1_nr0nt1	contig32841___1_nr0nt1	Unknown	
6037	74	51	unmapped	0		0	AAACAGTCTGGCGTCCCGTAAGAAGCTCCTCCCCATCGTTAAGGACTTCCTGAAGGGGCA	5832	0	UF_Msa_AF_105542	contig11778___1rc_nrnt-1	contig11778___1rc_nrnt-1	Unknown	
6038	74	52	unmapped	0		0	GGAGGTCGACAAAGGAGGATGGATCCAGAATTATTTGCCTCTGCAATGAAAATAAACGAG	5834	0	UF_Msa_CF_121631	contig18819___0rc	contig18819___0rc	Unknown	
6039	74	53	unmapped	0		0	AGCAAAGAAACTCCGCGAGCAAAGGAAGTTTGGTAAAAAGGTCCAAATAGAAGTAATCCA	5836	0	UF_Msa_AF_106675	contig14084___1_nrnt0	contig14084___1_nrnt0	Unknown	
6040	74	54	unmapped	0		0	ATGGATGACCTACACAAACTTAAGTTGCTGGCTCAGGGTTTGGTACTGAATGCAGAAACG	5838	0	UF_Msa_AF_108560	contig31550___1_nrnt0	contig31550___1_nrnt0	Unknown	
6041	74	55	unmapped	0		0	ACGCTTTCAACGTTCCTGTGTGCTGTTTTGTCTGCACAGGCTGAGATCGCCACCTCGAGC	5840	0	UF_Msa_AF_100343	contig07217___1rc_nrnt0	contig07217___1rc_nrnt0	Unknown	
6042	74	56	unmapped	0		0	TCATCTGAATAGCATGGATGTCTCAGAGGACGACTACTATTACCATGAAAACATCAGTTT	5842	0	UF_Msa_CF_119791	contig12022___0rc	contig12022___0rc	Unknown	
6043	74	57	unmapped	0		0	TGGCCAAACAAACTTTAATGTTCTGAGCATGATCTTAAGCCGAAAGTGCTTGATAGCATC	5844	0	UF_Msa_AF_106776	contig28700___1_nrnt	contig28700___1_nrnt	Unknown	
6044	74	58	unmapped	0		0	AAGATCAAGAGGCCTCGAAGCAGTAATTCTGACGCATTGTACTGATGTTCATCCAGCCAT	5846	0	UF_Msa_AF_110075	contig06733___1_nrnt	contig06733___1_nrnt	Unknown	
6045	74	59	unmapped	0		0	CCATGGAGTACCTGCGCTTCAGAGAGCTGCCCGCAGGGATCAACTCCATTGTGGCGATTG	5848	0	UF_Msa_AF_109143	contig20949___1_nr0nt	contig20949___1_nr0nt	Unknown	
6046	74	60	unmapped	0		0	TTACCCTGGTCTGTCAGAAGGAGCCTTAACCTTCATGAAGAGCAGCCTGAATAACAAATC	5850	0	UF_Msa_AF_100448	contig13566___1_nrnt	contig13566___1_nrnt	Unknown	
6047	74	61	unmapped	0		0	GCTTAGTACTTAGTTAGACAACAGGAGCAGGAGAAGCTGCTTTCAGGAACATAAAGACCA	5852	0	UF_Msa_AF_107724	contig26255___1_nr0nt	contig26255___1_nr0nt	Unknown	
6048	74	62	unmapped	0		0	TGTGGTTCAACAAAGCACGACTGTTACAGATAAGACTAGCGTGCACAGCCTGAAGGGTCA	5854	0	UF_Msa_CF_124072	contig27570___0	contig27570___0	Unknown	
6049	74	63	unmapped	0		0	AAGATGTTCAATGGCTCAATCCCTCCTGCCCATCAAACGTTCACTGTCCAGCCTACAAGC	5856	0	UF_Msa_CF_121933	contig26057___0rc	contig26057___0rc	Unknown	
6050	74	64	unmapped	0		0	GCTGTTTCAGGGATTCCTCTTGGTGAAGTCGTCTTGTTCAACATCTTCTATGAGGTTTTT	5858	0	UF_Msa_AF_104687	contig10339___1_nrnt	contig10339___1_nrnt	Unknown	
6051	74	65	unmapped	0		0	CAGCTAAAACAAAATGACTTCACCATCATGGGATACAGCTTTTTCTCAGGACTGAATAAA	5860	0	UF_Msa_AF_106448	LMB_S454.793.C1___1_nr0nt	LMB_S454.793.C1___1_nr0nt	Unknown	
6052	74	66	unmapped	0		0	TTCACTGTGTGGCGGATCAGACCGATGAGGCTCTCAAATACTGTTTAATCGCAGACGTTG	5862	0	UF_Msa_CF_123896	contig00554___0	contig00554___0	Unknown	
6053	74	67	unmapped	0		0	CAAACGGAAGCTGATCTTTAAGACGCGCCCTAAACCCATCATCACTAATGTACCCAAGAA	5864	0	UF_Msa_AF_100282	contig27763___1rc_nrnt	contig27763___1rc_nrnt	Unknown	
6054	74	68	unmapped	0		0	GAAGAATACAGGTGAATGCTGTAGGAGAGATTCATGGTTCCTAATTTTACATAACCTATT	5866	0	UF_Msa_AF_106187	contig28765___1_nr1nt0	contig28765___1_nr1nt0	Unknown	
6055	74	69	unmapped	0		0	AATGTCATTCTGACTCAGTTTAACTCAAGAGGAGGCGCTAAAGTGCTCAGACATTCAGAG	5868	0	UF_Msa_CF_124073	LMB_S454.351.C1___0rc	LMB_S454.351.C1___0rc	Unknown	
6056	74	70	unmapped	0		0	TCTGGTGAAGCTGGTGTACTTTGAGCCCAAAGACATCACAGCAGAGGAGGAGCAGGAGGA	5870	0	UF_Msa_AF_108562	contig31192___1rc_nrnt	contig31192___1rc_nrnt	Unknown	
6057	74	71	unmapped	0		0	TAAAAGAAAAACAAACAAACTGGGTTTAACCTGCGACGCCCCATACCGCGACGAATTCGT	5872	0	UF_Msa_CF_117923	LMB_S454.470.C1___0	LMB_S454.470.C1___0	Unknown	
6058	74	72	unmapped	0		0	CCCGCATACTGCTGACTTCTCTTCTGGTATCCCTGCTCTGCAAAGCTATAGACTTTGAAG	5873	0	UF_Msa_AF_104647	contig24556___1_nr0nt1	contig24556___1_nr0nt1	Unknown	
6059	74	73	unmapped	0		0	CATTGAGAGATCCAATGTTGCAAGAAATGTTTATCCTATTCAACCACTGATTATCTTCTG	5875	0	UF_Msa_AF_102868	contig27984___1_nrnt	contig27984___1_nrnt	Unknown	
6060	74	74	unmapped	0		0	ATCCTCTATGGCGCGTACAAACATAGGTAACTGGGGAAACAAAGAGTTTCTTCAGCTTTG	5877	0	UF_Msa_CF_120308	contig20287___0rc	contig20287___0rc	Unknown	
6061	74	75	unmapped	0		0	TCCCCTTTTTCATATAGATGCAGGGTGATGGGGTAGAAAGGAATGGAAAGGTGTGATTGG	5879	0	UF_Msa_AD_200049	LMB_Add_143	LMB_Add_143	Unknown	
6062	74	76	unmapped	0		0	ATGAGAGTGAAAGCAACAAAACTGTGTCTTCCTCTGCCTCCTCTGTTAAGACTGAGCACT	5881	0	UF_Msa_CF_126037	contig17252___0	contig17252___0	Unknown	
6063	74	77	unmapped	0		0	ATCGTCTTGGAGTACGATCGCCGATTCGCCGCCTACGGTGACGACTTTGTCTTCTACGAC	5883	0	UF_Msa_AF_102762	contig14801___1rc_nrnt	contig14801___1rc_nrnt	Unknown	
6064	74	78	unmapped	0		0	ATTCCTGTCAATAGTACACTGATTGGTTGCTGGGCACATGTAGTCATTGTGACCCTGGAT	5885	0	UF_Msa_AD_200201	LMB_Add_163_rc	LMB_Add_163_rc	Unknown	
6065	74	79	unmapped	0		0	TTTTGACAAAGCTGAAGAGGGATGTCCGTTCTTTGCTCATTTCATCTAAGACGGGCTTGG	5887	0	UF_Msa_CF_125705	contig04007___0	contig04007___0	Unknown	
6066	74	80	unmapped	0		0	CAGAATGGAGAGTGAGTTCCCCGGGAAAATACCTCTTGGTCCTCCCCGTCAGCAACAGAT	5889	0	UF_Msa_CF_125503	contig20821___0rc	contig20821___0rc	Unknown	
6067	74	81	unmapped	0		0	AAACTCTAAAGCCTGGCTCTCCTTCTCTTGTAAGGATGGGAAGTGTATATCAGATGGCAG	5891	0	UF_Msa_AF_109454	contig21349___1rc_nrnt-1	contig21349___1rc_nrnt-1	Unknown	
6068	74	82	unmapped	0		0	GGGGTATGGGGGGCACTGCCATCATCAGGGTGGCCTGGTACTGGTCCAACCTGTGGAAAT	5893	0	UF_Msa_AF_108858	contig20161___1_nrnt	contig20161___1_nrnt	Unknown	
6069	75	1	unmapped	0		0	AAGAAGCCCAAGCTGGACATCACCAAGGCTGTGAATAAACAGATGAGAGAGGAGGACCGA	5894	0	UF_Msa_AF_103217	contig05412___1_nrnt	contig05412___1_nrnt	Unknown	
6070	75	2	unmapped	0		0	GGAGTATGTGGGAGATGCGGAAAGAGGAAGAGCTATGTTTTATGAGAAATAAATTAGAAA	5896	0	UF_Msa_CF_123447	contig08798___0	contig08798___0	Unknown	
6071	75	3	unmapped	0		0	CCCACAATTGTAAGTTGATAGAAGATTCAGACTATTGACTCCTGGGTTGTAGAGTTATTC	5898	0	UF_Msa_CF_120918	LMB_S454.1046.C1___0rc	LMB_S454.1046.C1___0rc	Unknown	
6072	75	4	unmapped	0		0	GTTTTGGATTATTTGACAGAAGTTGAGGAGGCAGCTGAGGATGTCCTCGCCACTAAACAA	5900	0	UF_Msa_CF_123355	contig11805___0	contig11805___0	Unknown	
6073	75	5	unmapped	0		0	AGACACAGACCAGCGGAAAGCTTAATTCTGTCACCAAAGTGACGGCCCCCACTCCAAGCC	5902	0	UF_Msa_CF_126784	contig09231___0	contig09231___0	Unknown	
6074	75	6	unmapped	0		0	AAATGGACAGATGTGCCTTTCATGTGTGCAAAAGCTCGGGAGTCCTACGGTTTCAACAAT	5904	0	UF_Msa_AF_107389	contig03740___1_nr1nt0	contig03740___1_nr1nt0	Unknown	
6075	75	7	unmapped	0		0	ACTCAGGATACACAGAACCTCTACATTACGCCAGTGGATTGTGGGCCAACAACAGTTTAG	5906	0	UF_Msa_CF_119287	contig14567___0	contig14567___0	Unknown	
6076	75	8	unmapped	0		0	CAGTCTGTGCATTTTGGAAGCCCTCTTCCTCTTAAGGTCATTATGTATTATAGAAATAAT	5908	0	UF_Msa_AF_102828	contig13153___1_nr0nt1	contig13153___1_nr0nt1	Unknown	
6077	75	9	unmapped	0		0	TGTTCTTGATGTCTTGGATGCTTCTCGTGAAAATTGGGCATTTCTGTTCCGCTCTTCCTC	5910	0	UF_Msa_CF_126322	contig06451___0rc	contig06451___0rc	Unknown	
6078	75	10	unmapped	0		0	ACAGATTCCTTCGTGTCCAATGAACTAGATGACCCCGATGACCTAATTGTGACCCGTAAA	5912	0	UF_Msa_AF_107076	contig12285___1_nrnt	contig12285___1_nrnt	Unknown	
6079	75	11	unmapped	0		0	ATGTGGTCTGACTCTGCCTGGATGATCAGCTGTACAGTAAACGCATTGCTATTTATTGCC	5914	0	UF_Msa_CF_123804	contig04309___0	contig04309___0	Unknown	
6080	75	12	unmapped	0		0	TCTGGCAGCTTCATTGCGGAGCCTCTGCCGCTCAAGACTGGCTCTTCGCACAAATGTATC	5916	0	UF_Msa_CF_127406	contig24852___0rc	contig24852___0rc	Unknown	
6081	75	13	unmapped	0		0	GTCAAACGTTAAAACATAGGGCTGAGCCATGGCCAGCTTTCAGATTCGGAAGTATCGGGA	5918	0	UF_Msa_AF_101205	contig00705___1_nr0nt	contig00705___1_nr0nt	Unknown	
6082	75	14	unmapped	0		0	TCAACTGTGAGAAAAAGGTTTTAGCAATCCACAGTGAAGCAGAGAAAGAGAGGACAGAGG	5920	0	UF_Msa_CF_125221	contig00632___0rc	contig00632___0rc	Unknown	
6083	75	15		1028	E1A	0		1348	1	(+)E1A_r60_a20	E1A_r60_a20	E1A_r60_a20		CONTROL
6084	75	16	unmapped	0		0	AGAGCAAAATCATCAAGTCTTGCCCAGAGTGTCGAATCACATCCAACTTTGTCATCCCCA	5923	0	UF_Msa_AF_102485	contig11831___1rc_nrnt	contig11831___1rc_nrnt	Unknown	
6085	75	17	unmapped	0		0	GTATGTGAAGCAACGATGGGGCTGCTTTAGCTTCTAGCCTGGATCACAAAAAGGTGCTGT	5925	0	UF_Msa_CF_122276	contig07102___0rc	contig07102___0rc	Unknown	
6086	75	18	unmapped	0		0	AAGGACGACAGTTTTGTTTCCAAGGCTATGGAGTACATGTTTGGCTGGTGACATTGCACA	5927	0	UF_Msa_AF_100278	contig25004___1rc_nrnt-1	contig25004___1rc_nrnt-1	Unknown	
6087	75	19	unmapped	0		0	ACGGCAATGTCAACCTCACAATGTGGGACGCCACACCTGTAGGTTGTCAGATTATGGGGT	5929	0	UF_Msa_AF_106026	LMB_S454.sd.611.C1___1_nrnt	LMB_S454.sd.611.C1___1_nrnt	Unknown	
6088	75	20	unmapped	0		0	CTCTGAGCAGCAAACATCAGGCAGTAGTGACCCACACTGGAGGGACGGTGGTGTAAACAG	5931	0	UF_Msa_AF_109719	contig01371___1_nr0nt	contig01371___1_nr0nt	Unknown	
6089	75	21	unmapped	0		0	GAGGGAAGGCGTTACATCTTTCTGCAGTGACAAAGATGACCACAAGAGAGCTGAGTACCT	5933	0	UF_Msa_CF_118493	contig22914___0rc	contig22914___0rc	Unknown	
6090	75	22	unmapped	0		0	GGACTAGTTTCATGATGGTGACGGACTGTAGAGAAAAATCCTCCACCAAAGATAAAAAAT	5935	0	UF_Msa_AD_200154	LMB_Add_22_rc	LMB_Add_22_rc	Unknown	
6091	75	23	unmapped	0		0	AGCAGTTCTCCCATGATGCGTGTCAGAGTCGTGAACAGGTTGAAGCATCTTACAGGGTGC	5937	0	UF_Msa_CF_119871	contig17440___0	contig17440___0	Unknown	
6092	75	24	unmapped	0		0	AAGGGTGTTGGTGTTTTGGTGTAGCAAGGTTTGGTGCGTGGCACTTGGAGAGTTTGGCCA	5939	0	UF_Msa_CF_122534	contig20531___0	contig20531___0	Unknown	
6093	75	25	unmapped	0		0	GGCAAGAAGGACAAGGAGCGATCAGGACAGAACATGGACATACAGGAGGTGAAGTTCAAG	5941	0	UF_Msa_CF_118531	contig15431___0	contig15431___0	Unknown	
6094	75	26	unmapped	0		0	ACGGACAGCGTGATGTGTTTCGGGCCCCTCGTTCCCGACGGTTATGCCATTTGTTACAAC	5943	0	UF_Msa_AF_108484	contig02773___1rc_nr1nt0	contig02773___1rc_nr1nt0	Unknown	
6095	75	27	unmapped	0		0	CATCTGGTTGGGCCCTTAGCCTACTTCCTGGAGTTTGAAGGCTACAACACCTTCTTGTTG	5945	0	UF_Msa_CF_121963	contig26242___0	contig26242___0	Unknown	
6096	75	28	unmapped	0		0	CTGTCCTTACACCAAGCCCACGTTTCTTGCATGTCCTGGCCATCTGGGGCGTTTGGTGGT	5947	0	UF_Msa_CF_125216	contig26726___0rc	contig26726___0rc	Unknown	
6097	75	29	unmapped	0		0	TTGCAGAGCAAATGGAGGATCTGTACCAGCAGCACACCAGCTTGCCCCAGAGGCACAAGA	5949	0	UF_Msa_CF_124269	contig22869___0	contig22869___0	Unknown	
6098	75	30	unmapped	0		0	TAAAGCTCCTCCATCACGCACATTGCACCGATGTTACAATTATACGCATTGGGACATCAG	5951	0	UF_Msa_AF_105780	contig27495___1_nrnt	contig27495___1_nrnt	Unknown	
6099	75	31	unmapped	0		0	AGCGACGATCTCCTGGTGCAGTCAGATGAGGAGGACGTCCAACCCGATATGTCATTGGCT	5953	0	UF_Msa_CF_123263	contig12981___0rc	contig12981___0rc	Unknown	
6100	75	32	unmapped	0		0	AGAGCAAGAGAGAGGTGGAAGAAAAGGGGAGTGACGACAGCAGGACACTTTCAGAAAAAG	5955	0	UF_Msa_CF_123413	contig22156___0	contig22156___0	Unknown	
6101	75	33	unmapped	0		0	ATTTATAGTGTTCTCAAGAACACACACCCCGCTCTTTTTATTAGATTTCACATCCCCGCT	5957	0	UF_Msa_CF_119546	GP3-1C4.g___0	GP3-1C4.g___0	Unknown	
6102	75	34	unmapped	0		0	ATGAGAATGAGAGAAGAAAACGCTGTCTTCACTCCTGTTAAAATTGTCTCTAAAAGAGGA	5959	0	UF_Msa_CF_122284	contig13841___0rc	contig13841___0rc	Unknown	
6103	75	35	unmapped	0		0	GCGGCGAGGTGGATGGACTGAAAGGTGGAGAGAGGGTTATCTGGCCCGAGCCTAAAGCGA	5961	0	UF_Msa_CF_118731	contig00505___0	contig00505___0	Unknown	
6104	75	36	unmapped	0		0	CCGACACACTTGTATTCCATTGTGATTATCGTATTGCATCGCCACAGCAGTAAAACAGTC	5963	0	UF_Msa_AF_108655	contig12475___1rc_nrnt	contig12475___1rc_nrnt	Unknown	
6105	75	37	unmapped	0		0	AATCTCACCATGTTTGAGGACACAGCAAATAAACGTATACCCATGCGTGTTAATTCCAAA	5965	0	UF_Msa_CF_120472	contig01535___0	contig01535___0	Unknown	
6106	75	38	unmapped	0		0	AAGGTTCCGCTGTCCCGAGACTCTCTTCCAGCCTTCATTCATTGGAATGGAGTCGGCTGG	5967	0	UF_Msa_AF_103913	LMB_S454.sd.590.C1___1_nrnt	LMB_S454.sd.590.C1___1_nrnt	Unknown	
6107	75	39	unmapped	0		0	TCTATAAACCTGTAGTAACACCATTTGAGATGGAGGTGGCCTGCAACAAGAAGAGGGAGT	5969	0	UF_Msa_AF_100529	contig28552___1_nrnt	contig28552___1_nrnt	Unknown	
6108	75	40	unmapped	0		0	GTCTCTGATCAACTCCCTCCCCTATGACACAGAGCTGGATCTGTGCTCTTCATGGACCAG	5971	0	UF_Msa_CF_124943	contig03633___0rc	contig03633___0rc	Unknown	
6109	75	41	unmapped	0		0	GTGAGATGTGGGGTTACAGGATACTACGTCGAAAAGAAAGTGGAAGACTCAAAGGCATTC	5973	0	UF_Msa_AF_103815	contig30164___1_nr0nt	contig30164___1_nr0nt	Unknown	
6110	75	42	unmapped	0		0	TGAAATATAAAACACTAAGGCAGAATGTACCCTGCGGCGCATAACATCTGCAGGAGTGGA	5975	0	UF_Msa_CF_125985	contig16114___0	contig16114___0	Unknown	
6111	75	43	unmapped	0		0	TTAACTATAACCCCTGCTGCTACCAAAGACCGATCCTGATTCTAATTTAGTCCTCATTCT	5977	0	UF_Msa_AF_105013	LMB_S454.sd.133.C1___1_nrnt	LMB_S454.sd.133.C1___1_nrnt	Unknown	
6112	75	44	unmapped	0		0	CAAGTGGACCCACTGGATCAGCAGGAGGGAGCTCTTCATGATGGACACAGATTACCATCA	5979	0	UF_Msa_CF_123865	contig25341___0	contig25341___0	Unknown	
6113	75	45	unmapped	0		0	GGAAACATCTTTACAGTCAATCTGCCAACTCAACAGCGGGGAAACTTTGTTAAAGTCCTC	5981	0	UF_Msa_CF_126026	contig06839___0rc	contig06839___0rc	Unknown	
6114	75	46	unmapped	0		0	TATATCCCACCCCCACCCGTCTGCATCGTACCAGAACATCAGAACGTGAAGGCTCCCACT	5983	0	UF_Msa_CF_124845	contig10352___0rc	contig10352___0rc	Unknown	
6115	75	47	unmapped	0		0	GTCTAAATGTAACTCCAAATAGCTTTTGGAGTACAGCTGTACTTTTATTTTTCTCCCCAT	5985	0	UF_Msa_CF_125174	LMB_S454.sd.182.C1___0	LMB_S454.sd.182.C1___0	Unknown	
6116	75	48	unmapped	0		0	TCAGGCGACGAGGAACAATCTGGGCCCATGTGGGCAGCAGAAGAAGATGATGATCCAGAA	5987	0	UF_Msa_AF_106319	contig02407___1rc_nrnt0	contig02407___1rc_nrnt0	Unknown	
6117	75	49	unmapped	0		0	GTTTCATCACTCAGTCTTATCAAAAGAACAGTACTGATCACATGAGTCACAGTGGGGAAG	5989	0	UF_Msa_AF_101022	contig07753___1_nr0nt	contig07753___1_nr0nt	Unknown	
6118	75	50	unmapped	0		0	GCAGACAGTATTCATTGCCTTACCACCACATATTAAAAAGCCAGCACTGAACGTAAAAAA	5991	0	UF_Msa_AD_200271	LMB_Add_165	LMB_Add_165	Unknown	
6119	75	51	unmapped	0		0	GGAGACTGGGGTTTGCCTTCTGTCCACAGCGAGTCGCTCATAGTTTTGGCCTATGCCAAG	5993	0	UF_Msa_AF_107800	contig08657___1_nrnt	contig08657___1_nrnt	Unknown	
6120	75	52	unmapped	0		0	ATAACGGAGCCTCGACTAAAACATTTGCCCGTGTTCCTCGTTCACCGGACTGCGATGCCG	5995	0	UF_Msa_CF_119841	contig09587___0	contig09587___0	Unknown	
6121	75	53		0		0		5997	1	DCP_22_4	DCP_22_4	DCP_22_4		CONTROL
6122	75	54	unmapped	0		0	TTTTCTGTACTTCAGCATTCTCCTTTTCAAGGTCACTGAACTGCAGCTCCAACTCAGCTA	5999	0	UF_Msa_AF_105989	contig30595___1_nr0nt1	contig30595___1_nr0nt1	Unknown	
6123	75	55	unmapped	0		0	CGGCTGTCCGTGAGGCCGCGCGCGGCTCCGTGTTCTTCGCGCCGTCGCCCGGTGTTGTCG	6001	0	UF_Msa_CF_119804	contig02781___0	contig02781___0	Unknown	
6124	75	56	unmapped	0		0	CAAATAGGAAGAGACGAAGGAGAAGGTCAAGAATTAAAAAATGGCAGCCCGCAGTATGTT	6003	0	UF_Msa_CF_124242	contig10628___0	contig10628___0	Unknown	
6125	75	57	unmapped	0		0	GCTGGCGCTGACACCCACAATGGGCTGGTTGCACTGGGAGAGATTCTTGTGTAATATCGA	6005	0	UF_Msa_AF_105962	contig11191___1rc_nrnt	contig11191___1rc_nrnt	Unknown	
6126	75	58	unmapped	0		0	TCCCAGCGCTCCGCAGTCCGTCCTCACATCGTTACAAACTTTACGTCTGGAAAATGTTTC	6007	0	UF_Msa_CF_118603	contig03093___0rc	contig03093___0rc	Unknown	
6127	75	59	unmapped	0		0	CAGCAACACAGTTTACAGAGACAAAATGGGACTTTCAGCCATCCTTTTTCTCAGTGCCTT	6009	0	UF_Msa_CF_125192	contig09600___0	contig09600___0	Unknown	
6128	75	60	unmapped	0		0	TCAAGACAACGAGTGCAGAGACTACCGCCTCGAGCATTCTGAGGGAGAGTCGCTCTTCTA	6011	0	UF_Msa_CF_120146	contig15444___0	contig15444___0	Unknown	
6129	75	61	unmapped	0		0	GACAACATGGCTGCACTACTCCCTGTGTTGTGATTTAATCTAATAAAAGGAACTCTATAG	6013	0	UF_Msa_AF_106368	LMB_S454.sd.286.C1___1_nr0nt1	LMB_S454.sd.286.C1___1_nr0nt1	Unknown	
6130	75	62	unmapped	0		0	AATTTGATGCTGATGTCCAGACCATGTCTCCAGAGGCATCAGAATATGAGACTTGCTATG	6015	0	UF_Msa_AF_109422	contig19452___1rc_nrnt	contig19452___1rc_nrnt	Unknown	
6131	75	63	unmapped	0		0	AGGTCAGAGGTGACCAAGCTGATTGGTATCAATGAGAAGGCTGCTTTCAACCAGGCTGAG	6017	0	UF_Msa_CF_124957	contig02708___0rc	contig02708___0rc	Unknown	
6132	75	64		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
6133	75	65	unmapped	0		0	TATCTCGGACAGAGCCGTGCAGTTCTTGGATGGACACCGGCTTGCTCAGCACTCTATCTG	6020	0	UF_Msa_CF_119336	contig23985___0rc	contig23985___0rc	Unknown	
6134	75	66	unmapped	0		0	GGGGATTACAGCTGCCATCAGCTAGTTAGCTGGTGTGAAACTCCTAAAGTATACAAAAAG	6021	0	UF_Msa_CF_118708	contig06937___0	contig06937___0	Unknown	
6135	75	67	unmapped	0		0	GTAGTGCTGTGTTAGTTTTGGTTTGAGAGGAACAAATGTCTTCAGAGATTATCATGTTTG	6023	0	UF_Msa_CF_123479	contig18551___0	contig18551___0	Unknown	
6136	75	68	unmapped	0		0	TCTAGAAGACCCCAAAACACTTACCCACCATAAACTCATACATGCTGCTACGGAGAGAGT	6025	0	UF_Msa_AF_106974	contig07748___1_nrnt	contig07748___1_nrnt	Unknown	
6137	75	69	unmapped	0		0	CAACCTTCAGTGTACTTAAAAACAGCCTTTAACACACATCCATGATCATGTTAAGAACAG	6027	0	UF_Msa_CF_127561	LMB_S454.36.C1___0rc	LMB_S454.36.C1___0rc	Unknown	
6138	75	70	unmapped	0		0	TAGTGTGAGCTGGGGAAAGTGGAAAAAGGAATCTGAAGGAACGCTAAATTCTGTTCTCAA	6029	0	UF_Msa_AD_200250	LMB_Add_112_rc	LMB_Add_112_rc	Unknown	
6139	75	71	unmapped	0		0	AACTGAAGGCAACCACCTTCAACTACCTGTCCAGCTGTATCATGGTCACTGTGACTCCAG	6031	0	UF_Msa_CF_127259	contig23468___0	contig23468___0	Unknown	
6140	75	72	unmapped	0		0	ATGACCAGAACCATGAGAAGATCCGTCTCAGTGACAACAACATTGCTGCTTTTCCAGACA	6033	0	UF_Msa_AF_105746	contig26483___1rc_nrnt0	contig26483___1rc_nrnt0	Unknown	
6141	75	73	unmapped	0		0	GCAGTGTGACATGCAGAAGTGAGCTCTCCCTGCTCGCTCCTCTTCTCACTGTAATCCACA	6035	0	UF_Msa_AF_104954	contig31666___1_nr0nt	contig31666___1_nr0nt	Unknown	
6142	75	74	unmapped	0		0	TAAACAAGAAGACGATGGCAAAATGACTGCCAGTGCTAAGGGCAGAGTCATCATCCTCAA	6037	0	UF_Msa_CF_126344	contig07292___0	contig07292___0	Unknown	
6143	75	75	unmapped	0		0	CGCGCCACGACCCGGATGAAGTTCTGTTCAACTTTATATCCCACAATTCCTTTCTGCGCC	6039	0	UF_Msa_AF_104683	contig15581___1_nr0nt	contig15581___1_nr0nt	Unknown	
6144	75	76	unmapped	0		0	GGAAGACAACCTCCCTCTCTCAAGTCAGGAGGTTTGACGTCAAGACCTTTGCCTTCTTGG	6041	0	UF_Msa_AF_109927	contig28312___1_nrnt	contig28312___1_nrnt	Unknown	
6145	75	77	unmapped	0		0	TCTACATACCTGCTTGTGTCCCACTTTGGCGATGCTCTGGTTGCTGTGCGGATGAGAACC	6043	0	UF_Msa_AF_106786	contig23685___1rc_nrnt-1	contig23685___1rc_nrnt-1	Unknown	
6146	75	78	unmapped	0		0	CTTAAAACCCCAGACAGGACTTTCTTACGACTAAAACCGGCCCCTGTCAGCACTAAAAAA	6045	0	UF_Msa_CF_120440	contig12553___0rc	contig12553___0rc	Unknown	
6147	75	79	unmapped	0		0	GGAGCCCGCCGGGGCAGACGAGACGAAAGAGCAGAAGAGGAGGAGGAGCAGGAAGAAGAG	6047	0	UF_Msa_AF_109929	contig32450___1_nr0nt	contig32450___1_nr0nt	Unknown	
6148	75	80	unmapped	0		0	AACTACCCAGAGTGGAAACAGAAGCACTCTCCCGACCTGAAGCCCTGGTTGTACCCAGAG	6049	0	UF_Msa_AF_102337	contig28670___1rc_nr1nt0	contig28670___1rc_nr1nt0	Unknown	
6149	75	81	unmapped	0		0	CACATCAGGAAAAATACGCTGCCTCAAAACGCTACTCGACCGAGCTGTTTGGTGTTTTTT	6051	0	UF_Msa_CF_118154	LMB_S454.841.C1___0	LMB_S454.841.C1___0	Unknown	
6150	75	82	unmapped	0		0	TGAGTGAAAATGTCCCCACCCTGGTTGGCGTCCTACACTGCTGGTGGAGGATTCATCTGG	6053	0	UF_Msa_AF_105022	contig21055___1_nr0nt	contig21055___1_nr0nt	Unknown	
6151	76	1	unmapped	0		0	TCATGCCCCCACACTCCAGGTTAATTCCCAGCACCTGCAGGAGAAATGTCAGCAGATGGC	5895	0	UF_Msa_CF_125429	contig09153___0rc	contig09153___0rc	Unknown	
6152	76	2	unmapped	0		0	ACAGAGCAACAGACTTTGTTGTGGACCAGCCTGGCAAATTCAAGATTATCTTCTCACCTG	5897	0	UF_Msa_AF_103536	contig29952___1_nrnt	contig29952___1_nrnt	Unknown	
6153	76	3	unmapped	0		0	AACGGGGACAGAGCGAGACAGACGTTATACCAAATCACTTCTGTAACACGAAGGGAGATA	5899	0	UF_Msa_CF_126407	contig14959___0	contig14959___0	Unknown	
6154	76	4	unmapped	0		0	ATGCAAGGTACTACAAGGACGCCCTCGACCCGAAGGGCCTGATGAATCCTGAGAAAATTC	5901	0	UF_Msa_AF_108377	contig05548___1rc_nr1nt0	contig05548___1rc_nr1nt0	Unknown	
6155	76	5	unmapped	0		0	GCCGGTCCATATCAGGATCTGTTGTCAAATATTTCGTATGTTCAAAAAACCCTGTTTTTT	5903	0	UF_Msa_AF_107896	contig13787___1_nr0nt	contig13787___1_nr0nt	Unknown	
6156	76	6	unmapped	0		0	GTGCGTGAGATACAACAGTAGGAGGTCAGCATTTTGAAACAGAACAATGACATTTTTCAA	5905	0	UF_Msa_AF_105337	contig25993___1_nr0nt1	contig25993___1_nr0nt1	Unknown	
6157	76	7	unmapped	0		0	CCTCTGTCAATGCCATGTCTTTGTTTACCATGAAAACCCAATAACAATGTATTTTCTAAC	5907	0	UF_Msa_AF_108176	LMB_S454.362.C1___1_nrnt	LMB_S454.362.C1___1_nrnt	Unknown	
6158	76	8	unmapped	0		0	GCTGGGGAATGCTATGATTTATGCCTCCCTTCAAAACTGTTTTGCTGAATATGTGGAAGA	5909	0	UF_Msa_CF_122711	contig20307___0	contig20307___0	Unknown	
6159	76	9	unmapped	0		0	AAAGTTTAAGAAAATTTACTTGTGAACTCTTGGGCCAAGAAACAACTCGCCTGTTTGTCA	5911	0	UF_Msa_CF_122783	contig22798___0rc	contig22798___0rc	Unknown	
6160	76	10	unmapped	0		0	ATGGCTGAACCAATGGAGACGTTGTCCAGGTGTCGGGATGCAGTTCCAGTTGTCACTGTG	5913	0	UF_Msa_CF_125352	contig16375___0rc	contig16375___0rc	Unknown	
6161	76	11	unmapped	0		0	ATGATAAAGGCGACAGCTCACTGGCTGATAAAGAGGAGGAAGAAGAGTTGGATAGGATCT	5915	0	UF_Msa_AF_106014	contig30728___1rc_nr1nt0	contig30728___1rc_nr1nt0	Unknown	
6162	76	12	unmapped	0		0	GACTAGTTTATCAAGAATTAACTTCTTTGCTGTGGTGAAGACATGCACTGGGAGAATACA	5917	0	UF_Msa_AF_105190	contig32691___1_nr0nt1	contig32691___1_nr0nt1	Unknown	
6163	76	13	unmapped	0		0	CAACACATGCAATGTGAGAGGTTGTTTTCATGTCCCAACATTCATCAAACCAGCTCAGTG	5919	0	UF_Msa_CF_126423	contig29080___0rc	contig29080___0rc	Unknown	
6164	76	14	unmapped	0		0	TTTGAGTCCACTTCTTTCCATCATGATGGTCGGATGTTTGGGATTCACTACGGATCAGGA	5921	0	UF_Msa_AF_107568	LMB_S454.sd.96.C1___1rc_nrnt	LMB_S454.sd.96.C1___1rc_nrnt	Unknown	
6165	76	15	unmapped	0		0	ACAAAAATATATCTACACAGTCTTAAATGTGGGGTGGGGGCTGAGCGACACAGCCAAGAA	5922	0	UF_Msa_CF_126167	contig17753___0	contig17753___0	Unknown	
6166	76	16	unmapped	0		0	AAAGGCCCAGGATCCGGCTGTCTACACTTGATTTGAGCAAGATGGCGTCACTGCCTGACG	5924	0	UF_Msa_AF_104651	contig13140___1rc_nrnt0	contig13140___1rc_nrnt0	Unknown	
6167	76	17	unmapped	0		0	GGGATTCCCAGCCCCTTGAACAAACCCACCTGAAATATTTATGTAAATAAAAATACTAAT	5926	0	UF_Msa_CF_117953	contig31339___0rc	contig31339___0rc	Unknown	
6168	76	18	unmapped	0		0	CCACCGCCTACCAAAGCTTCGAGAGCGTGATGGATGAGGTTTTCCGGGACGGAGTCAACT	5928	0	UF_Msa_AF_108930	contig01029___1rc_nrnt	contig01029___1rc_nrnt	Unknown	
6169	76	19	unmapped	0		0	ACAGGGTGGTGCAGAGCATGGTGTTTAGAAGATCTGGCTTGAGTTGAGTTGAATTGATTC	5930	0	UF_Msa_CF_118198	contig30666___0rc	contig30666___0rc	Unknown	
6170	76	20	unmapped	0		0	ATAAGATGGACTCGGTCGTCCAGGTTCCTGTAAAAAGGAACCAGCGTTGAAATCGAACAA	5932	0	UF_Msa_CF_119777	contig10174___0	contig10174___0	Unknown	
6171	76	21	unmapped	0		0	ACGGCACAGAACGGAGAGCTAGCGGGCCGTGAGGAGATACTCGATGAATTTGACAACAAG	5934	0	UF_Msa_CF_118431	contig15460___0	contig15460___0	Unknown	
6172	76	22	unmapped	0		0	GTGAACAGCTGGCTAATAACAGCTCCCCACCTAGAGATGCCCATGCCACTCCACGAACCC	5936	0	UF_Msa_CF_118774	contig17815___0	contig17815___0	Unknown	
6173	76	23	unmapped	0		0	AAGGGCACCAATCAAGCAGGCCCAGAGCTAAACACATTTTTTGAGAAGTCCACAGAGTTT	5938	0	UF_Msa_AF_108938	contig25575___1_nrnt	contig25575___1_nrnt	Unknown	
6174	76	24	unmapped	0		0	CCAAGGTCCTTTTATACTGGGCCACTGCCATCGACACCTGGAGCAAACACTGTGACAAGG	5940	0	UF_Msa_AF_105466	contig28596___1rc_nr1nt0	contig28596___1rc_nr1nt0	Unknown	
6175	76	25	unmapped	0		0	AGAAGATTTTGGGCAAATCTGAAGATGTGTTACAAGCAGAGGCTCAAGCCAAGATGCAGG	5942	0	UF_Msa_AF_100559	LMB_S454.819.C1___1_nrnt	LMB_S454.819.C1___1_nrnt	Unknown	
6176	76	26	unmapped	0		0	ATAACAGGGTTTTACTTGGCCCAACACAAGACTAAAGTGGTTCCAGCTGGTGGAAGCAAT	5944	0	UF_Msa_CF_126847	contig21284___0rc	contig21284___0rc	Unknown	
6177	76	27	unmapped	0		0	ACTGCAGCAAGTGGGTGGTTGGTTTCTGTGATGAGCGATTGGTTTCCTTTGATGATCCTG	5946	0	UF_Msa_AF_108173	contig02879___1rc_nrnt0	contig02879___1rc_nrnt0	Unknown	
6178	76	28	unmapped	0		0	GGATTCCTGCTCCAACAAACACTACATATTAATTTCTTGTGCTTTTTGTCATAAAGCAGT	5948	0	UF_Msa_AD_200063	LMB_Add_65	LMB_Add_65	Unknown	
6179	76	29	unmapped	0		0	ACTAAAAGACCCCAGAAGAGCTAAGGACAGAAGAGATACTAAACATCCTTGGGTTAGGGG	5950	0	UF_Msa_CF_125394	contig17896___0	contig17896___0	Unknown	
6180	76	30	unmapped	0		0	AAACCTTTTCCCGCCGGTTGTTTTTCCAGGACTAGTTTCAAAACAAGCTGTGACATGGAG	5952	0	UF_Msa_AF_101628	LMB_S454.301.C1___1_nrnt0	LMB_S454.301.C1___1_nrnt0	Unknown	
6181	76	31	unmapped	0		0	ACTGAGGAGTCCCCACTGCTCTCCGGCCCCAGAGCCGCTGATGACGCTCACATGACCTGC	5954	0	UF_Msa_CF_123396	contig05897___0rc	contig05897___0rc	Unknown	
6182	76	32	unmapped	0		0	GGTTTGGACATTGGCCCAGTCTGTTTCAAATAAATAGACTCATGATAAATTAACACCAAA	5956	0	UF_Msa_AF_109372	contig11649___1_nrnt	contig11649___1_nrnt	Unknown	
6183	76	33	unmapped	0		0	ACTCTCTTGGGCTCTGACCTGGAGCCTGGAATGCCTCTAGTGAGCTTGAAGCCGTCCTTT	5958	0	UF_Msa_CF_126496	contig13611___0rc	contig13611___0rc	Unknown	
6184	76	34	unmapped	0		0	TATCTGAAGAAGACGACAGGCTGAAGCAAGGATCACAGATTAGTTGCTACAATTACCTGT	5960	0	UF_Msa_AF_106273	LMB_S454.sd.218.C1___1rc_nrnt	LMB_S454.sd.218.C1___1rc_nrnt	Unknown	
6185	76	35	unmapped	0		0	TTTGAAACAGTCAATCATTCCATTGAAATGGACGTCAACTCCACCCAAATGCGGCAGGCA	5962	0	UF_Msa_CF_120605	contig25429___0rc	contig25429___0rc	Unknown	
6186	76	36	unmapped	0		0	TTCAAGAGAGCTGCGATGTCTGTGACGCCTCTCTGGTCGCGGTGGACTTCAACAAGACTC	5964	0	UF_Msa_CF_120643	contig15029___0	contig15029___0	Unknown	
6187	76	37	unmapped	0		0	CTTCACTGCCACTGTGGAGTTCAGGGAACAGATCTTGCGGGTGAAGGCGGAAGAGGACAA	5966	0	UF_Msa_AF_104787	contig01004___1_nrnt	contig01004___1_nrnt	Unknown	
6188	76	38	unmapped	0		0	TCCAGCTGCTCAGGACGGGCAAAGCTCTCTTACACAATTACTTCGCAGGGGTGGGCTTTC	5968	0	UF_Msa_CF_126358	contig12431___0	contig12431___0	Unknown	
6189	76	39	unmapped	0		0	GGTGGACATTGGGAGCGGGGATGGAAGGATAGTGATAGCAGCAGCTAAGCGTGGGTTTCA	5970	0	UF_Msa_AF_106927	contig09359___1rc_nr1nt0	contig09359___1rc_nr1nt0	Unknown	
6190	76	40	unmapped	0		0	AGAAACCAACCCCCATGGAGTTAATGAAGTCGCAGGCCACAAGACTGGCCGACAACCCTG	5972	0	UF_Msa_AF_100648	contig31510___1rc_nrnt-1	contig31510___1rc_nrnt-1	Unknown	
6191	76	41	unmapped	0		0	CTCCTGGCAGGGTTACACAAACAGTCTGTACCTAGATTATCTAAATATCTGCAGGCCTAC	5974	0	UF_Msa_CF_121459	contig10242___0rc	contig10242___0rc	Unknown	
6192	76	42	unmapped	0		0	GCTTCTATAATGTATTTCTCCGCAATGTGTGAGAAAGATGGGTAGTAAAAGAAGGGGAGG	5976	0	UF_Msa_CF_123658	contig22598___0	contig22598___0	Unknown	
6193	76	43	unmapped	0		0	ATGGCGGCGGCGGCGGAGAAGTCAACTAAAGAGCAGCTGCTCTCGGTTTTGGATGATTTG	5978	0	UF_Msa_CF_122812	contig11687___0	contig11687___0	Unknown	
6194	76	44	unmapped	0		0	AAGAGGAGGACGTTGTTTCAGAGGAGCATAAAAAACAGCCAAAACTAACAGGACAAACAG	5980	0	UF_Msa_CF_125021	contig28607___0	contig28607___0	Unknown	
6195	76	45	unmapped	0		0	AGCAGCCGTATGAGAAGAAGGCTGCCAAGCTTAAGGAGAAATATGACAAGGATATCGTTG	5982	0	UF_Msa_AF_104262	LMB_S454.1129.C1___1_nrnt	LMB_S454.1129.C1___1_nrnt	Unknown	
6196	76	46	unmapped	0		0	CTCCATTAAAAGAAAATACATTTGGTGTCTCTTAGTGTTATGATAGGTGACTTGTGTAGC	5984	0	UF_Msa_AD_200116	LMB_Add_103_rc	LMB_Add_103_rc	Unknown	
6197	76	47	unmapped	0		0	AATTTCACGTTGTTGCCACTGAAAACGTGAACCCTGTTGCTCTGGAGGCGAACATTGATT	5986	0	UF_Msa_AF_105971	contig32560___1rc_nrnt	contig32560___1rc_nrnt	Unknown	
6198	76	48	unmapped	0		0	TGAGCTGTGCCTCGCAGAGTACAGGACAGGTGCAGTGCAAGATCTTTGACTCCATGCTCC	5988	0	UF_Msa_AF_107120	contig22425___1rc_nrnt	contig22425___1rc_nrnt	Unknown	
6199	76	49	unmapped	0		0	TAGTCTTTGTGCTGAATTCGCCGATAAAATCGTAGGCTCCATCTCTGTCCAGTCATACAC	5990	0	UF_Msa_CF_125796	contig18614___0rc	contig18614___0rc	Unknown	
6200	76	50	unmapped	0		0	TGCTCATCTACGGAATCTTAATGCACTACAGCGTCTTCTGCACACCTATCGGACTAAGTT	5992	0	UF_Msa_AF_102764	contig12008___1_nrnt	contig12008___1_nrnt	Unknown	
6201	76	51	unmapped	0		0	GAGCTAAAAAATGCGATTCCTACAGAGCCCGTCCTGTTCCTAAAAACACCTTCAGCGTAT	5994	0	UF_Msa_AF_109064	contig00321___1rc_nrnt0	contig00321___1rc_nrnt0	Unknown	
6202	76	52	unmapped	0		0	CCGCCGAACAAAAGGTCACACCAAAGCAGGGTATTTCTGCAAAGAAAAAAGCTGTAAACT	5996	0	UF_Msa_CF_122431	contig18225___0rc	contig18225___0rc	Unknown	
6203	76	53	unmapped	0		0	AGATCAAAAGCATGAAAGACAGGAAGTCCAAGATGAGTCAATGTCCCATGGTCCGGTACA	5998	0	UF_Msa_AF_106815	contig31867___1rc_nr1nt0	contig31867___1rc_nr1nt0	Unknown	
6204	76	54	unmapped	0		0	ACAAAGAATACAACCAGCAACCCAACTGTGGAACAAACCCGTGTTCCTCAAACCAACAGA	6000	0	UF_Msa_CF_122914	contig24167___0rc	contig24167___0rc	Unknown	
6205	76	55	unmapped	0		0	GTGTCCCCCTTGTTGTAGATACATATTAAAAACAAATAAAATGACTACACTCCTTTTGCC	6002	0	UF_Msa_AF_105128	contig21424___1_nr0nt1	contig21424___1_nr0nt1	Unknown	
6206	76	56	unmapped	0		0	AGGGCTGAAGGGCTCAGAGTCTGCGAGTACAGATGAAGTTGTCCTGGTCGTCAACCCCAA	6004	0	UF_Msa_AF_109976	contig12708___1_nrnt0	contig12708___1_nrnt0	Unknown	
6207	76	57	unmapped	0		0	AGGTGAGACCAAACATGTCAATGTTTCTACCTACATCGACATCCTGACCACACGGAACAA	6006	0	UF_Msa_CF_127536	contig22781___0	contig22781___0	Unknown	
6208	76	58	unmapped	0		0	CATTTTCACCCTATGAGCATGGGGAAGTGTTTGTGCTGGATGACGGGGGTGAGGTGGACT	6008	0	UF_Msa_AF_110256	contig16906___1rc_nrnt	contig16906___1rc_nrnt	Unknown	
6209	76	59	unmapped	0		0	AGCCTACAAGGATGTTCCTGATGACAAGAAGCCTCTGATAACAAAAATGGGCCTCACAGA	6010	0	UF_Msa_CF_125661	contig17748___0rc	contig17748___0rc	Unknown	
6210	76	60	unmapped	0		0	TCGTGGAGAGCGCCAAACACGGCCACCAACATCAAACTGTGAAAATAAAGTATTTAACCC	6012	0	UF_Msa_CF_123334	contig23771___0	contig23771___0	Unknown	
6211	76	61	unmapped	0		0	ATTATAGGCCTGCTGGGCTGCTGTAAGGAGCATGATCTGATGCAGTATGTCGCTGGACTT	6014	0	UF_Msa_AF_101147	contig10809___1rc_nr0nt	contig10809___1rc_nr0nt	Unknown	
6212	76	62	unmapped	0		0	TTGGGCGCAAAGAGGTCATAACCACCATTGAGGAGGAGTCTGATCAAGCTGAGGAGGAGG	6016	0	UF_Msa_CF_121913	contig08780___0rc	contig08780___0rc	Unknown	
6213	76	63	unmapped	0		0	ACCTATAGCACCAGAGTCAGCTCCATCAGCCCAGGCTCTGCCACCCTCCTCAGTGGTATT	6018	0	UF_Msa_AF_100717	contig05732___1_nr0nt	contig05732___1_nr0nt	Unknown	
6214	76	64	unmapped	0		0	TCAGATGATTGCAGATGTTATAGCACTAGTTCCGATTACTACCTACAACGGTTCAGCCTC	6019	0	UF_Msa_CF_123096	contig27432___0	contig27432___0	Unknown	
6215	76	65		0		0		104	1	RC7	RC7	RC7		CONTROL
6216	76	66	unmapped	0		0	ACCTGTAGACCGCACACTGCCCCCCTGCTGTAGCAGGAAGTATTGTTGATATCCCAATAG	6022	0	UF_Msa_CF_118750	contig05606___0	contig05606___0	Unknown	
6217	76	67	unmapped	0		0	GGAAGCTGTGGAATACAGATGTGGAGTACAAAAAGCAGCAGGATCCCTACCTCCTGAAGA	6024	0	UF_Msa_AF_107881	contig02859___1rc_nrnt	contig02859___1rc_nrnt	Unknown	
6218	76	68	unmapped	0		0	GCCTCCTAATCATTTTTATATAGACTCGTTGAATAAACGTGCTGAAACACCGAAAGAAAA	6026	0	UF_Msa_AF_106343	LMB_S454.sd.39.C1___1_nrnt	LMB_S454.sd.39.C1___1_nrnt	Unknown	
6219	76	69	unmapped	0		0	TTTGCAGGTGGAGTTCCCGGCACTGACGAGCATGGCAGGGGAAAGAGAGGGATCCGTGAG	6028	0	UF_Msa_CF_127023	contig07159___0rc	contig07159___0rc	Unknown	
6220	76	70	unmapped	0		0	GAGAGGTTAGGTATTCAACGGTGGAAAAGGAGGCACTGGCTATCAAGTGGGCTCTTGACT	6030	0	UF_Msa_AF_104006	contig08612___1_nrnt	contig08612___1_nrnt	Unknown	
6221	76	71	unmapped	0		0	CGAGTGCAGGAGCTGCTAAAGCAGGAGCAGAAGAAGGTGGAGAATGAGCTTGCAGTCAAA	6032	0	UF_Msa_AF_109820	contig09042___1rc_nrnt0	contig09042___1rc_nrnt0	Unknown	
6222	76	72	unmapped	0		0	TGGTCGCTGGTTTCCCTGCAACCACTCAGACTGTCACGCAGGCTGTGTTCTCCCAGTCCG	6034	0	UF_Msa_AF_107297	contig20931___1_nrnt0	contig20931___1_nrnt0	Unknown	
6223	76	73	unmapped	0		0	ACCTACCTGAAGTCGGCAGAGCAAAAGACTACCCTCTCTTCTTTGGGACGGCCATCTTTG	6036	0	UF_Msa_AF_101054	contig03850___1rc_nrnt0	contig03850___1rc_nrnt0	Unknown	
6224	76	74	unmapped	0		0	AGATGATTGATGCTGCCAGAAACAAAGTCCGAGTGAAAGCCTGTTATGTGATGATAGGGG	6038	0	UF_Msa_AF_101938	contig28600___1_nrnt	contig28600___1_nrnt	Unknown	
6225	76	75	unmapped	0		0	TTCTCGGTCTTTGTGCTCTTATCGACCTTGAGCACAGGCCTCAGGCAGTCAACCAGGTGG	6040	0	UF_Msa_AF_102442	contig06348___1_nr1nt0	contig06348___1_nr1nt0	Unknown	
6226	76	76	unmapped	0		0	AGCCCAAATGAAAACAGAAGGGAACGCTTTCTACAGGGAGAAGAACATTCGTTCAGCCAT	6042	0	UF_Msa_AF_109054	contig30118___1rc_nr1nt0	contig30118___1rc_nr1nt0	Unknown	
6227	76	77	unmapped	0		0	CTTCAAGAAGAACAGCAAAACTGCGAATTTAAGCATGGATTCTGAAAGTAACAACAAAAG	6044	0	UF_Msa_CF_121663	contig19880___0	contig19880___0	Unknown	
6228	76	78	unmapped	0		0	AATGACAGCCCTGGCCTGAATGCCAACAAGTCGCCCTCCATTGCGTGTCTGTAAACCTGG	6046	0	UF_Msa_CF_120086	contig00614___0	contig00614___0	Unknown	
6229	76	79	unmapped	0		0	CACCACAGGGCTGGCTCTGGCCTAAGCATGAACTGTTGTAAGGCTTGTACTCTCCATAAG	6048	0	UF_Msa_AF_103105	contig02016___1_nr0nt	contig02016___1_nr0nt	Unknown	
6230	76	80	unmapped	0		0	GCACAGAAAATTGTGTTTTCTGGTGACAAAAACAAAGACGGGAGCCTCGACTTCAACGAG	6050	0	UF_Msa_AF_102648	contig24412___1rc_nrnt-1	contig24412___1rc_nrnt-1	Unknown	
6231	76	81	unmapped	0		0	GTCCGATCACTGTCTTTCAACTCATTTCATTACGTGTCTTTATTGGAGATCTTTACAAAA	6052	0	UF_Msa_AF_107588	LMB_S454.sd.353.C1___1_nrnt	LMB_S454.sd.353.C1___1_nrnt	Unknown	
6232	76	82	unmapped	0		0	AGAAGGAGGAAGAGGAGGCTATGAAGAGGCCCGTTGGACCTCTCCACTACGAGGACATCA	6054	0	UF_Msa_AF_103205	contig10444___1_nr0nt1	contig10444___1_nr0nt1	Unknown	
6233	77	1	unmapped	0		0	AACATTTACATGATGATCTGCACAGCTAAAGACCGGGCAGGCTCCAAGTACAAGCTAAAG	6055	0	UF_Msa_AF_102024	contig22536___1rc_nrnt-1	contig22536___1rc_nrnt-1	Unknown	
6234	77	2	unmapped	0		0	AATTCTTCCCCCGTCAAAGATGGACACCACAGCCACCAGGATGCACTGGGCGGGCCTGAC	6057	0	UF_Msa_CF_119273	contig25765___0	contig25765___0	Unknown	
6235	77	3	unmapped	0		0	TCTCCTTATGGGTTTAAAGACTGGGAATGTGACAAGTCATGTGGCCTCTGGTTCAGCTTA	6059	0	UF_Msa_CF_118770	contig17557___0	contig17557___0	Unknown	
6236	77	4	unmapped	0		0	CATTCTGCAGTGTAGTACAGCTTGGATGATGGTGATGATGAAGCAGTTCTGCCTTATGTG	6061	0	UF_Msa_CF_126276	contig14398___0	contig14398___0	Unknown	
6237	77	5	unmapped	0		0	TGAAGAAACCACCATGGTGAGTGCAGGGAATACACAGCAGCTCATGTATCCTGTAAATGA	6063	0	UF_Msa_CF_118277	contig07864___0rc	contig07864___0rc	Unknown	
6238	77	6	unmapped	0		0	TAATTACAAGGAGCTGGTCTCTGCCCATGGCTATGCACACAACAACGTTACTATCTGGAA	6065	0	UF_Msa_AF_106471	contig27363___1rc_nrnt	contig27363___1rc_nrnt	Unknown	
6239	77	7	unmapped	0		0	GAGTGTTTGTGTTGGATTCACACGAAAAGACCGCTCACTCAGAAATGGAGGACATTTCCT	6067	0	UF_Msa_AF_109449	contig16424___1rc_nrnt0	contig16424___1rc_nrnt0	Unknown	
6240	77	8	unmapped	0		0	AATACAGTGATGAACAACAAAGCAGAGAGCCGAAGATGAGCAGGTAGGTCCCGTAGTAAA	6069	0	UF_Msa_CF_125413	contig06915___0rc	contig06915___0rc	Unknown	
6241	77	9	unmapped	0		0	TGGTTGTGGAGGCTGTGCCTCGCCAGTGTTACGAGTGGGACTTTTTGGGTTGATGTTAAT	6071	0	UF_Msa_CF_126439	contig24937___0rc	contig24937___0rc	Unknown	
6242	77	10	unmapped	0		0	GGAACAGAGTGCAGATGAGGGAAGGAGGATAGGAGAAAAAGTGAAGGCTACTAAACGATT	6073	0	UF_Msa_CF_123173	contig29929___0	contig29929___0	Unknown	
6243	77	11	unmapped	0		0	GGACCCACTGGCCTGCCTATCATAGGAAACCTTCTACAGCTGGACAAAAGAGCTCCATTC	6075	0	UF_Msa_CF_122414	contig17595___0rc	contig17595___0rc	Unknown	
6244	77	12	unmapped	0		0	ACTGAAGGAGTACACACATCTACAAACCTGTAAAGAGCACTCTTGCTGTCCTGAAAGGCA	6077	0	UF_Msa_CF_119728	contig07621___0	contig07621___0	Unknown	
6245	77	13	unmapped	0		0	CTGGGCAAAGTGTGTGGCACCCTGTTAGGACAACAAAAAGACCAAAGTAAAGACATTGGT	6079	0	UF_Msa_CF_117949	contig05034___0	contig05034___0	Unknown	
6246	77	14	unmapped	0		0	TATCTTCTAGCATTTCTGTTTGATTGCTATGAGGACGCCTTGGAGAACAGCAACCAAAAA	6081	0	UF_Msa_AF_104087	contig32536___1_nrnt	contig32536___1_nrnt	Unknown	
6247	77	15	unmapped	0		0	TAACGTGCCGGTTCTCGGCCTGGTGCAGAACATGAGCGTCTTCCAGTGTCCCAACTGTAA	6083	0	UF_Msa_AF_106869	contig17710___1rc_nrnt-1	contig17710___1rc_nrnt-1	Unknown	
6248	77	16	unmapped	0		0	AATTTGACCTCTTCAGTAAGATTGATGTGAATGGAGACAACGCTCACCCTCTCTGGGAGT	6085	0	UF_Msa_AF_109996	contig12037___1_nrnt	contig12037___1_nrnt	Unknown	
6249	77	17	unmapped	0		0	GGACAAGTATTTTCCTGCTGACACTGGTATTAAGATTATTTCTGAGCCAGGGCGCTTTTA	6086	0	UF_Msa_AF_101802	contig11014___1_nrnt	contig11014___1_nrnt	Unknown	
6250	77	18	unmapped	0		0	TACCCACAGGGTTTGAGAACACTGCTGCAGAAGAGGTCAAGGAGAAAATCGGGGTTGACG	6088	0	UF_Msa_AF_107922	contig04260___1_nrnt0	contig04260___1_nrnt0	Unknown	
6251	77	19	unmapped	0		0	TTGTGTAATGCTGTTGAGGCATCTCCTGGATATAGATCATTTACTTCATACTGATTCTGT	6090	0	UF_Msa_AD_200023	LMB_Add_152	LMB_Add_152	Unknown	
6252	77	20	unmapped	0		0	TTCCTGGTGGAATATAGGACAACTCTTGGCTCGAGTCTATACCATAAATATGAAGTGAAC	6092	0	UF_Msa_CF_118525	contig10291___0rc	contig10291___0rc	Unknown	
6253	77	21	unmapped	0		0	GTTGGTTTCTGAACTTCTCCGTGCCCACCAGTACTGCCCCCGTCCATCCACATCGCTACG	6094	0	UF_Msa_CF_118267	LMB_S454.676.C1___0rc	LMB_S454.676.C1___0rc	Unknown	
6254	77	22	unmapped	0		0	TCATTGACTGCTGAGACTATCCTAAAGAACAAAAATAACCTGAACCAGCTGCCCCACGGA	6096	0	UF_Msa_AF_104605	contig26455___1_nrnt	contig26455___1_nrnt	Unknown	
6255	77	23	unmapped	0		0	TGACCTCTTCCAGCAGAGCAAGGTCAACATGCAGAAGATGCTTCCAGAGATCGATCAAAA	6098	0	UF_Msa_AF_108904	contig12276___1_nrnt	contig12276___1_nrnt	Unknown	
6256	77	24	unmapped	0		0	TCTGGGTCTGCTGATCGGAGCCGCCTCCACTTCCCTGCAGGTGGCGACGTTTGTTGGTCC	6100	0	UF_Msa_AF_105501	contig06561___1rc_nrnt	contig06561___1rc_nrnt	Unknown	
6257	77	25	unmapped	0		0	ATATTCCTGAAGAAGTCCTTATCAATCCCTGTGCTGTCAGACATGGAGGACTGCAGTAAC	6102	0	UF_Msa_AF_101742	LMB_S454.sd.597.C1___1_nrnt0	LMB_S454.sd.597.C1___1_nrnt0	Unknown	
6258	77	26	unmapped	0		0	AATCTGACTGCTAAAAAGAGTCGGTACCTGCCGGAGATGAAGTGTAAAAAACAAGACCGA	6103	0	UF_Msa_CF_124770	contig09300___0rc	contig09300___0rc	Unknown	
6259	77	27	unmapped	0		0	AGAATAGACTTATTGTCATGAACCCCTGCGATATGGCACCACTAAGTACCCTTCACGTCA	6105	0	UF_Msa_CF_127677	contig27144___0rc	contig27144___0rc	Unknown	
6260	77	28		1028	E1A	0		418	1	(+)E1A_r60_a135	E1A_r60_a135	E1A_r60_a135		CONTROL
6261	77	29	unmapped	0		0	TTCCTTATGATGGCTGCAATGTGGTTAAAGAGGGTGGAAGTTACGTGCTCCCAATGCATT	6108	0	UF_Msa_AF_101203	contig27645___1_nr1nt0	contig27645___1_nr1nt0	Unknown	
6262	77	30	unmapped	0		0	GCGAACGAGGAAGTGGCAGCGTCTACTCCAGCTCAGGGGAGGTGGGCTTTTCCATTTCCT	6110	0	UF_Msa_CF_125683	contig09139___0rc	contig09139___0rc	Unknown	
6263	77	31	unmapped	0		0	CTGTCAGACAACATGGTGGATATTGCTATGGAGCGGGCGATCACTGAGAAGCTGCCATCC	6112	0	UF_Msa_AF_102336	contig17326___1rc_nrnt-1	contig17326___1rc_nrnt-1	Unknown	
6264	77	32	unmapped	0		0	ACTACTTGGAGTTTTCATAGCGTTAGTGTTGCTGAGGAAAGGTTGGTTCTTCAGTCCAGG	6114	0	UF_Msa_CF_122569	contig30858___0	contig30858___0	Unknown	
6265	77	33	unmapped	0		0	GCACCTTTAATGTAAATACTGACTTTGTGAAGACAGAGAGAGATAGAGAGAGAGAGTGAA	6116	0	UF_Msa_AD_200282	LMB_Add_116	LMB_Add_116	Unknown	
6266	77	34	unmapped	0		0	ATTGCCTCCAGGTTGTGCAGCCACTAACCCACAGCTCCTTTGCCTTTTCCCTCAGTTTGT	6118	0	UF_Msa_AF_106734	contig21278___1_nr0nt	contig21278___1_nr0nt	Unknown	
6267	77	35	unmapped	0		0	TTTTAGAGGGGATCATTGACCACTGCCCGCCCTCAACGAACACCCCTGGAGCATAGAATA	6120	0	UF_Msa_AF_101013	contig31286___1rc_nrnt0	contig31286___1rc_nrnt0	Unknown	
6268	77	36	unmapped	0		0	ATTGGGTTCCATGAAAGTGGTATCTATGAGATCCCCATCATAATCACAGACTCGGGCAAC	6122	0	UF_Msa_AF_104902	contig22081___1rc_nrnt-1	contig22081___1rc_nrnt-1	Unknown	
6269	77	37	unmapped	0		0	TGATTGGCCCGGCGGGGGGAGGGGACGCCGACCGACAGCAAAGGGTATAAGAAAATAAGA	6124	0	UF_Msa_CF_119795	contig11099___0rc	contig11099___0rc	Unknown	
6270	77	38	unmapped	0		0	CTATCGGTTCCTCAGACGTTATGCCAAGTGTGTGAGTGCCGGCATGGACACGCTGACTCT	6126	0	UF_Msa_AF_101477	contig07143___1rc_nrnt	contig07143___1rc_nrnt	Unknown	
6271	77	39	unmapped	0		0	AGAGCCTCTGGGATACAGACAGGAAGACCCAAGCTACCGTTCCTTCCATTCGGGGGACTA	6128	0	UF_Msa_AF_105800	LMB_S454.sd.312.C1___1_nrnt	LMB_S454.sd.312.C1___1_nrnt	Unknown	
6272	77	40	unmapped	0		0	ACATGGCTGCTCGACCGTCACGTATGGCTTTTGGCTTGGAAACAAATCCTACCATTACCT	6129	0	UF_Msa_CF_122299	contig15911___0rc	contig15911___0rc	Unknown	
6273	77	41	unmapped	0		0	GATGGAAAGGGAGCCTTCCCCTTTGTGTCATATTTCACCTCCTCACCTAATTCCAGCTAC	6131	0	UF_Msa_CF_124991	contig24191___0rc	contig24191___0rc	Unknown	
6274	77	42	unmapped	0		0	TGCTTCTACTTGTTCTTTACGATGTTGCCCTTCAGTCTTCCATCAGCAATCCACGCTTTA	6133	0	UF_Msa_CF_119533	contig24905___0	contig24905___0	Unknown	
6275	77	43	unmapped	0		0	CGTCACAGTCTCTGCTGAGTCACCTGATCCCGACAGGCAACAAGATGAATGGCATGCCCA	6135	0	UF_Msa_CF_118318	contig14322___0rc	contig14322___0rc	Unknown	
6276	77	44	unmapped	0		0	CAAAGGAAAAGTTGTGGACTTGCTCGCAATGGATGCGGATATTGTATGCAGGTGCCAGGG	6137	0	UF_Msa_AF_102575	contig23249___1rc_nrnt	contig23249___1rc_nrnt	Unknown	
6277	77	45	unmapped	0		0	ACCCACTCCCACATCTATGATATCCATATCAGCGATGGCCAAGGGGGCCATGCACATGGT	6139	0	UF_Msa_AF_100879	contig21947___1rc_nrnt	contig21947___1rc_nrnt	Unknown	
6278	77	46	unmapped	0		0	TCTATCTCTGGAAGAGTCGGCCGTCCTCCTGGAGGAGCAAACCAAGAAGCAGCACGAGTT	6141	0	UF_Msa_CF_125530	contig15630___0rc	contig15630___0rc	Unknown	
6279	77	47	unmapped	0		0	TCAAAGGTCACGGCTCCACCCTCTCAGTCTGATGAAGACAGTGATGATGAAACACAGGCA	6143	0	UF_Msa_CF_126639	contig06150___0rc	contig06150___0rc	Unknown	
6280	77	48	unmapped	0		0	AGAGACGGGGAGGTGGGGGAAGGTGCCGTGCTGGGAGGCCATGCAGGTGGCGTTCGGCGG	6145	0	UF_Msa_CF_126678	contig24844___0	contig24844___0	Unknown	
6281	77	49	unmapped	0		0	TCGGGAGCGGACGACGTCATCAGCCAGTGGGATCTGTCTGTGGAGTCATGTGATGTGGGT	6147	0	UF_Msa_AF_100191	contig19546___1rc_nrnt	contig19546___1rc_nrnt	Unknown	
6282	77	50	unmapped	0		0	GTCAGTGATGGCTTTGAGTATGGTGATCTTTTGAGTGACCTAGAGGCCGGGGACCAATCC	6149	0	UF_Msa_CF_120487	contig23732___0	contig23732___0	Unknown	
6283	77	51	unmapped	0		0	AATCAGATTCTTCCTGTGGAGCAGTTCTTTGGAAACTTGGATGCCGTACAGGACTTTCCT	6151	0	UF_Msa_AF_104782	contig28440___1_nrnt	contig28440___1_nrnt	Unknown	
6284	77	52	unmapped	0		0	AAGAACCTGTTGTGGCTGAAGAGGTTCTGCCCAGGGATCAGCAAAGGGGTTCGGTTGGTC	6153	0	UF_Msa_CF_125789	contig18695___0	contig18695___0	Unknown	
6285	77	53	unmapped	0		0	AGAACAAAAGACAGTTTGAGAACACTGTGGTCTTTTTGCTTGTGAATAAATGCTGACGTT	6155	0	UF_Msa_AF_108228	contig16624___1_nr0nt	contig16624___1_nr0nt	Unknown	
6286	77	54	unmapped	0		0	ACGTGGATATAAAAAGAGTAATTTGGTTGGCTCCACATCGATCAATATTAGGGCTGTAAC	6157	0	UF_Msa_AF_104558	LMB_S454.596.C1___1_nrnt	LMB_S454.596.C1___1_nrnt	Unknown	
6287	77	55	unmapped	0		0	CAGCGGGCTGGATAAGGGGGCGTTTAGTGCGCCCATCAAGCAGGAGTCCGACTGGAGTGA	6159	0	UF_Msa_AF_106636	contig09539___1_nr0nt	contig09539___1_nr0nt	Unknown	
6288	77	56	unmapped	0		0	TACAAGTGTACCCTAGGACATTGTGACATCACTATTGGGCGCGGTTACAAGTTCAACAGA	6161	0	UF_Msa_CF_124767	contig09253___0	contig09253___0	Unknown	
6289	77	57	unmapped	0		0	ATTGAAAGCTCCCACCAGCCCCCTGTGGCAGGCCCACCGAACATGCCTCTTACTGGGAGT	6163	0	UF_Msa_AF_100196	contig05950___1rc_nrnt0	contig05950___1rc_nrnt0	Unknown	
6290	77	58	unmapped	0		0	AACTAAAGCAGGAAAATGAAGAATCTCGCCGGAGAATCGACCTCAACATCGACATGAGTC	6165	0	UF_Msa_AF_110146	LMB_S454.414.C1___1rc_nrnt	LMB_S454.414.C1___1rc_nrnt	Unknown	
6291	77	59	unmapped	0		0	TTTCACAGTCCAAACAGACCAAACTTTGTCGCTACTTTGGCTCTGCACACGTCATGCTAT	6167	0	UF_Msa_CF_121777	contig09981___0	contig09981___0	Unknown	
6292	77	60	unmapped	0		0	TATCACATTACCATACACTCTACATTTAGTCAGAAATTCTTCCCAGCCCTACATGGTAAT	6169	0	UF_Msa_CF_122277	contig28941___0rc	contig28941___0rc	Unknown	
6293	77	61		0		0		735	1	ETG05_36762	ETG05_36762	ETG05_36762		CONTROL
6294	77	62	unmapped	0		0	TAATAACTTTGAAGGAGTTAGCTGTTCTTCTACAGAGTGTCCCTGGCAGGCTCTCCTGAA	6172	0	UF_Msa_AF_104753	contig28110___1_nrnt0	contig28110___1_nrnt0	Unknown	
6295	77	63	unmapped	0		0	AAGGCAAGTTTAATTAGAACTAATTACACACAAAAATAAAATACTCTTACAAAATGATAG	6174	0	UF_Msa_AF_104776	contig21254___1_nr0nt	contig21254___1_nr0nt	Unknown	
6296	77	64	unmapped	0		0	ATTTGCCCAACTTGTTTTCTTCTGCTAAGTGTTATCACTGGTGGGAAAAGAGAGAGCACC	6176	0	UF_Msa_CF_125065	contig05238___0rc	contig05238___0rc	Unknown	
6297	77	65	unmapped	0		0	GACCAGCCCATCCATGACCTGAGGCTGTCCACGCTGAAGCGCTCGCTGCTTGGCAGTGTT	6178	0	UF_Msa_AF_102329	contig25358___1rc_nrnt0	contig25358___1rc_nrnt0	Unknown	
6298	77	66	unmapped	0		0	AAGATCACAGACAACATGTTCTGTGCGGGTTATAGACCAGAAGATACTCAACGTGGAGAC	6180	0	UF_Msa_AD_200367	LMB_Add_31_rc	LMB_Add_31_rc	Unknown	
6299	77	67	unmapped	0		0	AGAGACTTGATTTCCAGAGAGATCAGTAAATTCCGCGACACGCACAAGAAATTGGAGGAG	6182	0	UF_Msa_AF_100009	contig09645___1rc_nr0nt	contig09645___1rc_nr0nt	Unknown	
6300	77	68	unmapped	0		0	ACAAGCGAGGTGACGGTGCAGCCCAGTCCCTGCCTGAGCTACAGAATCCCACGTGACTTT	6184	0	UF_Msa_AF_109907	contig12541___1rc_nrnt-1	contig12541___1rc_nrnt-1	Unknown	
6301	77	69	unmapped	0		0	CATCCAAGTCTGAGTCCAGCCAAAAGTGAAATCAAAAAGTCAAATAAAGTCATGTTTTGC	6186	0	UF_Msa_AF_101346	LMB_S454.sd.617.C1___1_nrnt	LMB_S454.sd.617.C1___1_nrnt	Unknown	
6302	77	70	unmapped	0		0	TGACGATGAGGCTCTCAGGAGATGTCGGGAGGCAGTTTGGGAAACAAGAACCGACAAGAA	6188	0	UF_Msa_CF_123258	contig29182___0rc	contig29182___0rc	Unknown	
6303	77	71	unmapped	0		0	AGAAAACAACGCCACGAAAACGCAAGTTTGAATCAGAAAAGGGGTCTGAAAGGAGAACCC	6190	0	UF_Msa_CF_125438	contig07497___0rc	contig07497___0rc	Unknown	
6304	77	72	unmapped	0		0	GCTCAGGTCCTTTTAACAAAGAACCTGGACACTTTGTGTGTTGGAAACTGCATGTTGCAA	6192	0	UF_Msa_CF_118856	contig10973___0	contig10973___0	Unknown	
6305	77	73	unmapped	0		0	GCAAGGTCCAGCTGTACAAACGGACAGCATCCATCATCTTTTATGGAACAGACTTCAGGG	6194	0	UF_Msa_AF_103795	contig24558___1_nr0nt1	contig24558___1_nr0nt1	Unknown	
6306	77	74	unmapped	0		0	ATGATCCAGGCTTTCACCCGGTTGTAGCAGAGAGAGAACGGCTCTCAGGTGTCCTGTGTC	6196	0	UF_Msa_CF_127099	contig14587___0	contig14587___0	Unknown	
6307	77	75	unmapped	0		0	ATGCATTGAGGACTTCAAAAAGATTCGTTTGCCCAGAGTACTTCCAGATCGCAAGAGGCA	6198	0	UF_Msa_AF_100051	contig22965___1rc_nrnt0	contig22965___1rc_nrnt0	Unknown	
6308	77	76	unmapped	0		0	TTACCTCCAGGGGATGAGACGCACATAAACGCACCTGAATGCTGATGCTGCTTCTACATG	6200	0	UF_Msa_CF_118215	contig04703___0rc	contig04703___0rc	Unknown	
6309	77	77	unmapped	0		0	CTGTCTTGGACGACCTGTACAGAGTCAAAGAGGAGAAAGTGAGGGAGCTGCAGAGACGCA	6202	0	UF_Msa_CF_125363	contig17196___0	contig17196___0	Unknown	
6310	77	78	unmapped	0		0	TTTAAAGGAAGTGGCGAGCTACCGCGAGTCAAAGTTTAAGCGTCAGCTGTGTTTGTGCGG	6204	0	UF_Msa_CF_126274	contig22932___0rc	contig22932___0rc	Unknown	
6311	77	79	unmapped	0		0	AGAGAGAGTGTGTTGAGGAAATCTGTAACCACGAAGAAGCCAGAGAGGTGTTTGAACAGA	6206	0	UF_Msa_AF_109380	contig17541___1rc_nrnt	contig17541___1rc_nrnt	Unknown	
6312	77	80	unmapped	0		0	CTTGGTACAAAAATCACAATTTCTTTAACCATAATACTAAATCACTCTCCGCGAATGGTG	6208	0	UF_Msa_AF_108991	contig19979___1_nr0nt	contig19979___1_nr0nt	Unknown	
6313	77	81	unmapped	0		0	CTGACCTGTCCTAGGAAGACATTTTCCCTTTTTGTTTTTACAAATTGGTGTTAATTCTGT	6210	0	UF_Msa_AF_109464	contig28818___1_nrnt	contig28818___1_nrnt	Unknown	
6314	77	82	unmapped	0		0	CAAGCCATTATATCCAAGGAGTAGGAAAGTGTGATACCAAAGGAAATAAAGAGACAAACC	6212	0	UF_Msa_AF_107315	contig13914___1_nr0nt1	contig13914___1_nr0nt1	Unknown	
6315	78	1	unmapped	0		0	TATACCGGACCACCATAAACAAATCAAACATTCCTTCAGACTTTAGACTCAAAGTTGACC	6056	0	UF_Msa_CF_125229	contig06940___0	contig06940___0	Unknown	
6316	78	2	unmapped	0		0	AGTTGCAAAGTATGGCTACACTCACCTGTCATCTGGGGATCTGCTCCGTGCTGAGGTGTC	6058	0	UF_Msa_AF_100899	contig05726___1rc_nrnt-1	contig05726___1rc_nrnt-1	Unknown	
6317	78	3	unmapped	0		0	TAATGACAGTGGAGGACTGTTACGAGCTAGGGGAAAAATCGCCTACTCTGACGTTGATTA	6060	0	UF_Msa_AF_103976	contig26246___1rc_nrnt0	contig26246___1rc_nrnt0	Unknown	
6318	78	4	unmapped	0		0	AAGTAAAGCCAAGGTTCTTCTTTAACCTGCTTTACCTACTGTGCATGTTTTCCTGTGAAA	6062	0	UF_Msa_CF_124776	contig25901___0rc	contig25901___0rc	Unknown	
6319	78	5	unmapped	0		0	AGGGCCAAAATCTGAGAATATTTGTTTTCAGCATTCCAGATGTAGGTGCAGGACCCCATG	6064	0	UF_Msa_AD_200362	LMB_Add_10_rc	LMB_Add_10_rc	Unknown	
6320	78	6	unmapped	0		0	TGGGTGTCATACTTGGTCACCTGCCCTCTGAGAGCATCTACAGGTGTGGTCAGGTGTGCA	6066	0	UF_Msa_CF_125716	contig05368___0rc	contig05368___0rc	Unknown	
6321	78	7	unmapped	0		0	TTCACGCCAGTAGATGTCAATTTTGGTGTTTGTGGCAATGGCAAACCTTCTAGATGAGCC	6068	0	UF_Msa_AD_200329	LMB_Add_23	LMB_Add_23	Unknown	
6322	78	8	unmapped	0		0	TTAGCAAATCTGTGTCCTGAAGCTGCTGAGGAGGCCAAGGCCCTGATCCCCAGTTTGGAG	6070	0	UF_Msa_AF_106825	contig32435___1_nrnt	contig32435___1_nrnt	Unknown	
6323	78	9	unmapped	0		0	ACCCAGCACCCTCTAGATATTCCAGGTGATGTGGACAACAGGAGAGGAAAATAAACAAAT	6072	0	UF_Msa_CF_123532	contig26317___0rc	contig26317___0rc	Unknown	
6324	78	10	unmapped	0		0	AAGCAGGAAAAAATTGAATTCATGGAGGATCACATCAAGCAGCTGGTGGAGGAGATTCGC	6074	0	UF_Msa_AF_109088	contig13629___1rc_nrnt-1	contig13629___1rc_nrnt-1	Unknown	
6325	78	11	unmapped	0		0	GGCATTTACCTCTGAAGTTCGTGGCTGGCTGGCTCGAGCTTCAACTTCTACAGCTAGCGT	6076	0	UF_Msa_CF_122137	contig14572___0	contig14572___0	Unknown	
6326	78	12	unmapped	0		0	CAAGCTGACCAGCCGGTTTACTCTGAACGCCCTGAGAAGGATTCACCATGGACCTTGTTA	6078	0	UF_Msa_CF_121790	contig16429___0rc	contig16429___0rc	Unknown	
6327	78	13	unmapped	0		0	ATAAAGAGCTCATGGAGCGAGGGGTTTCTGACAGTTTGTGCACCTGGACGCCGGACGACA	6080	0	UF_Msa_CF_120610	contig06557___0	contig06557___0	Unknown	
6328	78	14	unmapped	0		0	GGCTTTGGCTCTGGTCCTCGGACGGGGAAGGCTTCGATGTGCCAGGGCTACTGTGAGATT	6082	0	UF_Msa_CF_122667	contig20861___0rc	contig20861___0rc	Unknown	
6329	78	15	unmapped	0		0	ACGTGCACTGAAAACACACAAAGACACTGCAGCCAGACGGAGTTCTGTTGTAAAGATGAA	6084	0	UF_Msa_CF_126387	contig27101___0rc	contig27101___0rc	Unknown	
6330	78	16		66	Structural	0		94	-1	(-)3xSLv1	NegativeControl	NegativeControl		CONTROL
6331	78	17	unmapped	0		0	TAGGTACTTGATGCACCAGAGGTCGGAGGAGAAGCGTTGGGATTTCCTGGTTCCCATCGG	6087	0	UF_Msa_CF_127740	contig11843___0	contig11843___0	Unknown	
6332	78	18	unmapped	0		0	AACGTGTTTCTTACAGGAGGGAACATGCAGTACCCTGGGATGAAGGAGAGAGTGGAGAGG	6089	0	UF_Msa_AF_100156	LMB_S454.29.C1___1_nrnt	LMB_S454.29.C1___1_nrnt	Unknown	
6333	78	19	unmapped	0		0	GAGGAAGCAGAAACAGGAAGAGGAAAAGGAGCACTACGAGGCAGTGATGCGGCGGACATT	6091	0	UF_Msa_CF_119998	contig11388___0rc	contig11388___0rc	Unknown	
6334	78	20	unmapped	0		0	TCCACCTGGAGTATCTAATGAGGAAAAGAAAGAGGACGGGGAAGAAGAGTACAAGTTTGA	6093	0	UF_Msa_CF_123663	contig01411___0rc	contig01411___0rc	Unknown	
6335	78	21	unmapped	0		0	AAGATGGCGACCGAGCAGGGCAGGATGAAGTTCACCAGACCGCTCTTCAGGGAGGTATTC	6095	0	UF_Msa_AF_102669	contig12808___1_nrnt	contig12808___1_nrnt	Unknown	
6336	78	22	unmapped	0		0	GCTACACCTGCTGAGCCTGAAAAGGCTCCACCTATGACCACACAAGCTGGGGATGTTAAG	6097	0	UF_Msa_CF_120634	contig04382___0	contig04382___0	Unknown	
6337	78	23	unmapped	0		0	TCAACTACGCAAGAAAGATGAGTCTCACTGCTAAGGACAAGGCAACAGTCAAAGCCTTCT	6099	0	UF_Msa_AF_104606	LMB_S454.207.C1___1_nr0nt	LMB_S454.207.C1___1_nr0nt	Unknown	
6338	78	24	unmapped	0		0	GTCTGACGATGACATGGGCTTCGGTCTCTTCGATTAAAATGGCTCTTTTTTAAGAAAAAA	6101	0	UF_Msa_AF_102784	LMB_S454.sd.442.C1___1_nrnt	LMB_S454.sd.442.C1___1_nrnt	Unknown	
6339	78	25		0		0		3602	1	ETG10_236652	ETG10_236652	ETG10_236652		CONTROL
6340	78	26	unmapped	0		0	CGCCACAAGGGAAAGATCAGGAAGCTGAGCACGATGACTGAGTGAAACCTTCATAAAAAA	6104	0	UF_Msa_AF_105087	contig13837___1_nr0nt1	contig13837___1_nr0nt1	Unknown	
6341	78	27	unmapped	0		0	TTCTCCTGAACGCTTTCATTTCATGGGACAATTTTCTATGGAGCTCAACAGCCAGCCCAT	6106	0	UF_Msa_CF_119645	contig10647___0rc	contig10647___0rc	Unknown	
6342	78	28	unmapped	0		0	TCCTCTCTGAACTCGTCGAGCAGCGGAGACCAGGACTACGACTGTCTCAGTGAATGGGGA	6107	0	UF_Msa_CF_124412	contig14902___0	contig14902___0	Unknown	
6343	78	29	unmapped	0		0	GCTAATGTTTCTGTTGTACTACCGCATTTGTACATTTGCTTTTGGTGGAACTTGTTTTTT	6109	0	UF_Msa_AF_105947	contig27314___1_nrnt	contig27314___1_nrnt	Unknown	
6344	78	30	unmapped	0		0	ATCATAAAGACAAAGATGGCAACACAGCACCACAGTAGAGAGAGAAAGTACGCTAGCCTC	6111	0	UF_Msa_CF_125764	contig00620___0	contig00620___0	Unknown	
6345	78	31	unmapped	0		0	CATGATTGTGGCTGTTTCCCAATTATTTTGCCCTACCTGTCAATCACCAAAACCTCTGTC	6113	0	UF_Msa_CF_122141	contig26734___0	contig26734___0	Unknown	
6346	78	32	unmapped	0		0	TCAGAAAAACACTGAAGGGTGTTGAGGATTTAAAATAAACAGATTTCATTGCTGCCATGT	6115	0	UF_Msa_AD_200069	LMB_Add_60	LMB_Add_60	Unknown	
6347	78	33	unmapped	0		0	TTCGAAGATATTGAGGGCCTTTCTGACTACCCCTGCCCCATGTGCAAGTCCATCCGCCAG	6117	0	UF_Msa_AF_104587	contig07351___1rc_nr1nt0	contig07351___1rc_nr1nt0	Unknown	
6348	78	34	unmapped	0		0	GACTGCTGTGAGCAAAACCAAACCTTCTCCATCTCAGTTTATGCCTCTTGTGGTTGACTA	6119	0	UF_Msa_AF_104035	contig20345___1rc_nrnt	contig20345___1rc_nrnt	Unknown	
6349	78	35	unmapped	0		0	CAATGTCTATATTTCTATGGTGCCCTACAACAGTTTGTATCAGAAATGGTCAATAAAGAG	6121	0	UF_Msa_AF_107695	contig25590___1_nr0nt1	contig25590___1_nr0nt1	Unknown	
6350	78	36	unmapped	0		0	GGTCTCACCCCCGGCTACAACGACACACGCTGACCTCGCAGAGGTGGCTAGTGAGAAGAA	6123	0	UF_Msa_CF_125782	contig21097___0	contig21097___0	Unknown	
6351	78	37	unmapped	0		0	CCGTAACATAGCGTTAGCTGTCGAGCTAATAAGCTCAGTGTTTCGCGGTGTATCTTTTAG	6125	0	UF_Msa_CF_124963	LMB_S454.766.C1___0	LMB_S454.766.C1___0	Unknown	
6352	78	38	unmapped	0		0	AAGAAGTCAGACCAGAGAGAACTGTATGTGATCCTGAATCAGAAGAACGCCAATCTGATC	6127	0	UF_Msa_AF_100765	contig05303___1_nrnt	contig05303___1_nrnt	Unknown	
6353	78	39		1028	E1A	0		1348	1	(+)E1A_r60_a20	E1A_r60_a20	E1A_r60_a20		CONTROL
6354	78	40	unmapped	0		0	CTCAGTGGAGATAGAGGTGGACAGTTGACAATTTTCAGTGGAGTGGACGAATATGTGAAG	6130	0	UF_Msa_CF_120100	contig20192___0	contig20192___0	Unknown	
6355	78	41	unmapped	0		0	ATGTGTATCGTCGTGACTTCAGTGGATGGTTTTAAAGATGAGAAGGAAGTCGACGTGCCT	6132	0	UF_Msa_CF_127303	contig08513___0rc	contig08513___0rc	Unknown	
6356	78	42	unmapped	0		0	TATTGAGACACAAAGGGATTTCTGTAAAGACTTCAGTCCTTCACAAATTTGTGGACAGCT	6134	0	UF_Msa_AF_106185	LMB_S454.967.C1___1_nr1nt0	LMB_S454.967.C1___1_nr1nt0	Unknown	
6357	78	43	unmapped	0		0	TCAGACAGCAGTAAGAAACAGAAGGTGGAAATCACAACTACAGCAACGACGACAGGAAAT	6136	0	UF_Msa_AF_103881	contig30504___1_nrnt	contig30504___1_nrnt	Unknown	
6358	78	44	unmapped	0		0	ACAAACCAAAACAGGCTGGCCGCAAGTCTGAGGGGCCTATCTGTCAAGCCTGCATCCTCA	6138	0	UF_Msa_CF_123749	contig17501___0rc	contig17501___0rc	Unknown	
6359	78	45	unmapped	0		0	AAATACAGGAGGATTAAACTCAGCAACAAGGTGTTCCAGGAAGATCGCAGGAAAGGCACA	6140	0	UF_Msa_AF_101459	contig19780___1_nrnt0	contig19780___1_nrnt0	Unknown	
6360	78	46	unmapped	0		0	ACGTCGATGCACCCAAAGATCAAATGGACAAGGAGTGGGAAGAGTTTCAAAAGGAGATAC	6142	0	UF_Msa_AF_100652	contig02667___1_nrnt	contig02667___1_nrnt	Unknown	
6361	78	47	unmapped	0		0	TCTGTATGTGAATGTTTGGGATGTTTGGAGGGAGGCGGGGGCTCTCACCGTCACCCTACA	6144	0	UF_Msa_CF_121910	contig04710___0	contig04710___0	Unknown	
6362	78	48	unmapped	0		0	AATAATAACAGCAACTACAACCAACACTATCACCAGGATACACATCTTCTTCCGGGAGCT	6146	0	UF_Msa_AF_101132	contig32323___1_nr0nt	contig32323___1_nr0nt	Unknown	
6363	78	49	unmapped	0		0	TTGGTTTGACAGACTTGCACACGAGCAACAGTTTAGAAGCTTGTTCCTCTCCAGAGCTTT	6148	0	UF_Msa_AF_100835	contig25071___1_nr0nt	contig25071___1_nr0nt	Unknown	
6364	78	50	unmapped	0		0	ATGAAGCTGTGATGTCGCCGCTGAGGTCAGGGCTCCAACGCGGCGGTCCAACAAGAACCA	6150	0	UF_Msa_CF_117708	LMB_S454.361.C1___0	LMB_S454.361.C1___0	Unknown	
6365	78	51	unmapped	0		0	ATCAGTGAGCTGAGGGACCTGCTGAGGCAGTTCAAAAAACGAGAAGTGCGACTGTTTTTT	6152	0	UF_Msa_AF_109394	contig20917___1_nrnt0	contig20917___1_nrnt0	Unknown	
6366	78	52	unmapped	0		0	AGAGTCAGGTTCTGAAGAAAGAGTTGAACAGTCAGACCAGGCCCAACAAGAGAAGTTAGT	6154	0	UF_Msa_CF_127667	contig27083___0	contig27083___0	Unknown	
6367	78	53	unmapped	0		0	AGTTGTACCGACCAATCAGCATGGCCCAGGAAGTCAGACCCCTCGCACTAGCTGTAAGAC	6156	0	UF_Msa_CF_124948	contig18235___0	contig18235___0	Unknown	
6368	78	54	unmapped	0		0	TATGCATCAGTCGGGCCCTGCAGGCCTATCAGGCCTGTGCCGAGTCACCGAACATCTTTA	6158	0	UF_Msa_CF_122226	contig24088___0	contig24088___0	Unknown	
6369	78	55	unmapped	0		0	TTGTTGGAGTACATCAAGAACGCATTCTACAGTGTCTGAATGCAGTGCGAACAGTGCAGA	6160	0	UF_Msa_AF_105225	contig05853___1_nrnt	contig05853___1_nrnt	Unknown	
6370	78	56	unmapped	0		0	GCACTCGTTTACATCGAATTCAATGCGTTCAATAAAATAAAACCAGACTGTGTGTTATGA	6162	0	UF_Msa_AF_101886	LMB_S454.sd.232.C1___1_nrnt	LMB_S454.sd.232.C1___1_nrnt	Unknown	
6371	78	57	unmapped	0		0	AGAGGCCTCTTAAAGAAACAGTCTGCAGTAGTAGCATCGTAAGGATTGAGATTGTTTTTT	6164	0	UF_Msa_CF_127117	contig31903___0	contig31903___0	Unknown	
6372	78	58	unmapped	0		0	TCTCTTCTAATTGGAGGAAATCTTATTTGGAGGTGGCTGCAGTATCACCACAGAGGGCTT	6166	0	UF_Msa_CF_120582	LMB_S454.sd.640.C1___0	LMB_S454.sd.640.C1___0	Unknown	
6373	78	59	unmapped	0		0	AATGCTATTCAGCCGCCTGGCTGGAGGAAAGCCTGGTGCCAAACAGGAGCCTGACTTCAA	6168	0	UF_Msa_CF_126305	contig02673___0rc	contig02673___0rc	Unknown	
6374	78	60	unmapped	0		0	TCTCATCAAAGAGATTGTTGCTACACATAAACCAGGGACACAGGTGCTGGTTTTGTCCAC	6170	0	UF_Msa_AF_109262	contig17496___1rc_nrnt0	contig17496___1rc_nrnt0	Unknown	
6375	78	61	unmapped	0		0	TGGCGAGGAGCCTGGGGGTCAAGTGCCATGTACGAGGGACTATGCTGACTATTGAGGGGC	6171	0	UF_Msa_AF_104338	contig09639___1rc_nrnt-1	contig09639___1rc_nrnt-1	Unknown	
6376	78	62	unmapped	0		0	ACTTCAACGACAACAAAACTTTTGTGCCTTTCTTCGGTTAAACTTAGTCAGCTTTTGCAG	6173	0	UF_Msa_CF_127136	contig03431___0	contig03431___0	Unknown	
6377	78	63	unmapped	0		0	TTTAGAGTTGTCTCTCAAGCAACACTGTGTGTGGCTCTTCTATCACTGGAGCCATTGTTT	6175	0	UF_Msa_AF_103966	contig28687___1_nr0nt1	contig28687___1_nr0nt1	Unknown	
6378	78	64	unmapped	0		0	ATGATCAGCGCCGGGCTCTTCTGTGTGGCCCCACTCATCTACGGCTGCGTGGAGATGTTC	6177	0	UF_Msa_AF_105951	contig06347___1rc_nrnt-1	contig06347___1rc_nrnt-1	Unknown	
6379	78	65	unmapped	0		0	TGAGCAGGACTTTCACCGACCTTGGCAGCGCTGCCTGTCCCCAGCACACAACAACCCTCT	6179	0	UF_Msa_CF_119180	LMB_S454.446.C1___0	LMB_S454.446.C1___0	Unknown	
6380	78	66	unmapped	0		0	TATTTGGATGTGTTGGGCAGACAACAGAGGGTGTTGCTTCATGTCATTTGGAAAGAGGAG	6181	0	UF_Msa_CF_125894	contig01170___0	contig01170___0	Unknown	
6381	78	67	unmapped	0		0	CCCAGTTATACATGATCAGCATAACTATGAGCCCATCTCACAGGCTCTGCACAGTTTAAT	6183	0	UF_Msa_CF_126309	contig26029___0	contig26029___0	Unknown	
6382	78	68	unmapped	0		0	TCTAGACAGAAATCTTTTTGCCTTGTTGCAGATGTGAAACCTGACCTGAAAGTCCAAAAG	6185	0	UF_Msa_CF_122365	contig25800___0	contig25800___0	Unknown	
6383	78	69	unmapped	0		0	TTATTGATTCATATACATCCAAGGAAAGACTTTCAGCCTCAGACCGGGCCTCTCCAGATC	6187	0	UF_Msa_CF_121010	contig31694___0	contig31694___0	Unknown	
6384	78	70	unmapped	0		0	GTCTTGAAGCAACATCAGTGTTGTTTGCCGAGTGAAACCTCAGTGTAATTTAGTACTTGT	6189	0	UF_Msa_AF_105318	contig10066___1_nr0nt	contig10066___1_nr0nt	Unknown	
6385	78	71	unmapped	0		0	TACTACTTTATACCTCATATCCCAGAGGAGAACCTGTTCCACTGCAGGGTGCTTTACGAA	6191	0	UF_Msa_AF_103626	LMB_S454.1111.C1___1_nrnt	LMB_S454.1111.C1___1_nrnt	Unknown	
6386	78	72	unmapped	0		0	AGCCCAGCCTCTTTGCAGGGACTAAAATAGGAACAGACATTCTTGAAACGAGATTTGTCC	6193	0	UF_Msa_CF_121067	contig22147___0rc	contig22147___0rc	Unknown	
6387	78	73	unmapped	0		0	GGGATGGAGGCAAGCAAGCGAGCAGAGGCGCACCGACGCAGCTACCAGACAGACCCGGCT	6195	0	UF_Msa_CF_122504	contig09984___0	contig09984___0	Unknown	
6388	78	74	unmapped	0		0	GGAGACGAGAGCTGGAACACTATCTCAAACTGAAAAGTGAGGGCTGGTTGCAAGACCGGA	6197	0	UF_Msa_CF_122541	contig20806___0	contig20806___0	Unknown	
6389	78	75	unmapped	0		0	ATTCTGCGCTCACCGTACGTGGCCACGGACTTCCTGAAGAGGAGTCCAGTACAAGCAGAT	6199	0	UF_Msa_CF_126324	contig23614___0	contig23614___0	Unknown	
6390	78	76	unmapped	0		0	AGAGCTCCCGGCATAGCTCTACCTGTCACCTTCAACACGATCCCCGCGTGCCATGCTTCA	6201	0	UF_Msa_CF_125982	LMB_S454.303.C1___0	LMB_S454.303.C1___0	Unknown	
6391	78	77	unmapped	0		0	AATAGCTGACAAACCCCGATGTCTGTTTTAACGCCACTACCCCTTTACCATGGTAAAACA	6203	0	UF_Msa_CF_118600	contig15957___0rc	contig15957___0rc	Unknown	
6392	78	78	unmapped	0		0	GAGGAGGAACATACTAACATGGCGGTGTGTATAGCGGTGATCGCAAAAGAGAACTACCCG	6205	0	UF_Msa_CF_127747	contig27096___0	contig27096___0	Unknown	
6393	78	79	unmapped	0		0	ATGCTGCTGCAGGCCAAGCGCTGCAGCGCACTGCGAACCACCAGCGGAGACAAGTTTACT	6207	0	UF_Msa_AF_100253	contig13527___1_nr0nt	contig13527___1_nr0nt	Unknown	
6394	78	80	unmapped	0		0	TCCAAAACACGGAGTAGAAATGGCCGTAAAGTCAGGGCAAAAAAGACGGAGAATAAAGCT	6209	0	UF_Msa_AF_105605	contig28415___1_nrnt0	contig28415___1_nrnt0	Unknown	
6395	78	81	unmapped	0		0	CGTCAACTACGAGAACTGCCTGGAAAGCTGTGTCTGTGGGCAGAACTCCAGAGAGCTTCA	6211	0	UF_Msa_AF_104402	contig02689___1_nr0nt	contig02689___1_nr0nt	Unknown	
6396	78	82	unmapped	0		0	GTATGCCCGTTGAACATCCTTTTATTATCATTGGCCAAGTTGCCTCTTTCTTGTACTTTT	6213	0	UF_Msa_AD_200091	AY116000	AY116000	Unknown	
6397	79	1	unmapped	0		0	ATCGGGGACTACATATGCTTTGCAACAAATGAACTTGGCATGTCCAACGACAAGATCCAC	6214	0	UF_Msa_CF_124622	contig04184___0rc	contig04184___0rc	Unknown	
6398	79	2	unmapped	0		0	TGAGGCCTTTAGAGCTGTAAGAAGTACACACCTTAATGAAAAATCACAGCACTGCAATAT	6216	0	UF_Msa_CF_119743	contig27661___0	contig27661___0	Unknown	
6399	79	3	unmapped	0		0	TACTTGACAGGAGAATGAGAGGGACATGTCGCACACATTTGTGTTCTGTATGAAAGCTGG	6218	0	UF_Msa_AF_106665	contig30608___1rc_nr0nt	contig30608___1rc_nr0nt	Unknown	
6400	79	4	unmapped	0		0	AAAGGAATCAACAAGCAAGCGGTGCCATGGTAACGGTCACTGTATAGCACAACAAGCTTA	6220	0	UF_Msa_AF_105657	LMB_S454.sd.70.C1___1_nrnt	LMB_S454.sd.70.C1___1_nrnt	Unknown	
6401	79	5	unmapped	0		0	CGGTATAACAAAGTATTTTGAGTCAGTGTTCTTACATGTCAAGAGGGACTGAAATAGTTT	6222	0	UF_Msa_AF_108788	contig28928___1rc_nr0nt1	contig28928___1rc_nr0nt1	Unknown	
6402	79	6	unmapped	0		0	ATGGCTGATGGGTATGAGGGTGGGAAGGCTGTAAAGAAACATTGTAATAAACGGTTCAGA	6224	0	UF_Msa_CF_127457	contig22171___0rc	contig22171___0rc	Unknown	
6403	79	7	unmapped	0		0	ATCCATTCACTCACTGGTCTTCCACCAGCAATGCAGAAAGTGATGTACAAGGGATTGCTT	6226	0	UF_Msa_AF_106440	contig00690___1rc_nrnt	contig00690___1rc_nrnt	Unknown	
6404	79	8	unmapped	0		0	AGACGAGTCTGAAGTGACGTTTTCAGCACACTGACGCTCTGACACTGGAAGCCGCCCAGT	6228	0	UF_Msa_AF_102303	LMB_S454.sd.602.C1___1_nr0nt1	LMB_S454.sd.602.C1___1_nr0nt1	Unknown	
6405	79	9	unmapped	0		0	GATGCTACAACAACCACACTATCATCTTCATCCTCCTCCTCAGAGTTTGTTCAGAGGAAG	6230	0	UF_Msa_CF_123471	contig09069___0rc	contig09069___0rc	Unknown	
6406	79	10	unmapped	0		0	TGCCAAATGTAATACTTAACTGCCAGGAGGAAGATGAAGGAGAGAGTGAAGATGATGAAG	6232	0	UF_Msa_AF_109138	contig26162___1_nr1nt0	contig26162___1_nr1nt0	Unknown	
6407	79	11	unmapped	0		0	ATGTGGTTGGTGAACAAAGCCAAAGAAGACCGTCTCAAATTGGAAAAGAAAGCAGAGGAG	6234	0	UF_Msa_AF_107152	contig27662___1_nr0nt1	contig27662___1_nr0nt1	Unknown	
6408	79	12	unmapped	0		0	CCCGTTCTACTGCGGCTGCGCTGTCTGGCGCGCCACTTTGCGTCGGCTGCAGTGCGCACC	6236	0	UF_Msa_CF_118803	contig06126___0rc	contig06126___0rc	Unknown	
6409	79	13	unmapped	0		0	CATGATGATGATGTTTCTGTGTCTTTGTGAAGAACGACGGTTGGTGTACCTAGACTCCTC	6238	0	UF_Msa_AF_100075	contig13715___1_nr0nt	contig13715___1_nr0nt	Unknown	
6410	79	14	unmapped	0		0	GTCAAAAGCAATGGAAGACTTTAGGAAAAACAATATCAACTCATCCAACTTTGTGCTGCC	6240	0	UF_Msa_AF_105959	contig12530___1rc_nrnt0	contig12530___1rc_nrnt0	Unknown	
6411	79	15	unmapped	0		0	ACGTTTGTTGATAAAAATTGCATCTTTATTCCACCAAGGCTCACCTCCTGCCCATCTCTG	6242	0	UF_Msa_CF_124624	contig19038___0	contig19038___0	Unknown	
6412	79	16	unmapped	0		0	ACCCTCGGAACGCCGTCTGTCCAGTCCGTCGCCACCAAAGTCGGAGCTCCGGTGTCGCTG	6244	0	UF_Msa_AF_100344	contig02387___1rc_nrnt-1	contig02387___1rc_nrnt-1	Unknown	
6413	79	17	unmapped	0		0	TATGAACCCTCAAGGCGGCTTGGGATATGGCCCAACCCCTCTTCTTCACCATATTCACCG	6246	0	UF_Msa_CF_121530	contig23989___0rc	contig23989___0rc	Unknown	
6414	79	18	unmapped	0		0	CATCACTGAGGATGTCAGTACCTCTGATTTGCTTGGTCTTTAATTATATTCTGTACATAA	6248	0	UF_Msa_AF_109005	LMB_S454.sd.638.C1___1_nrnt	LMB_S454.sd.638.C1___1_nrnt	Unknown	
6415	79	19	unmapped	0		0	TACTGCTCCTGATCCAAGAGACTGAAAAGACTTGACAAGAGAGACAAAAAGAATGATTCT	6250	0	UF_Msa_CF_124151	contig20705___0rc	contig20705___0rc	Unknown	
6416	79	20	unmapped	0		0	CCAACAGAACCTGGCTGCAGGATACCAACAACTACCGCTCCTCCTTCTTCTTCTTCTGCC	6252	0	UF_Msa_CF_123697	contig19314___0rc	contig19314___0rc	Unknown	
6417	79	21	unmapped	0		0	GGGTAACGTCGGGGGAAAGAGGAAGGCAGACGTGTTTAACCAGCCTGACTCCAAGCGCCG	6254	0	UF_Msa_AF_103903	contig07618___1_nr0nt1	contig07618___1_nr0nt1	Unknown	
6418	79	22	unmapped	0		0	ATGTTGCCTGATGAAACCTCTTCTCAGGTCTCTCTGGGCGTGTATAAACATCGAAACATC	6256	0	UF_Msa_CF_118972	contig18154___0	contig18154___0	Unknown	
6419	79	23	unmapped	0		0	GACTTCAGCCTTCTAGTCCGATTCGGGATGGTCATCCGCCCTCACCATAAGAAGCAGTAC	6258	0	UF_Msa_AF_101977	contig32312___1rc_nr1nt0	contig32312___1rc_nr1nt0	Unknown	
6420	79	24	unmapped	0		0	CTGGAGCAGTTGGGAACATTGTTGCTGCCACGCCTGGGGAAAAAGGACGAGTTCCCTACT	6260	0	UF_Msa_AF_110091	contig15252___1_nrnt	contig15252___1_nrnt	Unknown	
6421	79	25	unmapped	0		0	ATACGTTTCCGCCAATGATGAGAACGGGGAGAGGATCCTCCACACTGCCCCCTCCAGCCC	6262	0	UF_Msa_AF_109220	contig27091___1_nrnt0	contig27091___1_nrnt0	Unknown	
6422	79	26	unmapped	0		0	GCAATGCAGCAGAGAAGAGGAGAAGAAAGGACAGTGCCATCCCTCTACAGCTACTAGGCG	6264	0	UF_Msa_CF_124626	contig15736___0	contig15736___0	Unknown	
6423	79	27	unmapped	0		0	CGCAACTTACGTTCATTAAAAATGTATTGTTTCAAAGTGTAAACTCTGGAAAACGGTCAG	6266	0	UF_Msa_AF_107839	contig18718___1_nr0nt1	contig18718___1_nr0nt1	Unknown	
6424	79	28	unmapped	0		0	TGAATGCTGCCATTGCCACCATCAAGACCAAGCGCTCCATCCAGTTTGTGGACTGGTGCC	6268	0	UF_Msa_AF_108447	LMB_S454.sd.161.C1___1rc_nrnt	LMB_S454.sd.161.C1___1rc_nrnt	Unknown	
6425	79	29	unmapped	0		0	TTATCAGCAAGGACTCGCACAGCCAGGCTTTGCAGGTGACAGCACAGCACCTCCCGGCAG	6270	0	UF_Msa_AF_101154	contig09933___1rc_nrnt0	contig09933___1rc_nrnt0	Unknown	
6426	79	30	unmapped	0		0	CTTGACAAAGTTGATGTCAGACATACAGGAGACCCAGTTAAATCACTAAATAAATACTAC	6272	0	UF_Msa_CF_126585	contig31788___0	contig31788___0	Unknown	
6427	79	31	unmapped	0		0	GACGAAGGAGGAGGAGAAGAAGAAGTTGCCAGCATGGCGTTTACACTGTACTCTCTCATT	6274	0	UF_Msa_AF_102786	contig03997___1_nr0nt	contig03997___1_nr0nt	Unknown	
6428	79	32	unmapped	0		0	TTATTCTGCTGTCACTTCCTGGTGCAGTTAGCCAATCATCTCCTGGTGACAGTTTTCGAT	6276	0	UF_Msa_AF_101766	contig02411___1_nr0nt	contig02411___1_nr0nt	Unknown	
6429	79	33	unmapped	0		0	AGACGTGTCCCGCATGAGCGCAGGCGGCAGACAATCGGTGGCAACATGGGAGGAAAAGCA	6278	0	UF_Msa_CF_124790	contig19595___0	contig19595___0	Unknown	
6430	79	34	unmapped	0		0	TAGATATCCTACACAGAGTATCTGTTCCTGCTGACTATCCTGACCAAGCCTCTTACAGGA	6280	0	UF_Msa_AF_105626	contig24899___1rc_nrnt0	contig24899___1rc_nrnt0	Unknown	
6431	79	35	unmapped	0		0	ACGTCAATGATCTCTTCCTGGCCATACGCAAAAAAGATGCCAAAAACAGACACCCAAAAC	6282	0	UF_Msa_AF_107836	contig22029___1rc_nrnt	contig22029___1rc_nrnt	Unknown	
6432	79	36	unmapped	0		0	AACTACGTGTGGCCCAATGTGTTCGAGACATCCCCTCATGCGATCCAGGCTGTTATGGGG	6284	0	UF_Msa_AF_100629	LMB_S454.sd.544.C1___1_nrnt	LMB_S454.sd.544.C1___1_nrnt	Unknown	
6433	79	37	unmapped	0		0	CTGTCTATGTGAAGCCTTACAGGAATGAGGACATGTCTGCGTATGTGAAGAAGATCCAGT	6286	0	UF_Msa_AF_103921	contig19896___1_nrnt	contig19896___1_nrnt	Unknown	
6434	79	38	unmapped	0		0	GCACTCCCGCTCCAAGAGTGCAACCCCCAAAGACATACGTCCCCGTGGCTATGAGAAGTT	6288	0	UF_Msa_CF_118604	contig24923___0rc	contig24923___0rc	Unknown	
6435	79	39	unmapped	0		0	TAAAACAATAGAGAAACCTAATTGGGAGAATCGGTATGCTGCCATTTCAGGCAAAGCCAA	6290	0	UF_Msa_CF_118263	contig02065___0	contig02065___0	Unknown	
6436	79	40	unmapped	0		0	TACAGTCTGCTCGCTCTGAAGAAAAAGAAGAAGACAAAGTATCAGAGAAGAAGAGCCGTG	6292	0	UF_Msa_CF_119255	contig09090___0rc	contig09090___0rc	Unknown	
6437	79	41	unmapped	0		0	AATAAAATCAGAGAGGAGATGAAAGGTGGGTGACTCCCGCAGATTGCCCTATCATTCTTC	6294	0	UF_Msa_CF_118283	contig16721___0	contig16721___0	Unknown	
6438	79	42	unmapped	0		0	TGGGCCCAGAGCGTTTGGAGAAACTAAAGAACGTCATACACAAGATTTTCTCCAAGTTTG	6296	0	UF_Msa_AF_101286	contig07510___1rc_nrnt	contig07510___1rc_nrnt	Unknown	
6439	79	43	unmapped	0		0	CAGTGACTCGCCACTACAGGCAACACCAACAGGGAAAAGAGACCTCCACCAATCCCATAG	6298	0	UF_Msa_AF_108062	contig03281___1_nrnt	contig03281___1_nrnt	Unknown	
6440	79	44	unmapped	0		0	AGAAACACCCCTCCTATGGGCCCTTGGCTTTATTTTCCTTTTTACAGTAGGAGGTCTAAC	6300	0	UF_Msa_AD_200314	LMB_Add_26_rc	LMB_Add_26_rc	Unknown	
6441	79	45	unmapped	0		0	TTAATGGAATGAGAAACGAGGTGATCCAGTAGGAGAGAGATTATGGGAGACACATGAATG	6302	0	UF_Msa_CF_120591	contig30297___0	contig30297___0	Unknown	
6442	79	46	unmapped	0		0	TCAGTTTACAGCCTGTCAAACGCTGGTACCAGCTACCTGTAAGACTTTAGCGGGCAGCAG	6304	0	UF_Msa_CF_122310	contig24582___0	contig24582___0	Unknown	
6443	79	47	unmapped	0		0	ACAAAGATCTGCATTTTGAATCGACAAATTGTTCCTGGTGTTTGTTCCTATCTTTTCCGG	6306	0	UF_Msa_AD_200292	LMB_Add_78_rc	LMB_Add_78_rc	Unknown	
6444	79	48	unmapped	0		0	GGAGGAGGACGATAGAGAAAATTTCCAAATCCTTGATTCACTCGATGATCAAACGATGAA	6308	0	UF_Msa_CF_127598	contig16731___0rc	contig16731___0rc	Unknown	
6445	79	49	unmapped	0		0	CCGAAAAAGGACAGAAAAAACTGACTGGGAAAGGTGAATAAACTAGGACCAAGCCATGTG	6310	0	UF_Msa_AF_100876	contig14556___1rc_nrnt	contig14556___1rc_nrnt	Unknown	
6446	79	50	unmapped	0		0	GCTGATTTGTGAAGAAATATACTGCAGGCAGGCACAGTTGGAAAAGTAACAGGTTTGAAA	6312	0	UF_Msa_CF_123403	contig07545___0	contig07545___0	Unknown	
6447	79	51	unmapped	0		0	GAGGAACAAAGAAAGCCGCCCGTTGCGTGGAAAACGTTCTTTCACTTCGGCAACACGGAC	6314	0	UF_Msa_CF_119327	contig14523___0	contig14523___0	Unknown	
6448	79	52	unmapped	0		0	GCAACATTACCTATCTATTGCTGTCCTGTCTCAGTTTTCGCATTTTTATTTAATAAACGC	6316	0	UF_Msa_AF_109608	contig25977___1rc_nrnt	contig25977___1rc_nrnt	Unknown	
6449	79	53		1028	E1A	0		643	1	(+)E1A_r60_a22	E1A_r60_a22	E1A_r60_a22		CONTROL
6450	79	54	unmapped	0		0	CTTTGAGCAGTACTTGGATGAGTACTATAAACTGGACTATGAGGACATCATAGATGACCT	6319	0	UF_Msa_AF_109768	contig30231___1_nrnt	contig30231___1_nrnt	Unknown	
6451	79	55	unmapped	0		0	TAGAGGAGTCTGTGGACAGACTGTACTCTCTGGATGAGATCCGCAGATACCTGCTCTTTG	6321	0	UF_Msa_CF_122723	contig22511___0	contig22511___0	Unknown	
6452	79	56	unmapped	0		0	CCAGGAAGGTCTTTCTTCTCCTTCAGCAATGAGGATTTCCTGGAGAGGAGAAGGAAAGGA	6323	0	UF_Msa_AF_105939	contig05871___1_nrnt	contig05871___1_nrnt	Unknown	
6453	79	57	unmapped	0		0	TGATCAGAAGGTGTGTGCTTCAGAAAAACCTCCCAAGGACCTGGGATACCTCTATTTCTA	6325	0	UF_Msa_AF_109901	contig12817___1rc_nrnt	contig12817___1rc_nrnt	Unknown	
6454	79	58	unmapped	0		0	CAGATGTGGCCAGCCCTTCGTGCCCGCCACTCTGGCCACTAAACCTAGTCAAAACCGGCA	6327	0	UF_Msa_CF_123651	contig22809___0	contig22809___0	Unknown	
6455	79	59	unmapped	0		0	CACTGACATGCCAGCTTACATGCCATATTTGTACAAACTTATTTTTAACAGCAAATCTTC	6329	0	UF_Msa_AF_103290	contig00494___1_nr0nt1	contig00494___1_nr0nt1	Unknown	
6456	79	60	unmapped	0		0	TGCGGCGGCCCGAGCGGCTCGACTCACCTGAGCTCAGGAAACACATGAGACTCCCGACGT	6331	0	UF_Msa_CF_124880	contig27117___0rc	contig27117___0rc	Unknown	
6457	79	61		0		0		5807	1	DCP_20_1	DCP_20_1	DCP_20_1		CONTROL
6458	79	62	unmapped	0		0	ATAACTGCTGCCATCTCCTTGACTGCTTGTGAAAGTTCTGGAACTGTGGAATGGTCATCT	6334	0	UF_Msa_AF_104016	contig30825___1_nr0nt1	contig30825___1_nr0nt1	Unknown	
6459	79	63	unmapped	0		0	CCAGGTGGGTCATGAGTTGTTTGACATCATCTGCAACGATGCTCGCGAGGGACAGAGGAA	6336	0	UF_Msa_AF_107337	contig13555___1rc_nrnt-1	contig13555___1rc_nrnt-1	Unknown	
6460	79	64	unmapped	0		0	TGAAGGACGGGAAGAGCCCCATCCAGTTGGTGCAGATGCCCCGGGTTGTAGTGGAGCGTA	6338	0	UF_Msa_AF_103635	contig03936___1_nrnt	contig03936___1_nrnt	Unknown	
6461	79	65		1028	E1A	0		418	1	(+)E1A_r60_a135	E1A_r60_a135	E1A_r60_a135		CONTROL
6462	79	66	unmapped	0		0	AACATGCACTTTAAAAGAAGCCTTTTCAGAAGTGCAGACTCGTCTGCAGCTCAGACGACT	6341	0	UF_Msa_CF_125939	contig07920___0	contig07920___0	Unknown	
6463	79	67	unmapped	0		0	GATCGATCATGCTCCTGTAAATAACAAGTTGAGAATAATGTTCACGAGTTTCATCCAACA	6343	0	UF_Msa_CF_127009	contig16590___0	contig16590___0	Unknown	
6464	79	68	unmapped	0		0	TCCCCATCGAGCTCCAGCGGCTCTCTCTAAAATCAACCCGATCGTTGCCTCTAGGTTTTT	6345	0	UF_Msa_CF_127700	contig11972___0rc	contig11972___0rc	Unknown	
6465	79	69	unmapped	0		0	TCCTCTTACAAGACAACAAATGAAACACTGAGGTGAATGCAAACATGTTGCTCAGTGCTC	6347	0	UF_Msa_CF_121348	contig00208___0	contig00208___0	Unknown	
6466	79	70	unmapped	0		0	CTTCATTAGAATCTAGATAACGAGGATGTTTCTGTCTGGAAAACATTAAGACACACATCA	6349	0	UF_Msa_CF_123940	contig30799___0rc	contig30799___0rc	Unknown	
6467	79	71	unmapped	0		0	CTGGAGGGAGAAACAGACCCCTTGACAAATAGCTATGAAAGAGCTTAAGAGCAGAAAGAT	6351	0	UF_Msa_AF_102180	contig15201___1rc_nrnt	contig15201___1rc_nrnt	Unknown	
6468	79	72	unmapped	0		0	TTCTGTGTGGAATAGAAGCACACGCCTGTATTGCATGCACAGCATATGACCTTCTTAAGG	6352	0	UF_Msa_AF_104908	contig00552___1_nrnt	contig00552___1_nrnt	Unknown	
6469	79	73	unmapped	0		0	ACTTCCTCATGAAGATTCTGCCCAACTATCACCACCTGAAGAAGACGGTCAAAGGAAACA	6354	0	UF_Msa_AF_103485	contig29245___1rc_nrnt	contig29245___1rc_nrnt	Unknown	
6470	79	74	unmapped	0		0	GGTATTTGTTTGGAAGATAAATTCGATAACTTACAATGTCTGGAAGAGGCAAAACCGGAG	6356	0	UF_Msa_CF_124007	LMB_S454.790.C1___0	LMB_S454.790.C1___0	Unknown	
6471	79	75	unmapped	0		0	CAACTGTAGTGTCTGGCTGTGATTTTAAAACCTGCAGACTGAAGGTGAGACAGGGTTAAA	6358	0	UF_Msa_CF_125408	contig06666___0	contig06666___0	Unknown	
6472	79	76	unmapped	0		0	TAGTTACCACAGGTCTTGGCTTGCGGCACATCTTGTACAGGCAGCAGCAGGGCACACACA	6360	0	UF_Msa_AF_107703	contig28472___1_nr0nt	contig28472___1_nr0nt	Unknown	
6473	79	77	unmapped	0		0	AAAGTCAAATGGTACTGGTCCTGACCGCAGTGTTTCAGGTGTTTGCTCAGGGACCGTTGC	6362	0	UF_Msa_CF_118022	contig22273___0rc	contig22273___0rc	Unknown	
6474	79	78	unmapped	0		0	ATCTGTTCAAAGCGAGCTGCTACCGTTACAGAGAGGAGCTGTCTGCTGGGATCCTGGTGG	6364	0	UF_Msa_AF_104525	contig20164___1rc_nrnt	contig20164___1rc_nrnt	Unknown	
6475	79	79	unmapped	0		0	TTGATCAGACGTCTCAGAGAAATGTGTTGGGTTTTTTAGGGCTAGAAGGCGTCATGTGTG	6366	0	UF_Msa_CF_125749	contig32180___0rc	contig32180___0rc	Unknown	
6476	79	80	unmapped	0		0	AAGATGGAGCAGGCTAAGAAGAAAGCAGAGGCAGTTGTCAACACAGTGGACATCTCTGAG	6368	0	UF_Msa_AF_102688	contig00325___1rc_nr0nt1	contig00325___1rc_nr0nt1	Unknown	
6477	79	81	unmapped	0		0	TTTTGACCACTCGTTTTACCAGCTGTCAGTGCTCGCCAGTGAAATTAAAGAGGAGGAAGA	6370	0	UF_Msa_AF_100295	LMB_S454.sd.309.C1___1rc_nrnt	LMB_S454.sd.309.C1___1rc_nrnt	Unknown	
6478	79	82	unmapped	0		0	TTTACACTGGCAGCCTAGGCAGTGCTGTTCGAGGGGTAAAGATGTTCTCTTACAGCACCA	6372	0	UF_Msa_CF_118580	contig26308___0	contig26308___0	Unknown	
6479	80	1	unmapped	0		0	TCAGGATAATAGGTTAATAAGGGATATATCTTCGAGCTACACGCTGTTACTCCTCCATCC	6215	0	UF_Msa_CF_120470	contig01669___0rc	contig01669___0rc	Unknown	
6480	80	2	unmapped	0		0	TTGCTCAAAACACAACGCTCAGTCTCCGGTGCTGTCTGCTACCTTCGTTGCCAAGCCAAC	6217	0	UF_Msa_CF_120645	contig15815___0rc	contig15815___0rc	Unknown	
6481	80	3	unmapped	0		0	TAAAACATGATTGTGGACTGTCCATGCAGATGAAAGTCAATGCTTTCCATCTCAACTGAA	6219	0	UF_Msa_AF_108361	contig20532___1_nr0nt	contig20532___1_nr0nt	Unknown	
6482	80	4	unmapped	0		0	TGAGCAGCCATGAAGATGACAGAGGAAAACAGTTCTGGAAAGTGGGAAATAACAATGGAT	6221	0	UF_Msa_CF_125638	contig12560___0	contig12560___0	Unknown	
6483	80	5	unmapped	0		0	CTCATCCCCCGCGAACATCAGTTCTACAAGAATCTGCCTGCTGCAATTAGGAAGTTTACA	6223	0	UF_Msa_AF_101830	contig05962___1rc_nrnt	contig05962___1rc_nrnt	Unknown	
6484	80	6	unmapped	0		0	TACCTGAGTCCAGGTGGGCTCATTGATAATCACCTTTTCACCCACTTCATGATGCACATT	6225	0	UF_Msa_CF_124810	contig00686___0	contig00686___0	Unknown	
6485	80	7	unmapped	0		0	CACTGTGCAGCAAAAGTGACGAGGTGAGGCTGGCAGAGGAGGCCAGCAAGAAGTACGGCT	6227	0	UF_Msa_CF_124499	contig00610___0rc	contig00610___0rc	Unknown	
6486	80	8	unmapped	0		0	CAAGCTGGACAGCTCTCGCGCAAACCTCTACGGCTTCCGTAGCTGCGTACACCATGTCGC	6229	0	UF_Msa_CF_123792	contig03113___0rc	contig03113___0rc	Unknown	
6487	80	9	unmapped	0		0	ATAGTCCCTACTCAATCTGTAATGATTTCTCCTTCCATAGAGCAGTTGGTGATGCACATT	6231	0	UF_Msa_AF_102417	contig01048___1_nrnt0	contig01048___1_nrnt0	Unknown	
6488	80	10	unmapped	0		0	TATGTGTGTGTGTAAATAAATAAAAACCTGGCAGGGAAGGTGAACGAGTGACTCGCTGCC	6233	0	UF_Msa_AF_101065	contig23580___1_nr0nt	contig23580___1_nr0nt	Unknown	
6489	80	11	unmapped	0		0	TATTTCTTCGGATTTCTCTATTTTTGGCTCGAGAGCATCTTTCCACACTGGGCTCCCAGT	6235	0	UF_Msa_AD_200381	LMB_Add_161_rc	LMB_Add_161_rc	Unknown	
6490	80	12	unmapped	0		0	ACTGAAGATATGGAGGGTCAATACCAAGTATAATGTGCTGTATGTTCACGGCTCTGTCCC	6237	0	UF_Msa_AF_100627	contig03048___1_nrnt	contig03048___1_nrnt	Unknown	
6491	80	13	unmapped	0		0	GCGGGACAAAGGACCAGAGCATCCAGCAGCTCAGAGGACTCCTGGCAGCTAGTAACTGCA	6239	0	UF_Msa_CF_119015	contig04888___0	contig04888___0	Unknown	
6492	80	14	unmapped	0		0	TGGTCACCATGACAACAAACGTGGGGCCCATGAATCTTCACCATGCCATGCTGAGATCAC	6241	0	UF_Msa_CF_123731	contig00039___0	contig00039___0	Unknown	
6493	80	15	unmapped	0		0	ATAGGTTTAGATGTAATCTTGGTGGACCTGGGAGAGCCTTGTAGCTACTTTGAAGCTAGC	6243	0	UF_Msa_CF_125052	contig18620___0rc	contig18620___0rc	Unknown	
6494	80	16	unmapped	0		0	GCCAGCTACTGATCGACAGAAAGGATAAGAAACTAGACTATTGATGTACTGAATTGCTTG	6245	0	UF_Msa_CF_123244	contig10690___0rc	contig10690___0rc	Unknown	
6495	80	17	unmapped	0		0	ACAAGGAAACCCACCCACATCCAAGACTTGAAGCTGTTCTGTAAAGAAGAATGAGTTAAG	6247	0	UF_Msa_AF_103183	contig23338___1_nr0nt	contig23338___1_nr0nt	Unknown	
6496	80	18	unmapped	0		0	TGTGACTCCTATAAAAGAGAATCTGTGATATCCCAAGCTCAAGTCCTCTTATGGATTGGT	6249	0	UF_Msa_CF_121187	contig17549___0	contig17549___0	Unknown	
6497	80	19	unmapped	0		0	TAACATGGAGGCTTTTCTTCCTCTGATGATCATTCAGAGCTCAGTCTCTACACAGCAGCT	6251	0	UF_Msa_CF_127712	contig16747___0	contig16747___0	Unknown	
6498	80	20	unmapped	0		0	ATAACGAACGCTGGTAATTACTGGCAGAAACTGATAACACAATGCAGCTGCAGGCGAGTT	6253	0	UF_Msa_CF_122895	LMB_S454.915.C1___0	LMB_S454.915.C1___0	Unknown	
6499	80	21	unmapped	0		0	TCTGACTGTTCTGTGTTGCTGCAGCGGAGTCTTCAGCGTGCCCACCGGTGCTCGGTTCAC	6255	0	UF_Msa_CF_120362	contig03509___0rc	contig03509___0rc	Unknown	
6500	80	22	unmapped	0		0	TCATTTCAACTGGTAAAAAGTTTGCGACGTTGCCTCAGATCCTGCATCTGCTCTCAGAGA	6257	0	UF_Msa_CF_125940	contig30072___0	contig30072___0	Unknown	
6501	80	23	unmapped	0		0	AGGCTGTTCTCCATTTTATCTATCTCTGTGCGTCGTGCCAAATTCAATGCCGCCCAAGAT	6259	0	UF_Msa_CF_122018	contig00938___0	contig00938___0	Unknown	
6502	80	24	unmapped	0		0	AATAATAGACCAATCAGGATCCGCTTTTCTACACATGTTGCTGCGCTCACAGTGCGTAAC	6261	0	UF_Msa_AF_103195	contig24633___1_nrnt0	contig24633___1_nrnt0	Unknown	
6503	80	25	unmapped	0		0	GATGTCACGCCTTCACCCACACATCCCTAATAGGCCTCGTCCACATCAAGGAGCATTTAG	6263	0	UF_Msa_CF_126919	contig18252___0	contig18252___0	Unknown	
6504	80	26	unmapped	0		0	GAGCACCGTGACCTGCACAACATATATGGCTTCTATGTGCAAATGGCCACAGCGGAGGGT	6265	0	UF_Msa_AF_109576	contig06722___1_nr0nt	contig06722___1_nr0nt	Unknown	
6505	80	27	unmapped	0		0	GCATCTCTCGGAAATTCACCACTGCGTTCAATAAAATAGCCACCCATTAGAGCATAAACA	6267	0	UF_Msa_CF_125024	contig20047___0rc	contig20047___0rc	Unknown	
6506	80	28	unmapped	0		0	AGATGTATTTGGAGGTCTCATGTGTCTGGCCATTAAGTTACACAGACACACACAGCAGAA	6269	0	UF_Msa_CF_126183	contig28791___0rc	contig28791___0rc	Unknown	
6507	80	29	unmapped	0		0	CAAAAACTACAACTACAACTTGGATTCTTCAAGAAGAACGCATCGCTAAACATGGCGCTA	6271	0	UF_Msa_CF_121991	LMB_S454.216.C1___0	LMB_S454.216.C1___0	Unknown	
6508	80	30	unmapped	0		0	TTGATAAGTTCCTGGAAGATCGGGCGAAGGCAGCAGACCACAGCCCCCAGGCTATTTGCA	6273	0	UF_Msa_AF_102109	contig22461___1rc_nr0nt	contig22461___1rc_nr0nt	Unknown	
6509	80	31	unmapped	0		0	ATCTATCTTGAATGGCCTTCGTTCGGGGAGATACAGAGGAAGTCATTCCTACCAAGAAAC	6275	0	UF_Msa_CF_124470	contig01763___0rc	contig01763___0rc	Unknown	
6510	80	32	unmapped	0		0	ATGATCGCAACATCAGGAGGGTCTTCATCCGTAAGGTGTACGCCATCTTGATGATCCAGC	6277	0	UF_Msa_AF_101973	contig05594___1rc_nrnt-1	contig05594___1rc_nrnt-1	Unknown	
6511	80	33	unmapped	0		0	GATAGCATTTTCATCCAAAAGGTAGGAGAAGAGAAAAGACAAGAGACGACATCGCAGTCA	6279	0	UF_Msa_CF_118819	contig09377___0	contig09377___0	Unknown	
6512	80	34	unmapped	0		0	AAATCAAGGATCGTTTACCCTTGGCTGTAGTCGGCAGCAATACCATTATCGAGGTCAATG	6281	0	UF_Msa_AF_105274	LMB_S454.373.C1___1_nrnt	LMB_S454.373.C1___1_nrnt	Unknown	
6513	80	35	unmapped	0		0	TTTAGGAAGACCTACGACAAGACAGTGGCTCTGGGTCACAGACTAGATATAGTCTTCTAC	6283	0	UF_Msa_AF_110263	contig17985___1_nrnt	contig17985___1_nrnt	Unknown	
6514	80	36	unmapped	0		0	CAATTATGCATGGGACCAGTCAGAGAAATTTGTCAAAATTTACCTCACATTGAAGAATGT	6285	0	UF_Msa_AF_100096	contig13771___1rc_nrnt	contig13771___1rc_nrnt	Unknown	
6515	80	37	unmapped	0		0	AACTTCAAAAAGGCCAAGAAAGAGATGAAGAAGCTATGGGATATCCAAGGCCCAGCTAGG	6287	0	UF_Msa_AF_104930	contig19173___1rc_nrnt	contig19173___1rc_nrnt	Unknown	
6516	80	38	unmapped	0		0	TCACCGGGTATCAGCTGACTCTTTCATCCTGAAGACACTGGAGGAGGAGGACGACGACGA	6289	0	UF_Msa_CF_121255	contig08979___0	contig08979___0	Unknown	
6517	80	39	unmapped	0		0	TGACCACGTGATGCTAAAGATGGCGGCCAGCACCGGTGGTAAAGACGGTCAGGACAGTAT	6291	0	UF_Msa_CF_124055	contig24161___0	contig24161___0	Unknown	
6518	80	40	unmapped	0		0	TGGACGTCGCTGCTTTCAACAAGATCTGAAACCTGAAACGTTAATTAAAACCTTGATGTC	6293	0	UF_Msa_AF_104242	LMB_S454.sd.47.C1___1_nrnt	LMB_S454.sd.47.C1___1_nrnt	Unknown	
6519	80	41	unmapped	0		0	AAGCCTTTCAGGATGGGGTAGATGTTTTCAAATGCTTCGTAGATCTCTGCTCTCACCTTG	6295	0	UF_Msa_AD_200145	LMB_Add_168_rc	LMB_Add_168_rc	Unknown	
6520	80	42	unmapped	0		0	ACCTTTCGAACGGCTGGTGTCTGCGTACCGCAACAAGTTCACACGGAGCTACAACACAGC	6297	0	UF_Msa_AF_109265	contig08698___1rc_nrnt	contig08698___1rc_nrnt	Unknown	
6521	80	43	unmapped	0		0	GAAGCTGGAGCTACAGGCCCTGAGTCGGACCAAGCCATCTCGACTGGATCTGCTGCTCGA	6299	0	UF_Msa_AF_103748	contig12085___1_nrnt0	contig12085___1_nrnt0	Unknown	
6522	80	44	unmapped	0		0	ATTTCAACTGTGACCAAAATGCACTCAGTTTTAAACACCATGACCACAGAGAGTAAAAAA	6301	0	UF_Msa_CF_124164	contig31093___0	contig31093___0	Unknown	
6523	80	45	unmapped	0		0	CCGCTCATCAAGACGGCCAGGTGGTCTGCCCTGCTGCTCGGCGTCTTCTACGGCAAGCAG	6303	0	UF_Msa_AF_108046	contig05521___1_nrnt	contig05521___1_nrnt	Unknown	
6524	80	46	unmapped	0		0	CCGCAGGTGTGCAGATGGTACTGAGCTTCGAGGGAGAATAGTGGAAACTGAAGCCTATCT	6305	0	UF_Msa_AF_107198	contig30634___1rc_nrnt-1	contig30634___1rc_nrnt-1	Unknown	
6525	80	47	unmapped	0		0	ATGAAAAAAGAGTTCGAGCACAAGCCAAAAAATTCTCCCCCTCGTAAGGGCGAAGACTTG	6307	0	UF_Msa_AF_102256	contig31750___1rc_nrnt	contig31750___1rc_nrnt	Unknown	
6526	80	48	unmapped	0		0	AAGCCCTGGTGACCGCCAACCAGCTTCCACAGCCGCAGACTTTCCCGGAGTTCAAGAGGA	6309	0	UF_Msa_AF_104961	contig16223___1rc_nrnt0	contig16223___1rc_nrnt0	Unknown	
6527	80	49	unmapped	0		0	GAAAACACCTTTTAACTCAACCACACAGAGGTTCAAGAAGCAAGTCATGTATAACTGAGG	6311	0	UF_Msa_CF_125713	contig21116___0rc	contig21116___0rc	Unknown	
6528	80	50	unmapped	0		0	ACGTTAATCTGCTTCTAATGGAAGCGCGAATGCAGGCAGAACTGTTATACGTCTCTGAGA	6313	0	UF_Msa_AF_100552	contig24637___1_nrnt	contig24637___1_nrnt	Unknown	
6529	80	51	unmapped	0		0	GTGCTTCACCGCCCGGACATCCTTCTTCCCCAAAACCCGGAAAGCTAACGTCAATGTTAA	6315	0	UF_Msa_AF_109842	contig07583___1rc_nrnt	contig07583___1rc_nrnt	Unknown	
6530	80	52	unmapped	0		0	ACCAAACACAGGCTGCTACATACACGGTCTATTCCTGGAGGGGGCTCGCTGGGATATCGA	6317	0	UF_Msa_AF_103704	contig09152___1_nrnt0	contig09152___1_nrnt0	Unknown	
6531	80	53	unmapped	0		0	TGTGGGCAGCAGTCCTGGAGCAGAAGGATGCATGGCTGGTGGATGCATGGGCCTTAAGGC	6318	0	UF_Msa_CF_123180	contig01108___0	contig01108___0	Unknown	
6532	80	54	unmapped	0		0	CCATCCTGTCTGTCTGTTAGAGACGTCAGCTGAGAGGTGTTCTTCGGTCAGGTTACTATC	6320	0	UF_Msa_CF_122952	contig26366___0rc	contig26366___0rc	Unknown	
6533	80	55	unmapped	0		0	AACTTCCTACTACAATGCGACTTGCATACAGAGCAGAGGGAGCGGAGTGACAGCCGGTGC	6322	0	UF_Msa_CF_123199	contig24513___0rc	contig24513___0rc	Unknown	
6534	80	56	unmapped	0		0	AATCTTGTGCGCAAGAAGTGAACATGGAGAAGCACTGGTCGGCAGTTTGTGCTCTGATTT	6324	0	UF_Msa_CF_120377	contig25441___0	contig25441___0	Unknown	
6535	80	57	unmapped	0		0	AACGGAGTGCAGCAAGAGAATGGATTCAGCACCACGAACAGCGCCGGCAGGATGAACGGG	6326	0	UF_Msa_AF_104062	contig08231___1_nrnt	contig08231___1_nrnt	Unknown	
6536	80	58	unmapped	0		0	ATATGTTCTGCACTGGACCCAGCAAGTTTGAGGAAAATGTTTGCTTTGGTGATGCAGGAG	6328	0	UF_Msa_AD_200230	LMB_Add_76_rc	LMB_Add_76_rc	Unknown	
6537	80	59	unmapped	0		0	TAACTTCAAATTATCAGGTGCCAGCCAACATTGAAAACCTTGAATGCAGAACCTGCGTAG	6330	0	UF_Msa_AF_108284	contig21629___1_nrnt	contig21629___1_nrnt	Unknown	
6538	80	60	unmapped	0		0	ACAACTGTGATTTACATGGTGGAGGTCATCAACAAGGTTCAGGCAATCAGCCTCAACCAT	6332	0	UF_Msa_CF_127628	LMB_S454.341.C1___0	LMB_S454.341.C1___0	Unknown	
6539	80	61	unmapped	0		0	ATTTCTGAAGCCTATGGAGCAGACAAAGTGGTTCCTGCCTTGTCCAACAGCAACACAGGC	6333	0	UF_Msa_CF_119427	contig01821___0rc	contig01821___0rc	Unknown	
6540	80	62	unmapped	0		0	GGCATGTAAGGGCATGTGATTGGAGCATTATTTAATCAGCCACGCAAATAAAATAAAATT	6335	0	UF_Msa_AF_100703	LMB_S454.sd.9.C1___1_nr0nt1	LMB_S454.sd.9.C1___1_nr0nt1	Unknown	
6541	80	63	unmapped	0		0	GATGACAGGCATTCAAAGCTTCATTTGAAAAGCTTTGAGAAGCTTTGAATGTAAACAAAC	6337	0	UF_Msa_AF_108455	contig12351___1_nr0nt	contig12351___1_nr0nt	Unknown	
6542	80	64	unmapped	0		0	GCGAATGTATTGTGTTGCTGCCTGCAATGTTATGTATAACTTATAAGTTCTTTGCTATGT	6339	0	UF_Msa_AF_107302	contig30432___1_nrnt	contig30432___1_nrnt	Unknown	
6543	80	65	unmapped	0		0	TGGAAGCTTAACCGCTCATCTATTTTAACACCACTGTTTTAGTTTTTTACGAGTGTACTA	6340	0	UF_Msa_AF_100263	contig11069___1_nrnt	contig11069___1_nrnt	Unknown	
6544	80	66	unmapped	0		0	CACAAGGGATTTGCAACTTGACCGATTTACTTCTGATCTGAATGTATATTTATGTAGAGA	6342	0	UF_Msa_AF_103319	contig29269___1_nr1nt0	contig29269___1_nr1nt0	Unknown	
6545	80	67	unmapped	0		0	TGTTGCAGGATACCAGATCCTCCACATGGACTACAAACTATCTGGTGGGCTTCACCACTG	6344	0	UF_Msa_AF_105516	contig03394___1rc_nr1nt0	contig03394___1rc_nr1nt0	Unknown	
6546	80	68	unmapped	0		0	AGAATGTGGCCAGTCTGATAAACGAGAGGAAGAGACGGCTAGAGAGTGTCGACACCATTG	6346	0	UF_Msa_AF_102617	contig17473___1_nr0nt	contig17473___1_nr0nt	Unknown	
6547	80	69	unmapped	0		0	AACTCTTTATGAAGACCATCCGCTGTGGGGAACCTGGGGAATTAAAGGACTAGATAAACC	6348	0	UF_Msa_CF_120432	contig18194___0rc	contig18194___0rc	Unknown	
6548	80	70	unmapped	0		0	AGGACAAGCACTTTGGCAAAACGTCTTACAGCGTGCTGTCAAATGAGCAGGAGATTCAGT	6350	0	UF_Msa_CF_119852	contig07147___0	contig07147___0	Unknown	
6549	80	71		0		0		692	1	RC1	RC1	RC1		CONTROL
6550	80	72	unmapped	0		0	TTTGTCTTCAACCTTGAAGTCACTGCTTTTGAAGAGGCTTATCAGCGGAAACGGGAAGAC	6353	0	UF_Msa_CF_125558	contig12900___0	contig12900___0	Unknown	
6551	80	73	unmapped	0		0	TCTGCCTCGTTCCGCTTGTCAAACCGGATGAAGCCCACTCCGCGTGATATGCCTGCTGTG	6355	0	UF_Msa_AF_108433	contig18004___1rc_nr0nt1	contig18004___1rc_nr0nt1	Unknown	
6552	80	74	unmapped	0		0	TCCTTTAAATGGAAGAGATGCACCACTGGAAGCTTTTGGAAGAGGAAGCGAGAAGAGGAA	6357	0	UF_Msa_CF_121290	contig24796___0rc	contig24796___0rc	Unknown	
6553	80	75	unmapped	0		0	GCTGTGGAAAACAAGTCTGGAAGCCAACTCCAAGCCAATTGCACAAGCCACCATCAAGTG	6359	0	UF_Msa_CF_122458	contig05868___0	contig05868___0	Unknown	
6554	80	76	unmapped	0		0	GCTCATCTTTATTGGTTTTACTTCTAGATGTTCACATATCAGTGCACTTTCCTCCCACTC	6361	0	UF_Msa_AF_104407	contig29532___1_nr0nt	contig29532___1_nr0nt	Unknown	
6555	80	77	unmapped	0		0	ATCAGCAATTATGCTCAGGAAGCATTAGGTGACGTGGTATACTGTGGACTCCCTGAAGTT	6363	0	UF_Msa_AF_102580	contig29872___1rc_nrnt	contig29872___1rc_nrnt	Unknown	
6556	80	78	unmapped	0		0	AAAGTTTGAGACACGGAGGCACAGTGTTTAGACTAACAGGCCAGTTTGTTTGTTTCTGTA	6365	0	UF_Msa_CF_118018	contig10942___0	contig10942___0	Unknown	
6557	80	79	unmapped	0		0	ACCAGCATCTCTCCCTACAAAGGGGCTTTTTGAGGTCCTTTGGGACGCAGCGGCTTTTGG	6367	0	UF_Msa_CF_126586	contig25633___0	contig25633___0	Unknown	
6558	80	80	unmapped	0		0	AAACCTATGGACCCCCAGTGCCTGAACTGGAGTCAGCTGGGCAGACTTGGGTATCTCAAC	6369	0	UF_Msa_AF_104098	contig13419___1_nrnt0	contig13419___1_nrnt0	Unknown	
6559	80	81	unmapped	0		0	AAGATCTTTGATGCTCTGGAGTCACATCAGGACGGAGACGACGACATGCCTGCCATCCAG	6371	0	UF_Msa_CF_122300	contig24535___0	contig24535___0	Unknown	
6560	80	82	unmapped	0		0	ATTTATACACCATCCACAGACAATGTTGTGAGCTTTTCCACACAAAACCGAGTTTCAAAT	6373	0	UF_Msa_CF_120563	contig27558___0	contig27558___0	Unknown	
6561	81	1	unmapped	0		0	GAGCTGTCACTCCCAAAGTTCTCCATGTCTTCGGTGACTGATCTGCCTGACCTGCTGACC	6374	0	UF_Msa_CF_125578	contig10439___0rc	contig10439___0rc	Unknown	
6562	81	2	unmapped	0		0	GGGAACTGAGATGGACTTTGTGGAGTCAAAACTGTCCAGTGAATTTGTCTTCAACAATCT	6376	0	UF_Msa_AF_100131	contig18633___1rc_nrnt	contig18633___1rc_nrnt	Unknown	
6563	81	3	unmapped	0		0	AGTGAAAGACCTCAGGGAGAAAACACAGAGTGGGAAACAGCTGCTTCCACTTTGCTTCAA	6378	0	UF_Msa_CF_126094	contig04296___0	contig04296___0	Unknown	
6564	81	4	unmapped	0		0	CAGAAAAGGAAGAGGTCTGGTGGTGTCTCCAAAGGATTATTCTACAAAATACAGATATTG	6380	0	UF_Msa_AF_103749	contig27204___1_nrnt	contig27204___1_nrnt	Unknown	
6565	81	5	unmapped	0		0	CCGGCACACTTAGGGAGTACAAAGTCGTTGGGCGTCTGCTGCCCTCAGCGAAGAATCCCG	6382	0	UF_Msa_AF_106607	contig26156___1_nrnt	contig26156___1_nrnt	Unknown	
6566	81	6	unmapped	0		0	TGACCAGGCAGGAATCAAAAATCCAATGGGCAGACAATAAGGTCAAAGACGGAAAAGTAA	6384	0	UF_Msa_CF_120021	contig22740___0rc	contig22740___0rc	Unknown	
6567	81	7	unmapped	0		0	TCTTCGGAGCCTTAACTGGATCAGGCATCTTCAACTTCGTAATAGTTCTCAACGAATCCC	6386	0	UF_Msa_CF_125388	contig21555___0rc	contig21555___0rc	Unknown	
6568	81	8	unmapped	0		0	TGGTGATGAGTGATCAGCCTTTCAGCTCTGGCCGCCAGGTCGTGGTGGAACGTCATAACA	6388	0	UF_Msa_AF_104024	contig31985___1_nrnt0	contig31985___1_nrnt0	Unknown	
6569	81	9	unmapped	0		0	TGTAACTGTGGTTCAAGGTTATGTGAACCCGTGACCGGCGACTGTATCTGCCCTCCGAGG	6390	0	UF_Msa_AF_110285	contig13885___1rc_nrnt0	contig13885___1rc_nrnt0	Unknown	
6570	81	10	unmapped	0		0	TGGCAGATGGTATGGCAGGAGAACACGAGGGTGATCGTAATGACATCAAGAGAGGTTGAG	6392	0	UF_Msa_AF_107835	contig06742___1_nr0nt	contig06742___1_nr0nt	Unknown	
6571	81	11	unmapped	0		0	TGGTATCAGTGTGAGGAGTCTGTGCACTTCTTGCCAAATACAAAACAAACCCATGACGCT	6394	0	UF_Msa_AF_107533	contig04870___1rc_nr0nt1	contig04870___1rc_nr0nt1	Unknown	
6572	81	12	unmapped	0		0	GACATACACCACAGACTACAGAGGAACTCTGATAGGAGAAGGTATGCAGATAAAGGTAAG	6396	0	UF_Msa_AF_107869	contig12468___1_nrnt0	contig12468___1_nrnt0	Unknown	
6573	81	13	unmapped	0		0	GGGGAGGTTGAATGTAGAGAGGCTTACTACTGTACGTAACATTACAGGGTGGGTGTAGAA	6398	0	UF_Msa_CF_125923	contig21485___0	contig21485___0	Unknown	
6574	81	14	unmapped	0		0	AATTGCAGTGGACATCTCAATGTGGACACAGCGTTGAGGGAGGACATGGAGGTCCTGCGG	6400	0	UF_Msa_CF_122442	contig18895___0rc	contig18895___0rc	Unknown	
6575	81	15	unmapped	0		0	TGCAAGATTTGAGCTGAAGTCTTCACCACAAACAATTATACTCACATCAAAACCCCCGAC	6402	0	UF_Msa_AF_103252	contig01208___1_nr0nt1	contig01208___1_nr0nt1	Unknown	
6576	81	16	unmapped	0		0	ATTGCGAGGGCAGATTGTTTGTAAACACTGCCATTCCAGAACACCACCTCCAGAAACTAT	6404	0	UF_Msa_CF_126706	LMB_S454.sd.52.C1___0	LMB_S454.sd.52.C1___0	Unknown	
6577	81	17	unmapped	0		0	ATCGTACTACAGTCCTCTACATATAGCTCGTTTTGAGGAACAGGCCACACTATGGTGAAG	6406	0	UF_Msa_AF_100242	contig29410___1_nrnt0	contig29410___1_nrnt0	Unknown	
6578	81	18	unmapped	0		0	ATTACAACACAAGCCATTTCCCTTGGAGAGCTGAGTTCCTAGTCTTTCATGGTGACTGAG	6408	0	UF_Msa_CF_121388	contig32617___0	contig32617___0	Unknown	
6579	81	19	unmapped	0		0	GACAAGAAGCGGACCGTTCATCGTCTGAAACGTCTCAAAGGAAAACTTTCAAAAGCATGG	6410	0	UF_Msa_CF_124686	contig18048___0	contig18048___0	Unknown	
6580	81	20	unmapped	0		0	ATCTTTGGCTGAGAAAAATGGCGTCGGATAATGGACTGGCCTCTCTGGGGCTGGAGGGAG	6412	0	UF_Msa_CF_122337	contig26769___0	contig26769___0	Unknown	
6581	81	21	unmapped	0		0	CATACGGCTCATGTATTACGCTCAGGGTCACTAGCAGACCCCAAAAAGTAAAATAGAAAA	6414	0	UF_Msa_CF_123119	contig08921___0rc	contig08921___0rc	Unknown	
6582	81	22	unmapped	0		0	GTGTGATGGCCTTGATCGCATTGTTGAGCAGTGTAACCTGCCTGACCTGCAAGTGGGTGA	6416	0	UF_Msa_AF_100357	contig19233___1_nr0nt1	contig19233___1_nr0nt1	Unknown	
6583	81	23	unmapped	0		0	TGAGCTCAATCACTGCAGCAGTAAAGGGGAAGATTCATTGATGCCAAACAAAAAGCAGCC	6418	0	UF_Msa_CF_122085	contig22463___0rc	contig22463___0rc	Unknown	
6584	81	24	unmapped	0		0	AGGAAGATCAGTTACAGCCGCATCCCTGATAACGAGGCAGAAGGCGGGGCCGTCTCTGCC	6420	0	UF_Msa_CF_117995	contig20800___0rc	contig20800___0rc	Unknown	
6585	81	25	unmapped	0		0	GACAAGATGTCAAGCGTGGAATCTTAAAGCTGACTGTCCCATCGACTACATATTGGGTGA	6422	0	UF_Msa_CF_122547	contig14371___0rc	contig14371___0rc	Unknown	
6586	81	26	unmapped	0		0	ATCACATGGGTGCATTCATCACAACAGTGTTGAAAGGTATGATCCAGAAAGGGACCAGTG	6424	0	UF_Msa_AF_109293	contig25445___1_nrnt	contig25445___1_nrnt	Unknown	
6587	81	27	unmapped	0		0	TCAGTACCTTGACATGATCACTGATGGAAGTGCTGCCATTCCAAGCATACCTGCTCTATT	6426	0	UF_Msa_AF_106136	contig29266___1_nr1nt0	contig29266___1_nr1nt0	Unknown	
6588	81	28	unmapped	0		0	CAAACTGGGAGGGGTTTGCATATCATTATGTTAATGAGATCTCCTTCATGTTGGAAAAAA	6428	0	UF_Msa_AF_107141	contig15803___1_nr0nt	contig15803___1_nr0nt	Unknown	
6589	81	29	unmapped	0		0	GGCCAACCAGGACTTCCTGAAGGTGGACCCTGACAGCCCGCAGTTTAAAGATGTTGAGTA	6430	0	UF_Msa_AF_106362	contig24463___1rc_nrnt0	contig24463___1rc_nrnt0	Unknown	
6590	81	30	unmapped	0		0	AAAGAGCTGTTTATCGGAAAACTGCCCGGAGAAGAGGAGGCGTTGAGTGGTGGGTGTAGC	6432	0	UF_Msa_CF_121723	contig25744___0	contig25744___0	Unknown	
6591	81	31	unmapped	0		0	TCCCAGAAAGCTCCGTTTCATCCAGTTCGCATCAGCGATCTACGAAGACGAGCCCTACAT	6434	0	UF_Msa_CF_119916	contig02362___0rc	contig02362___0rc	Unknown	
6592	81	32	unmapped	0		0	TCTATCTGCCTCCCTGTGTGCTCTGCAGAGTGGCTTCACTAACCATCAAGCCTCGCGCAT	6436	0	UF_Msa_CF_118052	contig23086___0	contig23086___0	Unknown	
6593	81	33	unmapped	0		0	TGTGAATCAGTCCATCTGACTCGGGGGCAACGTGAAGCTCAGTTGCCCCTCGCCTTCTAA	6438	0	UF_Msa_CF_125276	contig02954___0	contig02954___0	Unknown	
6594	81	34	unmapped	0		0	GACACTTATGTACAAAAGCATAAATATATAAATATCTGTGATACAAAAATAAATATTTTC	6440	0	UF_Msa_AF_106961	contig16302___1_nr0nt	contig16302___1_nr0nt	Unknown	
6595	81	35	unmapped	0		0	GTCTTGATTTATTGATTTGGCCATTTGATCGGACATTTATTGCACTGTTTCTTGTTGGTT	6442	0	UF_Msa_AF_101849	contig27673___1rc_nrnt	contig27673___1rc_nrnt	Unknown	
6596	81	36		0		0		2230	1	ETG10_195139	ETG10_195139	ETG10_195139		CONTROL
6597	81	37	unmapped	0		0	TTCTTGGCTGACCTTCTGCAGCCAATGAAAGCAAGGTTCCCAGCCTTTGAGGTGTAAACG	6445	0	UF_Msa_AF_110017	contig21668___1rc_nrnt	contig21668___1rc_nrnt	Unknown	
6598	81	38	unmapped	0		0	AGAATCACACTGATCATCAGTCACTGTACAACACAAGCAGGAAACACATCACCATGCGGA	6447	0	UF_Msa_AF_102632	contig03985___1_nr0nt1	contig03985___1_nr0nt1	Unknown	
6599	81	39	unmapped	0		0	ATTTCTAGATGAGAATGTGCACTTTTTCCACACCAATTTCCTAGTGTCACAGATAATCCG	6449	0	UF_Msa_AF_101456	contig08687___1rc_nrnt	contig08687___1rc_nrnt	Unknown	
6600	81	40	unmapped	0		0	TCAAGAGGGAAATGCCAACCAACAGGGAGAGACAGAAGAAGATATGGACAACACAGATTT	6451	0	UF_Msa_AF_107273	contig29785___1rc_nr1nt0	contig29785___1rc_nr1nt0	Unknown	
6601	81	41	unmapped	0		0	AGGACATGATGGAGGAAGGTGGTGAGGGTAGAGCATGCTAGGTCTCCTCTGTGCTGCACT	6453	0	UF_Msa_CF_121319	contig08884___0rc	contig08884___0rc	Unknown	
6602	81	42	unmapped	0		0	TCCCTCTGATCTACATCGCATTCCAGTGTACCGAGGCCCTTCTTATGTGCCTGTGCTTCA	6455	0	UF_Msa_AF_100397	contig02672___1rc_nrnt0	contig02672___1rc_nrnt0	Unknown	
6603	81	43	unmapped	0		0	ACATTAGAACACAAACACTGGATGGGCAGCAAAACGTTGAATGTGGGAGCACGTTGGAGG	6457	0	UF_Msa_CF_118551	contig10507___0	contig10507___0	Unknown	
6604	81	44	unmapped	0		0	GATATGACAAGCAAGGATGATGGATACATTTTCGAACCTACTATAGGAGAAGACAAGAAA	6459	0	UF_Msa_CF_126389	LMB_S454.35.C1___0	LMB_S454.35.C1___0	Unknown	
6605	81	45	unmapped	0		0	CGCTTGAGAGTCTTAAATCTCACTGGACTCAATACGAGTAAAATCAAAATGTCCTGTCTA	6461	0	UF_Msa_CF_124212	contig31382___0rc	contig31382___0rc	Unknown	
6606	81	46	unmapped	0		0	GACCACACTATCATGTTTTCATTGGCTAACGTCTTGGGGAAATTACAGAAATACAAGGAG	6463	0	UF_Msa_AF_105790	contig08271___1_nrnt0	contig08271___1_nrnt0	Unknown	
6607	81	47	unmapped	0		0	CATCACACACTTGACAATATATCTTTCATCTCTGGACTTACATGATGCTGTTTTCTATCC	6465	0	UF_Msa_AF_106382	contig14488___1_nr1nt0	contig14488___1_nr1nt0	Unknown	
6608	81	48	unmapped	0		0	ATGTATATTTTTCATGTTATGAAACCTGTCACCTGTAGTGAGTTCCTCTAAAATATGTAC	6467	0	UF_Msa_AF_102045	contig02025___1_nr0nt	contig02025___1_nr0nt	Unknown	
6609	81	49	unmapped	0		0	AAGCTAAGAAAATCGGGCAGTCTATCAAATTTAATGGTGGCAGTGGAACGGGGCAGTTCA	6469	0	UF_Msa_AF_100665	contig27736___1_nr1nt0	contig27736___1_nr1nt0	Unknown	
6610	81	50	unmapped	0		0	AACCACGACCGGATACAGAGGCTGAGGCAGGAGTTCCAGCAGTCCCAGAACGTCCCTGAC	6471	0	UF_Msa_AF_103168	contig16205___1rc_nrnt-1	contig16205___1rc_nrnt-1	Unknown	
6611	81	51	unmapped	0		0	ACCTTTAACGAAGCAGCCCCCGCCGCACGTTTCACCTACGTGCACGAATTCTCTGTGGTA	6473	0	UF_Msa_AF_108289	contig31031___1_nr0nt1	contig31031___1_nr0nt1	Unknown	
6612	81	52	unmapped	0		0	GGTGGCTTTTCAAGTTGGTACTGCTTACAAAACCTGTAAGAAATGATTAATGGAACAATA	6475	0	UF_Msa_AF_109133	LMB_S454.sd.223.C1___1rc_nr1nt0	LMB_S454.sd.223.C1___1rc_nr1nt0	Unknown	
6613	81	53	unmapped	0		0	TTGGCTGAAAAGCTCAGATATTTCAGCCAGCATCAAGTTCATGTGTCTCTGCATCAGAGC	6477	0	UF_Msa_AD_200070	LMB_Add_138	LMB_Add_138	Unknown	
6614	81	54	unmapped	0		0	TTTTCCCGGGACTTTCCCAATTCTAAGACAGAGGAGTTGTTGCTTTTCAGCAAAAGGAGG	6479	0	UF_Msa_AF_107339	LMB_S454.694.C1___1_nr1nt0	LMB_S454.694.C1___1_nr1nt0	Unknown	
6615	81	55	unmapped	0		0	TGACTAATCCAGCGGGCTGTGGACGTGACAGCTCTGAGCGACTTTCTGTTTCTGACGGAG	6481	0	UF_Msa_CF_121285	contig10505___0	contig10505___0	Unknown	
6616	81	56	unmapped	0		0	ATTGTGAAGCTCATTGCTTGGCGGGCGTGTAATGCTAATGAAAATGAGGGAAAGGAGTCA	6483	0	UF_Msa_CF_119087	contig16052___0	contig16052___0	Unknown	
6617	81	57	unmapped	0		0	TGTGATGACGTCACGGGGCTCTGACAAGCTGGTGGTGCCGGAAGAAAAGATGGCGGATCA	6485	0	UF_Msa_AF_107535	contig12842___1_nr0nt1	contig12842___1_nr0nt1	Unknown	
6618	81	58	unmapped	0		0	GTTACACAAAAGAGCATGGGAAATACAGTTTTAGTCATGAATGACAGATTGCATTTTAAG	6487	0	UF_Msa_AD_200059	LMB_Add_46_rc	LMB_Add_46_rc	Unknown	
6619	81	59	unmapped	0		0	TCGGGCACCAAGATCATCAAAGCACATGAGGAGAGGCAGCTGCAGGAGGCTGTCATCAGG	6489	0	UF_Msa_CF_122910	contig24060___0	contig24060___0	Unknown	
6620	81	60	unmapped	0		0	GTGTTTTTCCCCAACTACTTACATCCTCAGTCATGTTTTGTAATTAGAGCAGTTTAAAAG	6491	0	UF_Msa_AF_107441	LMB_S454.sd.219.C1___1_nr0nt1	LMB_S454.sd.219.C1___1_nr0nt1	Unknown	
6621	81	61	unmapped	0		0	ATCCATTGGAGAAATACATGAAGATGGTCCTGGAAGCAAGAGAGAAGCAGCATGCGCAAA	6493	0	UF_Msa_CF_125673	contig01553___0rc	contig01553___0rc	Unknown	
6622	81	62	unmapped	0		0	CTCACACCACTTCTTCGGGCTCTAAGTCGGGCGGGGACAAGATGTTTTCCCTGAAGAAGT	6495	0	UF_Msa_AF_106732	contig04718___1_nr0nt1	contig04718___1_nr0nt1	Unknown	
6623	81	63		1028	E1A	0		479	1	(+)E1A_r60_1	E1A_r60_1	E1A_r60_1		CONTROL
6624	81	64	unmapped	0		0	AAGTACCACCCCAAGTGACATACAGAGACAAAGAGAAAGCGGATGATATAGACAGCAACC	6498	0	UF_Msa_CF_123026	contig11086___0rc	contig11086___0rc	Unknown	
6625	81	65	unmapped	0		0	CCGCTGGTAACCTGCTACAGGAAGCGATGCCGTCATGATTTGTGTCCCCCTGGAAACAGC	6500	0	UF_Msa_CF_118799	contig14462___0rc	contig14462___0rc	Unknown	
6626	81	66	unmapped	0		0	CACCTTCCCTCGACGCAACTCCAGAAGTTCTGAGTACTGCAACTACCCTGACATAAACTT	6502	0	UF_Msa_AF_103309	contig18719___1_nrnt0	contig18719___1_nrnt0	Unknown	
6627	81	67	unmapped	0		0	TATCCTTCAGATTACGGCAAACGGTAACACATGTAAGGTCCCTTCATACCAGTGGATGTG	6504	0	UF_Msa_CF_126155	contig00420___0	contig00420___0	Unknown	
6628	81	68	unmapped	0		0	AGTTATTACTAATCTCCTCTCGGCCATCCCCTACATCGGCAACACTTTAGTTCAATGAAT	6506	0	UF_Msa_AD_200243	DQ451323	DQ451323	Unknown	
6629	81	69	unmapped	0		0	CCAGCAGTTTTCTTCTGGGGAAACTCCAACTGGGGAAAATATAAAGCTGATTTGTTTTTT	6508	0	UF_Msa_CF_127653	contig05176___0	contig05176___0	Unknown	
6630	81	70	unmapped	0		0	GTTTTGAGACTAGGCTGCTGTCCACTGGGGCCTCAAGTGGGATAGACTCTCAGTTCTTTG	6510	0	UF_Msa_CF_125922	contig14498___0rc	contig14498___0rc	Unknown	
6631	81	71	unmapped	0		0	GTGCTGAGGACAAACCCCAGGCATTTTTAGCTTAGATTAGTTAAAAACTTTAAAATCCTT	6511	0	UF_Msa_CF_122960	contig05146___0rc	contig05146___0rc	Unknown	
6632	81	72	unmapped	0		0	TGCACTGATATGAGAATGTACCATCAGATGACTTTTAGCCACAGTGAAATAAATGGGACT	6513	0	UF_Msa_CF_118878	contig29941___0	contig29941___0	Unknown	
6633	81	73	unmapped	0		0	ACGAGATCTTTATTCATCACTATCAGTTACCACTAACAGTTCGGGACATTGTTAAAGAGC	6515	0	UF_Msa_CF_127179	contig01213___0rc	contig01213___0rc	Unknown	
6634	81	74	unmapped	0		0	GTTCTGCCTGCTTTGCTTAAAGATTTAGTTAGCTAAATAAGCACTACACTTGCAAAGTTT	6517	0	UF_Msa_AF_102095	contig28313___1_nr1nt0	contig28313___1_nr1nt0	Unknown	
6635	81	75	unmapped	0		0	AGGAAGTCCTACCTTCCACCTCCTCTCAGCTGGCTGAGCTGATGATGGTATCTCGGGTCA	6519	0	UF_Msa_CF_124001	contig24448___0	contig24448___0	Unknown	
6636	81	76	unmapped	0		0	CAGACTCCAAACCTGGAAATGACACTGTTTAAAATGTTTGTTTGTGTTTGTGTATAGAAC	6521	0	UF_Msa_AF_101525	contig13748___1_nr0nt1	contig13748___1_nr0nt1	Unknown	
6637	81	77	unmapped	0		0	AAATCAGCATGAAGATCTTCGGCGAGCTGGACGCAGAGAGTCTGTGCAGCGCCTCGTTGA	6523	0	UF_Msa_CF_118808	contig25456___0rc	contig25456___0rc	Unknown	
6638	81	78	unmapped	0		0	CTTGGCATAAAAAGCTATTCATGGCATCATCTGCACTGTAAAATATGGCTCTTGTAAATA	6525	0	UF_Msa_AF_103929	LMB_S454.37.C1___1rc_nrnt	LMB_S454.37.C1___1rc_nrnt	Unknown	
6639	81	79	unmapped	0		0	TAATCTGTCAGACAGAGATCCATCACTGCACTGGATATGAACAATGGTAACAACAAATCG	6527	0	UF_Msa_CF_126938	contig31991___0rc	contig31991___0rc	Unknown	
6640	81	80	unmapped	0		0	AACGAGACGATGTGAGAAGTAGAGCTATGGTAGAATTGAGTAATGTTAACAGTTTCTGGT	6529	0	UF_Msa_AD_200380	LMB_Add_21_rc	LMB_Add_21_rc	Unknown	
6641	81	81	unmapped	0		0	CTGCTGCCCCGTCTATCCCTGAGGGAATCCCCAGTGACAGCAAGACTAACAAGGATGGTG	6531	0	UF_Msa_AF_101790	contig30029___1_nr0nt1	contig30029___1_nr0nt1	Unknown	
6642	81	82	unmapped	0		0	ATTGGTTACAAAGGTTGCACATTCCACAGGGTGATCAAAGACTTTATGATACAAGGGGGG	6533	0	UF_Msa_AF_100875	contig30269___1rc_nrnt-1	contig30269___1rc_nrnt-1	Unknown	
6643	82	1	unmapped	0		0	TCCTGAGCAACACACCACTTTCTCCACATGAGCCAGGGGCTAAATTACAGAAACTTCCTG	6375	0	UF_Msa_CF_124850	contig11233___0rc	contig11233___0rc	Unknown	
6644	82	2	unmapped	0		0	CACGGGCATGGGCGGACATTCCCCTTAAACGATTACTGTCCAGCCGAAAACTACGGTCCA	6377	0	UF_Msa_CF_121002	contig13954___0rc	contig13954___0rc	Unknown	
6645	82	3	unmapped	0		0	TTAATGACCCTCACTTAACAATCAAGGCCATGGGCCACCAATGATACTGAAGCTACGAGT	6379	0	UF_Msa_AD_200040	LMB_Add_71	LMB_Add_71	Unknown	
6646	82	4	unmapped	0		0	TGTGATCCAGGAGCTGAGGCAGCAGTACAGTGACGCTCCGGTAGGAGATCAGGGACAGGC	6381	0	UF_Msa_AF_106951	contig09170___1rc_nrnt-1	contig09170___1rc_nrnt-1	Unknown	
6647	82	5	unmapped	0		0	TGCGCTGTCCTCACGCTGCCTGTGTTTGGACTCCTGGCCTTCACTTTTGTCCCTCCACTT	6383	0	UF_Msa_AF_105836	contig06330___1rc_nrnt0	contig06330___1rc_nrnt0	Unknown	
6648	82	6	unmapped	0		0	AAGGGGAAAGAAACAACAGTGTTTATAGAGAGTCGCGGAGAACAAGAAAGGCATCGTTCA	6385	0	UF_Msa_CF_121155	contig17181___0	contig17181___0	Unknown	
6649	82	7	unmapped	0		0	TTTCAGATTTCAAATCCATCACCGATGGAAGAATCTGCTGCACGTCCACAGGATCTGTTC	6387	0	UF_Msa_CF_127490	contig31977___0rc	contig31977___0rc	Unknown	
6650	82	8	unmapped	0		0	GCGACGACACGGATGACATGGACACTGATGCTGGCTCCTGATTGGCTGAGCAGACACATT	6389	0	UF_Msa_CF_119545	contig12790___0	contig12790___0	Unknown	
6651	82	9	unmapped	0		0	GGACCTGTCCTCACTGTTTTATCTTCCTGCCACCAGGGGGCAGTATCTCCTCTGTGCCTA	6391	0	UF_Msa_AF_100246	LMB_S454.sd.173.C1___1_nrnt	LMB_S454.sd.173.C1___1_nrnt	Unknown	
6652	82	10	unmapped	0		0	GAACCATGTTTTTCACCTATGTCGGTTGTTCCTAAAGCTGTTAAACATGATGTTAATACA	6393	0	UF_Msa_AF_109831	contig25483___1_nrnt	contig25483___1_nrnt	Unknown	
6653	82	11	unmapped	0		0	TCATGTGACCAACTCTGTACTGGCCCTGGTGGATGGGAAACCGTGGCCTCTCCACCAGCC	6395	0	UF_Msa_AF_101489	contig04161___1rc_nrnt-1	contig04161___1rc_nrnt-1	Unknown	
6654	82	12	unmapped	0		0	TGCATAATCCGAGTAGTCATCTTCGTGTTTTTGACCCCTGTTCAAGAGTTATCCAGCACC	6397	0	UF_Msa_CF_123118	contig22786___0rc	contig22786___0rc	Unknown	
6655	82	13	unmapped	0		0	AATACCTTCACTGCAGCCGATGCAGACAGGGTGAAGGAGCTGGACCGGCTGTTCAATCAG	6399	0	UF_Msa_AF_110201	contig32089___1_nr1nt0	contig32089___1_nr1nt0	Unknown	
6656	82	14	unmapped	0		0	TACTGTTGGTGTTCATGAGCACGGCAGGAGTAAACCGGCGAAGACGATACCGGGGGAAGA	6401	0	UF_Msa_CF_127062	contig21861___0	contig21861___0	Unknown	
6657	82	15	unmapped	0		0	ATATATCAGCAGTCTGAAACAGGCACTGAGACAGTTCAACACCAGCATCCAGGAGATCAT	6403	0	UF_Msa_AF_110059	contig26061___1rc_nrnt0	contig26061___1rc_nrnt0	Unknown	
6658	82	16	unmapped	0		0	TTTGATGCTGATGCAACAATAACGTGCCCGGAAGAAGAACCCGGGCACTAAACGCTTCAC	6405	0	UF_Msa_CF_127055	contig15304___0rc	contig15304___0rc	Unknown	
6659	82	17	unmapped	0		0	AAGAAAGAAGAGAGAGCATGAATTGGGAGTGTGTGGCGTCTACAGCTATCGACAAACCAA	6407	0	UF_Msa_AF_105618	contig31924___1_nr0nt1	contig31924___1_nr0nt1	Unknown	
6660	82	18	unmapped	0		0	GCTGCAAGTTGGACATGAGGACGGACCTCAACGTCATGAGAGAGCTTTCCAAACACAGAC	6409	0	UF_Msa_AF_107537	contig10359___1_nrnt	contig10359___1_nrnt	Unknown	
6661	82	19	unmapped	0		0	CACAACTCTTTACCTGAGAATGTGGATTTTCTCCCTTTTGAAGAAAATAAAAGTTCTGTG	6411	0	UF_Msa_CF_121283	contig04151___0rc	contig04151___0rc	Unknown	
6662	82	20	unmapped	0		0	ATAACTGCAGTGGGATCAAACCCGACAGAAAGATGAGGAAACCTCTGGTCGAGAAGAAAA	6413	0	UF_Msa_CF_120434	contig02070___0	contig02070___0	Unknown	
6663	82	21	unmapped	0		0	CACATACTCTAATACGCACATATACACACATTTTTGTCTCGTGGAGATTTAAGCTATACA	6415	0	UF_Msa_CF_122138	contig08964___0rc	contig08964___0rc	Unknown	
6664	82	22	unmapped	0		0	AGGGGTCAACAACATTCCCCCAGCACGCTGGAAACTGACCTGCTACCTGTGCAAGCAGAA	6417	0	UF_Msa_AF_103514	contig00197___1_nrnt	contig00197___1_nrnt	Unknown	
6665	82	23	unmapped	0		0	CCCTGCGCGGGGATGGGAGTCAGCTTCCAGCACTTGGAGCAGCTTAATGACAGTGGGATG	6419	0	UF_Msa_CF_118478	contig06747___0rc	contig06747___0rc	Unknown	
6666	82	24	unmapped	0		0	AGTGATGTTGAAGCAAGGATATCATCATCGGCACCAAGTGTACCCTGGAGTTTCAGGTGG	6421	0	UF_Msa_CF_124335	contig15798___0	contig15798___0	Unknown	
6667	82	25	unmapped	0		0	TCTCAAGCAGCATTTCCATTCAGAGGAGCTCTCGCTTTATTTCAGGAGAAGGTGGATTTG	6423	0	UF_Msa_CF_122387	contig28264___0rc	contig28264___0rc	Unknown	
6668	82	26	unmapped	0		0	TGGAAGCTGTTAGAGTCAGCGCACAGGAGTGGGACTCCATGAGCCGTGAGTTTGCAGCAA	6425	0	UF_Msa_CF_125391	contig10583___0	contig10583___0	Unknown	
6669	82	27	unmapped	0		0	TACAAGAAGGCCTGCCACAGCCTGGCAGTGGATGAGAACAAGCGCATCGCCCGGCTGTGT	6427	0	UF_Msa_AF_109593	contig24896___1rc_nrnt	contig24896___1rc_nrnt	Unknown	
6670	82	28	unmapped	0		0	TCTGAGGAATGATGGTACAATGGTCTTTATCAAGTTCTGCCCTCAACCCAGTTCAAATGG	6429	0	UF_Msa_CF_121393	LMB_S454.1145.C1___0rc	LMB_S454.1145.C1___0rc	Unknown	
6671	82	29		0		0		6431	1	DCP_20_7	DCP_20_7	DCP_20_7		CONTROL
6672	82	30	unmapped	0		0	TTTAAAAACATGGCTTCCAGGCCTTATTCGATCCACGCCCACGGAGTCAAAACAGAAAAC	6433	0	UF_Msa_AF_104414	contig05014___1rc_nrnt-1	contig05014___1rc_nrnt-1	Unknown	
6673	82	31	unmapped	0		0	TCCTTTGTCAACATTGAGCGAAAGCTTGACTCCTTCTTAAAGTAGTGGCCATGCAAGCGA	6435	0	UF_Msa_AF_101577	contig00560___1_nrnt	contig00560___1_nrnt	Unknown	
6674	82	32	unmapped	0		0	GGGGCCAGGAGGATGAAGTGGGCTCTGGAGCTGAGCTTGGGCAACACCAGGAGTCGCGGT	6437	0	UF_Msa_CF_125350	contig12582___0rc	contig12582___0rc	Unknown	
6675	82	33	unmapped	0		0	AATGACTGATTCTGCAAGAACTCACTAAACAGGAACTCCCCACCACAGCAACTTTAGCAG	6439	0	UF_Msa_AD_200216	AY225744	AY225744	Unknown	
6676	82	34	unmapped	0		0	CGGGAGGAGAAGCTGCTGCAGGACCAAGAGAGGCTGGACAGACTTATGGCAATACAGGAG	6441	0	UF_Msa_AF_102596	contig24631___1_nr0nt	contig24631___1_nr0nt	Unknown	
6677	82	35	unmapped	0		0	CATCAACTGCCAGTCCAAACTCACAGGAGATGCCTGCACCATGAATCTGGTCATTTACCG	6443	0	UF_Msa_CF_126999	contig19726___0rc	contig19726___0rc	Unknown	
6678	82	36	unmapped	0		0	TGTGCCGTACACCATCAGCCAGACCCGAGTTCTATTTGACTGTAAACTCAAACTCTTCTT	6444	0	UF_Msa_AF_100923	contig16656___1rc_nrnt0	contig16656___1rc_nrnt0	Unknown	
6679	82	37	unmapped	0		0	AAACACGTCCATCAGTAAAGATAGTCCCAAAGTGGTCCACAGCTTTGACATGGAGGACAT	6446	0	UF_Msa_AF_108827	contig27138___1rc_nrnt	contig27138___1rc_nrnt	Unknown	
6680	82	38	unmapped	0		0	GCTGACGCTGTGCGCTGGCTGGCAGGGACTCGACGGCAACGGTGAGCTGCCTCTGAAGTG	6448	0	UF_Msa_CF_126091	contig08114___0	contig08114___0	Unknown	
6681	82	39	unmapped	0		0	GCATGCAGACGGACGAACAGAGACTCCTCTCACTCAAAGAACAGTTGCGGAGGAAAAGTG	6450	0	UF_Msa_AF_103871	contig31069___1_nrnt	contig31069___1_nrnt	Unknown	
6682	82	40	unmapped	0		0	AATGGCCACACATGACAAAAACACAATGGAAGCCGTACCAGCTAACTGTCTAGGAGATGT	6452	0	UF_Msa_AF_100443	contig11897___1_nr1nt0	contig11897___1_nr1nt0	Unknown	
6683	82	41	unmapped	0		0	TCAGCCTGAAATAGTCATCCAAGACTGGTATGAGGAGAGTCAGCTGCATAAGTCCATCTA	6454	0	UF_Msa_AF_101853	contig04092___1rc_nrnt	contig04092___1rc_nrnt	Unknown	
6684	82	42	unmapped	0		0	CAGTCTGTTCATATTCCCGCTGTAGTTGTTACGTTGCGTAATTTAATAAAACAAAGGCTC	6456	0	UF_Msa_AF_102612	LMB_S454.sd.322.C1___1_nr0nt1	LMB_S454.sd.322.C1___1_nr0nt1	Unknown	
6685	82	43	unmapped	0		0	ATACGTCTGGGGGTCGTCTGACCCCCCAAAGAACGACAGCAGCCGGTTCTTCTTTAAGTC	6458	0	UF_Msa_CF_125652	contig07033___0rc	contig07033___0rc	Unknown	
6686	82	44	unmapped	0		0	TGTACAGTATTGTCAACCTACGCCTCTCAGAACCCTTGACTATGGTTTGCACTTCTATCC	6460	0	UF_Msa_CF_119574	contig14351___0	contig14351___0	Unknown	
6687	82	45	unmapped	0		0	ACAGTTACAAAACAGACGATCACATGCAACCTTAGAAGAAGGTCCCGCACTCTACTAAAC	6462	0	UF_Msa_CF_121195	contig05612___0rc	contig05612___0rc	Unknown	
6688	82	46	unmapped	0		0	CTTTGGGCTATTACTGGGACATGAGATTAACAAAAACACAAAAGGAGTTATCGGTAAAAA	6464	0	UF_Msa_CF_127334	contig32013___0rc	contig32013___0rc	Unknown	
6689	82	47	unmapped	0		0	AAAGGTGCAACTTTGTACGATAGCTGACTAGTCTGCGTTAGCTAAGATATACAACTTGTT	6466	0	UF_Msa_CF_118676	contig02357___0rc	contig02357___0rc	Unknown	
6690	82	48	unmapped	0		0	TGGAGCGATTTGTCTGGTTAATTCCGATAACGAACGAGACTCCGGCATGCTAACTAGTTA	6468	0	UF_Msa_AF_101531	LMB_S454.sd.302.C1___1rc_nrnt-1	LMB_S454.sd.302.C1___1rc_nrnt-1	Unknown	
6691	82	49	unmapped	0		0	TGATGGGAGGCTCCATGCCTGGCAACTTCACTCCCGGAGAAGCTCCATCTCTTACTAGAG	6470	0	UF_Msa_CF_125612	contig17967___0	contig17967___0	Unknown	
6692	82	50	unmapped	0		0	TCAAAGGTGAAACAAGCCCCTTAGCTATTTTTACTGAAGGACAGAAGTCTACCCACTGCG	6472	0	UF_Msa_AF_106957	contig24921___1_nr0nt1	contig24921___1_nr0nt1	Unknown	
6693	82	51	unmapped	0		0	ACATGACCAACTGTGTTATGTGTAAGGCCACTGAAAATGTTTTGTTTAACCTTACCCACC	6474	0	UF_Msa_AF_108261	contig12588___1rc_nr0nt	contig12588___1rc_nr0nt	Unknown	
6694	82	52	unmapped	0		0	AATGCAGAGACAACATCCTACAGAGCAGCGGGATCAGTTTAGTCACAAACTGTCTGTCAA	6476	0	UF_Msa_AF_103219	contig24438___1rc_nrnt0	contig24438___1rc_nrnt0	Unknown	
6695	82	53	unmapped	0		0	ATACCCGCTGTTTACAGCTAGCCTCCGACTCTACGACGGTCACAACGCCGAACTGCTTTA	6478	0	UF_Msa_CF_119999	contig03393___0	contig03393___0	Unknown	
6696	82	54	unmapped	0		0	AAATTTACAACGAGAAGGTGCTAGATCTTCTATCACCCGGCTCCCAGGATTTGCCTATCA	6480	0	UF_Msa_AF_102224	contig04553___1_nrnt	contig04553___1_nrnt	Unknown	
6697	82	55	unmapped	0		0	AGGATTTGTATACCACACATGCCTGCAACGAATACCTTGAGACCTTCCATCTGCTGGAAA	6482	0	UF_Msa_AD_200192	LMB_Add_3	LMB_Add_3	Unknown	
6698	82	56	unmapped	0		0	TCTGAACGCACAGTGGTTTGGCCCGGCGGTCACTGAGGCGATGTTCCAGATGAGGGAGGT	6484	0	UF_Msa_CF_123335	contig24123___0	contig24123___0	Unknown	
6699	82	57	unmapped	0		0	AAAGAAGTGGATTACACTGGTCTTCGGCTGCAAGCTTTACAAATGAGTGACGAGAAGGAG	6486	0	UF_Msa_AF_109785	contig12538___1_nrnt	contig12538___1_nrnt	Unknown	
6700	82	58	unmapped	0		0	AATCCTTATGCTTACGGCCAGTACAACATGCCCTACATGCCCTACCAGGCGTCTCCAGGA	6488	0	UF_Msa_CF_125865	contig08329___0	contig08329___0	Unknown	
6701	82	59	unmapped	0		0	GGAGAACCACAAGGATCCAGGCGGAGTCCGAGACTGGAGGAGGACAGGGCGCATGTTTAT	6490	0	UF_Msa_CF_126767	contig25813___0rc	contig25813___0rc	Unknown	
6702	82	60	unmapped	0		0	CCAACCAAAAAGTCCATTCAGATGTTGTCTGCAGCAGAAACGTATCTGGAGAGAAAGTTC	6492	0	UF_Msa_CF_123278	contig02989___0rc	contig02989___0rc	Unknown	
6703	82	61	unmapped	0		0	TACACATCTACTGAAGCAGATTTGGTGATTTTGGGTGGTGACCTTAACATGCACCCTCAG	6494	0	UF_Msa_AF_101397	contig13513___1rc_nrnt0	contig13513___1rc_nrnt0	Unknown	
6704	82	62	unmapped	0		0	GATAAGGACAAACCGTTACCTGCAGGTAATTAACCTCAGGAGTGTCTACCTGTTCTTGAG	6496	0	UF_Msa_AF_100073	contig23116___1rc_nrnt	contig23116___1rc_nrnt	Unknown	
6705	82	63	unmapped	0		0	CTCGTAACAATGTTTGCTTTGGCTAGTAAGTTTATCTACAAAGTGACGGTTTGTCTTGGT	6497	0	UF_Msa_CF_124557	contig15837___0	contig15837___0	Unknown	
6706	82	64	unmapped	0		0	GGGGTTTTCAATCATTTAAAGCTGTTCTTTTGTTGTACAAAAAGAGGTGATCAATTGCCA	6499	0	UF_Msa_AF_109999	contig30959___1_nr0nt1	contig30959___1_nr0nt1	Unknown	
6707	82	65	unmapped	0		0	AAGATGTTATCTTTTAAAACCGAGAGACAAACACTGACCGCGGTGTTCTTTGGTGCCGTC	6501	0	UF_Msa_AF_105796	LMB_S454.sd.405.C1___1rc_nr1nt0	LMB_S454.sd.405.C1___1rc_nr1nt0	Unknown	
6708	82	66	unmapped	0		0	AAAGAAGGAAGCCAAATTCTCTCTGGTGGGCATCGCAGGTCAGGACCTGAACGCCGGGAA	6503	0	UF_Msa_AF_101062	contig12372___1rc_nrnt	contig12372___1rc_nrnt	Unknown	
6709	82	67	unmapped	0		0	GGCAGGAATCAGGTTGACACTTTCTTGGAGAAGCACAGGACCCCAGGGATCCAGCACATT	6505	0	UF_Msa_AF_106068	contig21647___1_nrnt0	contig21647___1_nrnt0	Unknown	
6710	82	68	unmapped	0		0	TTTCACAGACACTGGAGATGTACAGGCTTCTGGGTGTGAATAGGGTGGTGATCTATAACA	6507	0	UF_Msa_AF_101082	contig23482___1_nrnt0	contig23482___1_nrnt0	Unknown	
6711	82	69	unmapped	0		0	AAGGACCAGTGTGGCAGCTGAACTTTTTACACAGGGATAAAGATGAAGCCATAGTTCAGC	6509	0	UF_Msa_CF_127365	contig20480___0rc	contig20480___0rc	Unknown	
6712	82	70		0		0		3602	1	ETG10_236652	ETG10_236652	ETG10_236652		CONTROL
6713	82	71	unmapped	0		0	GGAAATGCAGCTGACAACATCCTGGCCTCACGCACCCTCTCTCACACAAGGACTCGGTAA	6512	0	UF_Msa_CF_119117	contig22770___0	contig22770___0	Unknown	
6714	82	72	unmapped	0		0	TTTTGTGGAAAGTGTGGTGAAAAAGGTCGCTCAGTACATGTCTGATGTTCTGGAGGACAG	6514	0	UF_Msa_AF_106807	contig12774___1rc_nrnt	contig12774___1rc_nrnt	Unknown	
6715	82	73	unmapped	0		0	CACGTCCGCCATCTTCTCTGCCTCTGTCTGCTACTGCCTGCGCACAGACATGACGTCTTC	6516	0	UF_Msa_CF_120965	contig25130___0rc	contig25130___0rc	Unknown	
6716	82	74	unmapped	0		0	CTCGGTTAGAATACCATTGTTGTTTATCTAGGGGAAAAAAGCGAGTCTCATTATCTTAAT	6518	0	UF_Msa_CF_124010	contig14490___0	contig14490___0	Unknown	
6717	82	75	unmapped	0		0	GCTGGGAGCGATAGTCAGTACGTGGCCTTTTCATCTTGGACCATACAACAGCAGCTTGCT	6520	0	UF_Msa_CF_118870	contig15207___0	contig15207___0	Unknown	
6718	82	76	unmapped	0		0	TAACCCTCTCCACTCAAGTCTCAGAGCTGTAACATTTACCTCTCCCACAACTCACCGTAC	6522	0	UF_Msa_CF_118510	contig15520___0rc	contig15520___0rc	Unknown	
6719	82	77	unmapped	0		0	CAGAGGATGCTTGCAACTCAAAGATACAAATAGATTGGTTCACATTTACACTGAAAAAAG	6524	0	UF_Msa_AF_107249	contig29397___1_nr0nt	contig29397___1_nr0nt	Unknown	
6720	82	78	unmapped	0		0	AGCAGGTGGATGCTCTAGTGGGTCTTGGAGCTAACAAGCTGTTGGTGCGACTCAAGGCCT	6526	0	UF_Msa_CF_121634	contig15665___0rc	contig15665___0rc	Unknown	
6721	82	79	unmapped	0		0	CCAGAATACCTGCCATTAAATTTGAAGGAGTTTTGTCATTTTAACACAACTCCTCTTACA	6528	0	UF_Msa_AF_106154	contig27251___1_nr0nt1	contig27251___1_nr0nt1	Unknown	
6722	82	80	unmapped	0		0	TGGAGCTGGTTGAACGGTCACATCCACAGCTTTGTGAGCAGAACAGGGATTCAATACACA	6530	0	UF_Msa_CF_119809	contig08805___0	contig08805___0	Unknown	
6723	82	81	unmapped	0		0	ACATTTTAAGGGTAACCGCTATGATCAGGAGAAGCTGCTGAAGCAGAGCCACACTTTGTA	6532	0	UF_Msa_AF_105531	contig05512___1rc_nr1nt0	contig05512___1rc_nr1nt0	Unknown	
6724	82	82	unmapped	0		0	AGGTCAACACTAAGAAGGCTGAGTCAGAGATGGCCTACCAGCTGCAGGTAGCGAAGACGA	6534	0	UF_Msa_AF_104301	contig04808___1rc_nrnt	contig04808___1rc_nrnt	Unknown	
6725	83	1	unmapped	0		0	CTGAGAGCAATGGTATTGCCAGCTTGACAAAGGAGCTGGATGAATTTGAGCTAGCAAAAA	6535	0	UF_Msa_CF_124444	contig19350___0	contig19350___0	Unknown	
6726	83	2	unmapped	0		0	TGCTACCACCTCCTCATCTGCCCCTGCAGGGACAGGCCTAACATTTGGCTCTGTCCTGAC	6537	0	UF_Msa_CF_127559	contig02421___0rc	contig02421___0rc	Unknown	
6727	83	3	unmapped	0		0	TCTACGGCATTGTTCCCTAATTCTTTGGTTCGGTCCCACATTTCTTTCAGGGTACAAGAC	6539	0	UF_Msa_CF_118442	contig25921___0rc	contig25921___0rc	Unknown	
6728	83	4	unmapped	0		0	ACACCAGGCTCAATGTGGTCAGACTTGTGGCCAGTCTGTTGCAGAGCAACACACACAGCA	6541	0	UF_Msa_AF_105758	contig08077___1rc_nrnt0	contig08077___1rc_nrnt0	Unknown	
6729	83	5	unmapped	0		0	TTGTTGTAACTTTGTAATCAGTCTTTTCTGTAAAAATCATATATTTTATAAGGAATATCC	6543	0	UF_Msa_AF_105497	contig09404___1rc_nr0nt	contig09404___1rc_nr0nt	Unknown	
6730	83	6	unmapped	0		0	CAGGAAAGAAACTCTAAAATTAAGACGAGAGGCTCCACCTTGTCTAATGTCATGACCAGT	6545	0	UF_Msa_AD_200047	LMB_Add_145	LMB_Add_145	Unknown	
6731	83	7	unmapped	0		0	GGACTCGCAACAGACAACTAACTCCTGCCTGGACTGACATTGAGGTGAAAAGACAGATGA	6547	0	UF_Msa_CF_118211	contig16648___0	contig16648___0	Unknown	
6732	83	8	unmapped	0		0	AACAAAGAAAGATGGCCGAAGTCATAGAACTGCAGAAACTGAAGCTTGCGTGAACTGAGG	6549	0	UF_Msa_AF_104115	contig10761___1_nrnt	contig10761___1_nrnt	Unknown	
6733	83	9	unmapped	0		0	ATAAGCAGGCAGTTGTCGGAGACATTAACACAGAAAGACCAGGAACGCTGGACTTTAAAG	6551	0	UF_Msa_AF_103767	LMB_S454.933.C1___1_nrnt-1	LMB_S454.933.C1___1_nrnt-1	Unknown	
6734	83	10	unmapped	0		0	GGGACGGGGTTGCACAGAGCGTGATGGGCTCTTTTGAACAGGCGATACAGGATTATTTTG	6553	0	UF_Msa_CF_121610	contig11338___0rc	contig11338___0rc	Unknown	
6735	83	11	unmapped	0		0	CCTTTCTCCTCTCACACCTCCAGGATATATAGACACTCTGTAGAAATACAGTGGGTAAGG	6555	0	UF_Msa_CF_121227	contig00721___0	contig00721___0	Unknown	
6736	83	12	unmapped	0		0	CACCAAACCCAGATATACTATGCAACAAGCACATCAAATTCAACCATTTCCACAAGTATG	6557	0	UF_Msa_AF_105735	contig05127___1_nrnt0	contig05127___1_nrnt0	Unknown	
6737	83	13	unmapped	0		0	GTATCGACAGAACACCTGTTGCCAGTCTGGAGCCGCACGTCTCTACAAGAAGAAAAAGAC	6559	0	UF_Msa_CF_119103	contig27879___0	contig27879___0	Unknown	
6738	83	14	unmapped	0		0	AACCCATTCGCCTAGTCACCTTTGTGGAAACCGCTGTGGGCCTGCTCAATTTTAAGGCAG	6561	0	UF_Msa_AF_109629	contig26624___1rc_nrnt	contig26624___1rc_nrnt	Unknown	
6739	83	15	unmapped	0		0	AGATGCTACTGTATACTGTAGAATGACTGTGGCTGCTGATTCTGGGAAAGAAAATGCCGG	6563	0	UF_Msa_CF_121175	contig25058___0	contig25058___0	Unknown	
6740	83	16	unmapped	0		0	TACGTGTCGTCTGCAGGCTGTTCGGTGTCTTCATGAGCTGTCTCACTCTCCCCACACCAA	6564	0	UF_Msa_CF_118148	contig21231___0rc	contig21231___0rc	Unknown	
6741	83	17	unmapped	0		0	AATTTCCATACTGGCTGCTAAGTTGTCCACAGAGCAGACGGCTCAGCTCGGAGCAGAGCT	6566	0	UF_Msa_AF_110241	contig18068___1rc_nrnt-1	contig18068___1rc_nrnt-1	Unknown	
6742	83	18	unmapped	0		0	GTCCTGTTCAGTTTGAAAGGGCATTTCACATAATCTACATCATTCTCTGTGCCAGTGTAA	6568	0	UF_Msa_CF_127070	contig32544___0rc	contig32544___0rc	Unknown	
6743	83