|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Aug 28, 2024 |
Title |
RNA_FL_timecourse_E10.5+DMSO+1h_rep3 |
Sample type |
SRA |
|
|
Source name |
Forelimb bud
|
Organism |
Mus musculus |
Characteristics |
tissue: Forelimb bud genotype: WT Swiss Albino treatment: DMSO timepoint of_treatment: E10.5 timepoint of_dissection: E10.5 + 1hour
|
Extracted molecule |
polyA RNA |
Extraction protocol |
Limb buds were dissected in ice-cold PBS, washed in PBS, transferred to RNAlater (Invitrogen), and stored overnight at -20°C. The next day, samples were transferred to -80°C for long-term storage. RNA isolation was performed with the RNeasy Kit (Qiagen) following manufacture instructions. After performing QC on a Fragment Analyzer (Advanced Analytical Technologies, Inc.), RNA was stored at -80 until shipping to Novogene. Library constructions and sequencing were performed at Novogene. Standard Illumina mRNA-libraries (by polyA-enrichment) were made and after successful QC sequenced. Libraries were sequenced as PE150 on a NovaSeq6000 (by Novogene)
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NovaSeq 6000 |
|
|
Data processing |
Low quality bases and Truseq adapters were removed with cutadapt v1.16 (-a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -q 30 -m 15) Reads were mapped on mm10 with STAR version 2.7.0e using ENCODE parameters using custom gtf https://doi.org/10.5281/zenodo.7510406, counts and coverage were computed at the same time. FPKM values were computed with cufflinks version 2.2.1 (--max-bundle-length 10000000 --multi-read-correct --library-type "fr-unstranded" -b /home/ldelisle/genomes/fasta/mm10.fa --no-effective-length-correction -M MTmouse.gtf -G custom.gtf) Average coverage between replicates was computed with bigwigAverage from deepTools version 3.5.5 Assembly: mm10 Supplementary files format and content: bw: normalized coverage on uniquely mapped reads Supplementary files format and content: AllCufflinks_Simplified_timecourse.txt.gz: table with all FPKM values (one row per ensembl id, one column per sample) Supplementary files format and content: AllHTSeqCounts_subset_timecourse.txt.gz: table with all count values obtained with STAR (one row per ensembl id, one column per sample, genes on chrX, Y, M were removed)
|
|
|
Submission date |
Aug 27, 2024 |
Last update date |
Aug 30, 2024 |
Contact name |
Lucille Lopez-Delisle |
E-mail(s) |
lucille.delisle@epfl.ch
|
Organization name |
EPFL
|
Street address |
Station 19
|
City |
Lausanne |
ZIP/Postal code |
1015 |
Country |
Switzerland |
|
|
Platform ID |
GPL24247 |
Series (2) |
GSE275783 |
Synchronization of growth and self-organizing digit pattern by WNT signaling [RNAseq] |
GSE275784 |
Synchronization of growth and self-organizing digit pattern by WNT signaling |
|
Relations |
BioSample |
SAMN43383088 |
SRA |
SRX25842458 |
Supplementary file |
Size |
Download |
File type/resource |
GSM8484502_RNA_FL_timecourse_E10.5+DMSO+1h_rep3_Uniq_norm.bw |
136.7 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
Raw data are available in SRA |
|
|
|
|
|