 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 28, 2024 |
| Title |
input-H3K27Ac_FL_E10.5+C59+6h |
| Sample type |
SRA |
| |
|
| Source name |
Forelimb bud
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Forelimb bud
chip antibody: none
genotype: WT Swiss Albino
treatment: C59
timepoint of_treatment: E10.5
timepoint of_dissection: E10.5 + 6hours
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Dissected forelimb bud tissue was crosslinked in 1% formaldehyde/PBS at room temperature which was then quenched with glycine (125 mM). For β-Catenin ChIP a second crosslink step was performed using DSG (disuccinimidyl glutarate) for 40 min at RT. After lysing in hypertonic buffer chromatin fragments were generated by sonication. Immunoprecipitation was performed overnight at 4°C using the polyclonal anti beta Catenin antibody (71-2700 Invitrogen, 5 μg per sample) and anti-histone H3(acetyl K27) antibody (ChIP Grade ab4729 Abcam, 5 μg per sample). The immune-complexed chromatin complexes were extracted with magnetic beads (Fisher Scientific 11202D). After washing beads in RIPA buffer, DNA was eluted from beads followed by reverse cross-linking overnight.
Libraries were generated using the next-generation library preparation kit from Takara Bio (Japan) according to manufacturer instructions
ChIP-Seq libraries were sequenced using a NextSeq instrument (Illumina).
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Low quality bases and Truseq adapters were removed with cutadapt v4.1 (-a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -q 30 -m 15)
Filtered reads were mapped with bowtie2 version 2.4.5 with default parameters
Alignments with MAPQ below 30 were filtered out with samtools
Peaks were called and coverage was performed with macs2 version 2.2.7.1 (-g 1870000000 --call-summits --format BAMPE -B, input was not used)
Coverage was normalized the million fragments after filtering
Average coverage between replicates was computed with bigwigAverage from deepTools version 3.5.5
Consensus peaks were obtained with the following steps:
1. Peaks were called using all replicates with equal contribution.
In details, duplicates were removed from BAM files of each replicate with picard version 2.27.4.
Each BAM was subsampled to get the number of reads of the smallest BAM.
Peaks were called using all subsampled BAM with the same arguments as for individual replicates
2. Only peaks with summits overlapping both replicates were kept.
In details, individual narrowPeaks were overlaped with bedtools multiinter version 2.30.0, only intervals present in both replicates were kept.
The narrowPeak file of step1 was intersected with the output of multiinter and was filtered in order to keep only narrowPeaks with summits overlapping the output of multiinter.
Assembly: mm10
Supplementary files format and content: bw: normalized coverage
Supplementary files format and content: repX.narrowPeak: narrowPeak from macs2
Supplementary files format and content: consensus.narrowPeak: narrowPeak with summit overlapping both replicates
|
| |
|
| Submission date |
Aug 27, 2024 |
| Last update date |
Aug 28, 2024 |
| Contact name |
Lucille Lopez-Delisle |
| E-mail(s) |
lucille.delisle@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE275782 |
Synchronization of growth and self-organizing digit pattern by WNT signaling [ChIPseq] |
| GSE275784 |
Synchronization of growth and self-organizing digit pattern by WNT signaling |
|
| Relations |
| BioSample |
SAMN43382890 |
| SRA |
SRX25842410 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8484496_input-H3K27Ac_FL_E10.5+C59+6h.bw |
328.5 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
