NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM886490 Query DataSets for GSM886490
Status Public on Dec 06, 2013
Title 3-APC small RNA
Sample type SRA
 
Source name APC_small RNAseq
Organism Mus musculus
Characteristics strain: 129-M2rtTA
cell type: mouse adipose progenitor cells (APC)
passage: 1
Growth protocol ES cells and iPS cells were maintained in ES cell media containing 15% FBS and 1,000 Uml-1 of LIF.MEF and APCs were cultured in DMEM supplemented with 10% FBS and penicillin/streptomycin. HPCs was freshly isolated from bone marrow
Extracted molecule total RNA
Extraction protocol S-RNAs about 18-30 nt were first separated from the 5μg-10μg total RNA by size fractionation with 15% TBE urea polyacrylamide gel(TBU).Next,the 5’ RNA adapter(GUUCAGAGUUCUACAGUCCGACGAUC-3’) was ligated to the RNA pool with T4 RNA ligase.Ligated RNA was size-fractionated on a 15% agarose gel,and a 40-65 nt fraction excised.The 3’RNA adapter(5’-pUCGUAUGCCGUCUUCUGCUUGidT-3’;p,phosphate;idT,inverted deoxythymidine) was subsequently ligated to precipitated RNA using T4 RNA ligase.Ligate RNA was size-fractionated on a 10% agarose gel,and the 70-90 nt fraction excised.Through the RT- PCR amplification of 15 cycles and purified,small RNA libraries were produced.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 2000
 
Description Sample 13
Data processing The raw files were split according to barcode sequence by Perl scripts. Adapter sequences were removed using “vectorstrip” in EMBOSS package (version 6.4.0.0). Then, the unique reads were classified and counted.
Genome Build:
sRNA_BSC_uniq_counts.txt: mm9
 
Submission date Mar 06, 2012
Last update date May 15, 2019
Contact name Tao Cai
E-mail(s) caitao@nibs.ac.cn
Organization name National Institute Of Biological Sciences, Beijing (NIBS)
Lab Sequencing Facility
Street address No. 7 Science Park Road, Zhongguancun Life Science Park
City Beijing
ZIP/Postal code 102206
Country China
 
Platform ID GPL13112
Series (2)
GSE36291 High-throughput sequencing of sequentially reprogrammed iPS cells reveals key epigenetic modifications correlated with reduced pluripotency of iPS cells [sRNA-seq]
GSE36294 High-throughput sequencing of sequentially reprogrammed iPS cells reveals key epigenetic modifications correlated with reduced pluripotency of iPS cells
Relations
SRA SRX127356
BioSample SAMN00808794

Supplementary file Size Download File type/resource
GSM886490_sRNA_BSC_uniq_counts.txt.gz 1.5 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap