 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 17, 2024 |
| Title |
MLV_K562_GFP |
| Sample type |
SRA |
| |
|
| Source name |
K562
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: K562
time: 14 dpi
treatment: vector transduction
|
| Treatment protocol |
The K562 cells were counted and seeded with fresh cultivation medium on a cultivation plate/dish on the day of transduction. Virus-containing medium was added to the cultivation medium and cells were incubated for 24 hours. The next day, the medium was removed and fresh cultivation medium was added to the cells.
|
| Growth protocol |
The cell line K562 was cultivated in RPMI 1640 medium (Sigma) supplemented with 5% fetal calf serum and 5% newborn calf serum (both GIBCO) and antibiotics (#A5955, Antibiotic Antimycotic Solution (100×), Stabilized; Sigma-Aldrich) at 37 °C and in a 5% CO2 atmosphere.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Genomic DNA was extracted by a phenol-chloroform extraction.
Genomic DNA was fragmented by DNA fragmentase (NEB) to obtain fragments 100-2000 bp long with the main density between 500-1000 bp on an agarose gel. By purification fragments on SPRI Magnetic beads (Canvax), we selected fragments 300-2000 bp long. Then, we repaired the ends and added 3’polyA overhangs with T4 polymerase, T4 polynucleotide kinase, and Taq DNA polymerase (all NEB). After purification with the High Pure PCR Cleanup Micro Kit (Roche), through T-A ligation, we ligated adaptors with Quick Ligase (NEB). Apart from the standard adaptor oligos Ion-Link-A and Ion-Link-Ba, we added blocking oligo Ion-Link-Bb to prevent adaptor-adaptor amplification. After another purification on columns, DNA was amplified with adaptor-specific and provirus-specific primers. In the PCR reaction mix, we added blocking oligos to prevent the amplification of inner proviral sequences. First, we ran a linear PCR reaction with biotinylated primer MLV-LTR1_F_Bio. After purification of the PCR reaction on the Dynabeads™ MyOne™ Streptavidin C1 beads (Invitrogen), we ran a PCR reaction with the Ion_trP1 primer and the barcoded IonA_MIDx_mlvLTR2 primers. We isolated 300-500-bp-long PCR products from an agarose gel. After purification on columns, the samples were quantified with the KAPA Library Quantification Kit for IonTorrent Platforms (Roche). The quantified samples were pooled in equimolar ratio and mixed with Ion Sphere Particles (Thermo Fisher Scientific).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Ion Torrent PGM |
| |
|
| Description |
pooled, barcode-discriminated libraries
|
| Data processing |
Cutadapt was used for the pre-mapping processing of raw reads. Reads were sorted according to the barcodes using the ‘cutadapt -g ^B --overlap 8 --discard-untrimmed’ command, where ‘B’ stands for the barcode sequence (wt: TAGTATCAGC, GCATATGCAC; W390A: CTCGCGTGTC, CAGCTCATCA; CBX: CGTGTCTCTA, TCTCTATGCG). Reads containing LTR sequence were sequentially selected first using ‘cutadapt -g ^GCTTGCCAAACCTACAGGTG --overlap 20 --discard-untrimmed’ command to select reads containing a sequence targeted by LTR-specific primer. Next, reads containing the last 9 nucleotides of the LTR sequence with residual sequence of the minimal length of 15 bp were selected using ‘cutadapt -g ^GGTCTTTCA --overlap 8 --discard-untrimmed --minimum-length 15’ command. Adapter sequences were then removed from the reads with ‘cutadapt -a ACCACTAGTGTCGAC --overlap 10 --minimum-length 15’ command and the reads containing amplified inner proviral sequence were removed using the ‘cutadapt -g TTCCCCCCTT --overlap 10 --discard-trimmed' command.
Trimmed reads were mapped to both hg19 and hg38 human genome assemblies using the Bowtie 2 with ‘bowtie2 -p 20 -q -x hgX ‘command where the ‘hgX' marks the name of the assembly.
Reads that map from the start of the read (“MD:Z:0” reads) that show single hit in the genome (“XS:i:” reads) were selected and converted to BED file using ‘samtools view -S -b’ and ‘bedtools bamtobed -cigar -i 'commands. Each proviral integration site is recorded as a coordinate of single genomic LTR-proximal position. Integration site coordinates supported by at least 5 reads were selected. If more inegrations site coordinates were present within the distance of 5 bp, only the coordinate supported by the most reads is present in the bed file.
Assembly: hg19, hg38
Supplementary files format and content: BED file with integration site coordinates mapped to hg19 genome assembly
Supplementary files format and content: BED file with integration site coordinates mapped to hg38 genome assembly
Library strategy: ligation mediated PCR
|
| |
|
| Submission date |
Jun 04, 2024 |
| Last update date |
Jun 17, 2024 |
| Contact name |
Dalibor Miklik |
| Organization name |
Institute of Molecular Genetics of the Czech Academy of Sciences
|
| Lab |
Laboratory of Viral and Cellular Genetics
|
| Street address |
Videnska 1083
|
| City |
Prague |
| ZIP/Postal code |
14220 |
| Country |
Czech Republic |
| |
|
| Platform ID |
GPL17301 |
| Series (1) |
| GSE269015 |
Long Terminal Repeats of Gammaretroviruses Retain Stable Expression After Integration Retargeting or Knock-In into the Restrictive Chromatin of Lamina-Associated Domains |
|
| Relations |
| BioSample |
SAMN41670905 |
| SRA |
SRX24792858 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8305113_IS_hg19_GFP.bed.gz |
32.0 Kb |
(ftp)(http) |
BED |
| GSM8305113_IS_hg38_GFP.bed.gz |
38.7 Kb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
