 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 05, 2024 |
| Title |
Kidney, control 6 yo, tubules, ROI 5 |
| Sample type |
SRA |
| |
|
| Source name |
Kidney
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: Kidney
genotype: male
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Serially prepared sections (previously hybridized with Whole Transcriptome Assay (WTA) probes) were also immunostained with CD3, Ki-67, alpha-Smooth Muscle Actin and SYTO83 to help with region of interest (ROI) selection. Briefly, Morphology Marker Solution was prepared in the following proportions per slide: 22ul SYTO (Thermo Fisher Scientific, Cat#S11364), 5.5 ul a-Smooth Muscle Actin (NanoString Technologies), 5.5 ul CD3 (NanoString Technologies), 5.5 ul Ki-67 (NanoString Technologies), and 181.5 ul Buffer W for a total volume of 220 ul/slide. Slides were incubated in this solution at room temperature for 1 hour followed by successive 2x SSC washes, after which, the slides were loaded into the NanoString GeoMx Digital Spatial Profiler (DSP) where overview scans were captured at 20x to guide the selection of ROIs. Slides were prepared for hybridization following a modified RNA FFPE BOND RX Slide Preparation Protocol in the GeoMx NGS Slide Preparation User Manual (NanoString Technologies, MAN-10115). Briefly, deparaffinization, antigen retrieval, and Proteinase K digestion was performed on a Leica BOND-RX instrument with Bond Dewax Solution, Bond Epitope Retrieval Solution 2, and a 37°C Proteinase K digest at 1mg/ml. Human Whole Transcriptome Assay (WTA) probes (NanoString Technologies, Cat#121401102) hybridized at 4nM each in Buffer R, and incubated in a hybridization chamber for 16 hrs at 37°C. Two washes in 50% Formamide/2x SSC (ThermoFisher, Cat#AM9342 / Sigma-Aldrich, Cat#S6639) at 37°C washed non-specifically-bound probes from the slides, which were then blocked prior to antibody staining with 200 ul Buffer W (Nanostring). Regions of interest within the tissue were illuminated with UV light and oligo barcodes were physically aspirated from the tissue and collected into microtiter plates by the GeoMx® Digital Spatial Profiler (DSP) platform. For more information about DSP protocols please see Merritt et al. Nature Biotech 2020 (doi: 10.1038/s41598-020-63539-x)
Each collection of oligo tags from one well (representing an ROI from the tissue section) was indexed with i7xi5 unique dual indexes using GeoMx SeqCode primers with 18 cycles of PCR. After PCR, indexed AOIs were pooled and purified in two rounds of AMPure XP PCR purification using 1.2x bead:sample ratio.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
ROI, column N1_18 in GeoMX_TrACR_Q3Matrix
|
| Data processing |
Data processing was performed in R v4.2.1. The RNA count of the negative probes was used to evaluate the limit of quantification (LOQ); in brief the median and standard deviation of the negative probe counts were calculated and we defined the LOQ to be three standard deviations above the median of the negative probe counts. RNA counts below this threshold were converted in missing values. Then the count data was Q3 normalized using .
save-interim-files=false, quality-trim-score=20,2color-trimming=True, adapter1=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, adapter2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT, adapter-trim-match-length=10, adapter-trim-max-mismatch=3,barcode-max-mismatch=1,stitching-max-mismatch=2,dedup-hd=1,threads=4
Assembly: N/A, sequencing of synthetic tags and alignment to whitelist of RTS_IDs (probe barcodes) found in the config.ini output from the GeoMx DSP platform, see attached PKC file (Hs_TAP_H_WTA_V1.0.pkc)
Supplementary files format and content: Supplementary files format and content: Digital Count Conversion (DCC) file format outputted from GeoMx NGS Pipeline, contains software versions, scan attributes, GeoMx NGS pipeline parameters and output metrics, Q30 scores, and list of deduplicated counts per RTS_ID (probe barcode)
Supplementary files format and content: Supplementary files format and content: Q3 normalized counts
Library strategy: Spatial Transcriptomics
|
| |
|
| Submission date |
Nov 05, 2024 |
| Last update date |
Nov 05, 2024 |
| Contact name |
Miguel Fribourg |
| E-mail(s) |
Miguel.Fribourg@mssm.edu
|
| Phone |
212-241-4534
|
| Organization name |
Icahn School of Medicine at Mount Sinai
|
| Department |
Medicine
|
| Street address |
1 Gustave Levy Pl
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10029 |
| Country |
USA |
| |
|
| Platform ID |
GPL24676 |
| Series (1) |
| GSE281078 |
The spatially resolved transcriptional profile of acute T cell-mediated rejection in a kidney allograft |
|
| Relations |
| BioSample |
SAMN44581777 |
| SRA |
SRX26609619 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8610617_GeoMX_TrACR_N1_8.dcc.gz |
48.7 Kb |
(ftp)(http) |
DCC |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
