NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM995321 Query DataSets for GSM995321
Status Public on Oct 01, 2012
Title main_oan_cer
Sample type SRA
 
Source name Cerebellum
Organism Ornithorhynchus anatinus
Characteristics tissue/cell: Cerebellum
age: Adult
gender: Male
Extracted molecule total RNA
Extraction protocol We extracted high-quality RNA from the 38 samples described above using standard protocols. We then prepared small RNA-seq libraries for each of these samples using Illumina Small RNA v1.5 Sample Preparation protocol with the following optimizations. We first purified small RNAs (18-30 nucleotides) from total RNA using denaturing PAGE gel electrophoresis. We used 10% Novex TBE PAGE gel instead of the 6% described in the protocol to ensure a better separation of the cDNA constructs during the purification step.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer IIx
 
Data processing Base calling was performed using the standard Illumina software used on the Illumina Genome Analyzer Iix. Quality score in the raw fastq files are encoded using Phred 64.
Read were trimmed using a standard in-house procedure, removing the following adpater sequence: ATCTCGTATGCCGTCTTCTGCTTG
Reads of length 15-23 nucleotides were then selected to perform miRNA detection (see Methods in the related paper) and then to estimate expression level of detected miRNAs. To compute expression levels, we mapped 15-23 nt reads on the miRNA mature sequences (+/- 3base pair flanks) using bowtie (allowing for multiple mappings but no mismatch: bowtie -v 0 -a. ). We also mapped the reads on their respective genome, masking the miRNA precursor sequences, to identify reads mapping to genomic location other than miRNAs and excluded from the dataset miRNAs for which more than 10% of the mapped reads mapped also to other genomic locations.
For each mature miRNA, reads were then counted. When two (or more) miRNA genes shared more than 10% of their reads, a single joint expression value was computed for them, thus only counting once every single read (i.e., the two miRNAs are considered as one in the relevant analyses). If two (or more) miRNA genes shared less than 10% of their reads, then shared reads were equally distributed across the miRNA genes. Thus, in all cases, multiple mapping reads are never counted more than once for expression values.
Normalization across tissues was performed using edgeR (Robinson et al. 2010), which takes into account variable library sizes and corrects for biases in expression level estimates caused by highly expressed genes in a subset of tissues.
Genome_build: Ensembl Release 57
Supplementary_files_format_and_content: For each species, a processed data file is available containing a normalized expression matrix (mir.id denoted the miRNA gene ID as used in Supplementary Table 1).
 
Submission date Aug 30, 2012
Last update date May 15, 2019
Contact name Henrik Kaessmann
Organization name University of Lausanne
Department Center For Integrative Genomics
Lab Kaessmann
Street address GĂ©nopode
City Lausanne
ZIP/Postal code 1015
Country Switzerland
 
Platform ID GPL13798
Series (1)
GSE40499 Evolution of mammalian miRNA genes
Relations
SRA SRX182799
BioSample SAMN01161976

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap