 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 18, 2024 |
| Title |
CTCF ChIPmentation of HoxB Del/Del(i9-13):Ins(CBS5-10) gastruloids at 96h |
| Sample type |
SRA |
| |
|
| Source name |
gastruloids
|
| Organism |
Mus musculus |
| Characteristics |
tissue: gastruloids
antibody: CTCF (61311, Active Motif)
genotype: HoxB Del/Del(i9-13):Ins(CBS5-10)
stage (in_hours_after_aggregation): 96
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Collected gastruloids were pooled in a 15 ml falcon tube, washed with PBS and resuspended in 1 ml PBS containing 1% formaldehyde for fixation during 10 min at room temperature. The crosslink reaction was stopped by adding a glycine solution to a final concentration of 0.125 M. Fixed gastruloids were pelleted and stored at -80°C until further use.
ChIPmentation experiments were performed according to the protocol described in (Rodriguez-Carballo et al., 2017) and (Darbellay et al., 2019), and adapted for gastruloids. Samples were resuspended in a sonication buffer (Tris HCl pH=8.0 50 mM; EDTA 10 mM; SDS 0.25% and protease inhibitors) and sonicated in a Covaris E220 device for 14 min (duty cycle 2%, peak incident power 105 W) to obtain an average chromatin fragment size of 300-500 bp. A dilution buffer (HEPES pH=7.3 20 mM; EDTA 1 mM; NP40 0.1%; NaCl 150 mM and protease inhibitors) was added to the sonicated chromatin and incubated with the antibody-bead complex (Pierce Protein A/G Magnetic Beads, Thermo Scientific) overnight at 4°C. Sequential washes were then performed twice with RIPA buffer (Tris HCl pH=8.0 10 mM; EDTA 1 mM; Sodium Deoxycholate 0.1% TritonX-100 1%; NaCl 140 mM and protease inhibitors), RIPA High salt buffer (Tris HCl pH=8.0 10 mM; EDTA 1 mM; Sodium Deoxycholate 0.1% TritonX-100 1%; NaCl 500 mM and protease inhibitors), LiCl buffer (Tris HCl pH=8.0 10 mM; EDTA 1 mM; LiCl 250 mM; Sodium Deoxycholate 0.5%; NP40 0.5% and protease inhibitors) and Tris HCl buffer (pH=8.0 10mM and protease inhibitors). DNA fragments bound to the antibody-bead complex (CTCF (61311, Active Motif), RAD21 (ab992, Abcam) were tegmented using the Nextera Tegmentation kit. Beads were resuspended in the tegmentation buffer and incubated at 37° for 2 min with 1 µl of the Tn5 transposase. Fragment were then eluted and purified as described previously, and amplified using Nextera primers. Final DNA libraries were purified and size selected using AMPure XP magnetic beads (Beckman Coulter), and a fragment analysis was performed before sequencing.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Adapter and bad quality bases were removed from fastq files using cutadapt version 4.1 (Martin, 2011) (-a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -A CTGTCTCTTATACACATCTGACGCTGCCGACGA -q 30 -m 15).
Filtered reads were aligned on the in silico mutant genome using bowite2 version 2.4.5 with default parameters (Martin, 2011).
No filtering for mutlimap reads was performed as sequences are duplicated between both alleles of chromosome 11.
Coverage was computed with macs2 version 2.2.7.1 (Zhang et al, 2008) (--call-summits --format BAMPE -B) removing PCR duplicates and then normalized to the million fragments after filtering used by macs2.
Assembly: mm10_HoxB_deli9-13insCBS5-10_del
Supplementary files format and content: *bw = coverage normalized to million mapped fragments
Supplementary files format and content: *narrowPeak.gz = peak obtained by macs2
Library strategy: ChIPmentation
|
| |
|
| Submission date |
Jul 16, 2024 |
| Last update date |
Jul 18, 2024 |
| Contact name |
Lucille Lopez-Delisle |
| E-mail(s) |
lucille.delisle@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE272382 |
CTCF-dependent insulation of Hoxb13 and the heterochronic control of tail length [ChIPM] |
| GSE272483 |
CTCF-dependent insulation of Hoxb13 and the heterochronic control of tail length |
|
| Relations |
| BioSample |
SAMN42535816 |
| SRA |
SRX25346480 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8399751_ChIPM_CTCF_delBins5-10_96h_onmm10_HoxB_deli9-13insCBS5-10_del.bw |
314.5 Mb |
(ftp)(http) |
BW |
| GSM8399751_ChIPM_CTCF_delBins5-10_96h_onmm10_HoxB_deli9-13insCBS5-10_del.narrowPeak.gz |
1.0 Mb |
(ftp)(http) |
NARROWPEAK |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
