NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM879233 Query DataSets for GSM879233
Status Public on Aug 21, 2012
Title Susceptible R3
Sample type SRA
 
Source name Ventral Tegmental Area
Organism Mus musculus
Characteristics tissue: Ventral Tegmental Area
stress: Susceptible physical stress
exposure time: 10 days
strain: C57BL/6J
gender: male
Treatment protocol C57BL/6J male mice were exposed to either emotional stress, physical stress, or control for 10 days. 24 hr later, VTA punches were taken.
Extracted molecule total RNA
Extraction protocol Total RNA is isolated by using Trizol reagent (Invitrogen, California) following the product instructions. Four micrograms of total RNA is then used for mRNA library construction with the Illumina mRNA sample prep kit (cat#RS-100-0801). In brief, the poly-A containing mRNA is purified using poly-T oligo-attached magnetic beads. The mRNA is then fragmented into small pieces and converted into cDNA. These cDNA fragments then go through an end repair process, the addition of a single ‘A’ base, and then ligation of the adapters. These products are then gel purified and enriched with PCR to create the final cDNA libraries.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 2000
 
Data processing Adapter sequences (AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG) were removed from RNA-seq data using Fastx tool. They were then processed using the Cufflinks (v1.0.3) pipeline to determine gene expression levels and detect differential genes.
The three *.diff files are differential gene lists from comparison between the three treatment conditions and control.
emo=Emotional
res=Resilient
sus=Susceptible
Genome Build:
S3.fpkm_tracking: mm9
 
Submission date Feb 22, 2012
Last update date May 15, 2019
Contact name Li Shen
E-mail(s) li.shen@mssm.edu
Organization name Icahn School of Medicine at Mount Sinai
Department Neuroscience
Lab Shen
Street address 1425 Madison Ave
City New York
State/province NY
ZIP/Postal code 10029
Country USA
 
Platform ID GPL13112
Series (1)
GSE36005 High throughput sequencing of the mouse transcriptome within the VTA following exposure to emotional stress.
Relations
SRA SRX121687
BioSample SAMN00791660

Supplementary file Size Download File type/resource
GSM879233_S3.fpkm_tracking.gz 1.1 Mb (ftp)(http) FPKM_TRACKING
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap