|
Status |
Public on Dec 06, 2013 |
Title |
3-APC-iPSC-9 small RNA |
Sample type |
SRA |
|
|
Source name |
APC-iPSC_small RNAseq
|
Organism |
Mus musculus |
Characteristics |
strain: 129-M2rtTA cell type: APC-derived induced pluripotent stem cells passage: 10-12
|
Growth protocol |
ES cells and iPS cells were maintained in ES cell media containing 15% FBS and 1,000 Uml-1 of LIF.MEF and APCs were cultured in DMEM supplemented with 10% FBS and penicillin/streptomycin. HPCs was freshly isolated from bone marrow
|
Extracted molecule |
total RNA |
Extraction protocol |
S-RNAs about 18-30 nt were first separated from the 5μg-10μg total RNA by size fractionation with 15% TBE urea polyacrylamide gel(TBU).Next,the 5’ RNA adapter(GUUCAGAGUUCUACAGUCCGACGAUC-3’) was ligated to the RNA pool with T4 RNA ligase.Ligated RNA was size-fractionated on a 15% agarose gel,and a 40-65 nt fraction excised.The 3’RNA adapter(5’-pUCGUAUGCCGUCUUCUGCUUGidT-3’;p,phosphate;idT,inverted deoxythymidine) was subsequently ligated to precipitated RNA using T4 RNA ligase.Ligate RNA was size-fractionated on a 10% agarose gel,and the 70-90 nt fraction excised.Through the RT- PCR amplification of 15 cycles and purified,small RNA libraries were produced.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
Sample 9
|
Data processing |
The raw files were split according to barcode sequence by Perl scripts. Adapter sequences were removed using “vectorstrip” in EMBOSS package (version 6.4.0.0). Then, the unique reads were classified and counted. Genome Build: sRNA_9_uniq_counts.txt: mm9
|
|
|
Submission date |
Mar 06, 2012 |
Last update date |
May 15, 2019 |
Contact name |
Tao Cai |
E-mail(s) |
caitao@nibs.ac.cn
|
Organization name |
National Institute Of Biological Sciences, Beijing (NIBS)
|
Lab |
Sequencing Facility
|
Street address |
No. 7 Science Park Road, Zhongguancun Life Science Park
|
City |
Beijing |
ZIP/Postal code |
102206 |
Country |
China |
|
|
Platform ID |
GPL13112 |
Series (2) |
GSE36291 |
High-throughput sequencing of sequentially reprogrammed iPS cells reveals key epigenetic modifications correlated with reduced pluripotency of iPS cells [sRNA-seq] |
GSE36294 |
High-throughput sequencing of sequentially reprogrammed iPS cells reveals key epigenetic modifications correlated with reduced pluripotency of iPS cells |
|
Relations |
SRA |
SRX127352 |
BioSample |
SAMN00808790 |