GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM8292166

Query DataSets for GSM8292166

Status

Public on Nov 04, 2024

Title

Iso-seq EGFP KD rep2

Sample type

SRA

Source name

None

Organism

Drosophila melanogaster

Characteristics

tissue: None
cell line: Ovarian Somatic Cells (OSC)
cell type: EGFP-KD OSC
genotype: None
treatment: RNAi EGFP

Treatment protocol

Transfection of siRNAs was performed using Cell Line 96-well Nucleofector Kit SF and 96-well Shuttle Device (Lonza).

Growth protocol

Cells were grown at 26 degrees on OSC medium (Fly Extract added M3 medium).

Extracted molecule

total RNA

Extraction protocol

CLASH : 1e+8 OSCs were washed once with ice-cold PBS and then irradiated with 200 mJ/cm2 at 254 nm. Cells were pelleted and lysed in lysis buffer (20 mM HEPES-KOH pH 7.3, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.5% NP-40, 2 μg/ml Pepstatin, 2 μg/ml Leupeptin, 0.5% Aprotinin). Lysates were centrifuged at 20,000 g for 10 min at 4˚C, and the supernatants treated with 1 U/μl RNase T1 (Roche) for 15 min at room temperature on a rotator. RNA-protein complexes were immunoprecipitated using 10 μg of anti-Piwi antibody (Saito et al., 2006) and 100 μl Dynabeads protein G (Invitrogen) for 2 h at 4˚C. Beads were washed three times with wash buffer (20 mM HEPES-KOH pH 7.3, 300 mM NaCl, 1 mM DTT, 0.05% NP-40, 2 μg/ml Pepstatin, 2 μg/ml Leupeptin, 0.5% Aprotinin), and three times with high-salt wash buffer (20 mM HEPES-KOH pH 7.3, 500 mM NaCl, 1 mM DTT, 0.05% NP-40, 2 μg/ml Pepstatin, 2 μg/ml Leupeptin, 0.5% Aprotinin). The beads were resuspended in 100 μl PNK buffer (1 × PNK buffer, 6,000 Ci/mmol 32P-γ-ATP (Perkin Elmer), 10 units T4 Polynucleotide kinase (NEB), 40 units RNasin (Promega)) and incubated for 30 min at 37˚C. Piwi-piRNA complexes were washed 5 times with PNK wash buffer (50 mM Tris-HCl pH 7.5, 50 mM NaCl, 10 mM MgCl2). Piwi-bound, interacting RNA molecules were ligated overnight using 25 units of T4 RNA ligase 1 (NEB) in T4 RNA ligase buffer (1 × T4 RNA ligase buffer, 1 mM ATP, 15% PEG8000, 40 units RNasin (Promega)) at 16˚C. The ligation mixture was washed 5 times with PNK wash buffer. Piwi-piRNA/RNA complexes were eluted in 1 × LDS sample buffer (Life Technologies) for 10 min at 70°C and then resolved on a 4%–12% Bis-Tris NuPAGE gel (Life Technologies) in NuPAGE SDS MOPS running buffer (Life Technologies). The Piwi-piRNA/RNA complexes were transferred to a nitrocellulose blotting membrane (GE Healthcare) in a wet-transfer tank with NuPAGE transfer buffer (Life Technologies) containing 10% methanol for 100 min at 30 V. After excising the region of nitrocellulose containing Piwi-piRNA/RNA complexes, RNAs were released from the membrane using 10 μl of Proteinase K (Roche) in proteinase K buffer (50 mM Tris-HCl pH 7.5, 75 mM NaCl, 6.25 mM EDTA, 10% SDS) for 30 min at 55˚C. The RNA was extracted with phenol/chloroform/isoamyl alcohol, and then precipitated with ethanol and PelletPaint NF (Millipore). RNA pellets were washed with 70% ethanol and dissolved in Nuclease-Free Water.
CAGE & Iso-seq : Total RNA was extracted using Isogen II (Nippon Gene).
Pacbio-DNAseq : High molecular weight DNA was extracted using Blood & Cell Culture DNA kit (Qiagen).
piRNA-seq : 1e+8 OSCs were lysed in Lysis Buffer (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% NP-40, 1 mM EDTA, 1 mM DTT, 2 μg/ml Pepstatin, 2 μg/ml Leupeptin, 0.5% Aprotinin, 40 U/ml RNasin (Promega)) and spun at 135,000 rpm for 15 min at 4°C. The supernatant was collected and cooled on ice. 10 μg of Anti-Piwi antibody (Saito et al., 2006) was immobilised on 50 μl of Dynabeads protein G (Invitrogen) and incubated with lysates for 2 h at 4°C. The supernatant was discarded and the beads washed three times with IP wash buffer (20 mM Tris-HCl pH 7.5, 300 mM NaCl, 0.05% NP-40, 1 mM DTT, 2 μg/ml Pepstatin, 2 μg/ml Leupeptin, 0.5% Aprotinin) and three times with High salt buffer (20 mM Tris-HCl pH 7.5, 500 mM NaCl, 0.05% NP-40, 1 mM DTT, 2 μg/ml Pepstatin, 2 μg/ml Leupeptin, 0.5% Aprotinin). After washing, RNAs were extracted from the beads with acid phenol-chloroform and precipitated with ethanol. Purified RNAs were denatured in Gel Loading Buffer II (Invitrogen, AM8546G) for 5 min at 95°C, resolved on a denaturing 15% TBE polyacrylamide gel and sizes between 22-30 nt were excised.
ChIP-seq : ChIP was performed as described in the ultra-low-input native ChIP (ULI-NChIP) protocol (Brind’Amour et al., 2015) with minor modifications. Briefly, 5e+5 OSCs were lysed in 20 μl of Nuclei EZ lysis buffer (Sigma Aldrich, N3408). The chromatin was digested with 10 U/μl of MNase (NEB) at 37°C for 10 min and the reaction quenched with 100 mM EDTA. The digested chromatin was then diluted in IP buffer (20 mM Tris-HCl pH 7.5, 1% Triton X-100, 2 mM EDTA and 150 mM NaCl, 1 x cOmplete Protease Inhibitor Cocktail (Roche)). An aliquot of chromatin (10 μl) was used as the input control. Chromatin was pre-cleared with 20 μl of 1:1 Dynabeads protein A (invitrogen) : Dynabeads protein G (invitrogen) and immunoprecipitated with antibody–bead complexes (1 μl of H3K9me3 antibody (abcam, ab8898) or 1 μl of H3K4me3 antibody (abcam, ab8580) in 10 μl of 1:1 protein A:protein G Dynabeads) overnight at 4°C. Immunopurified protein-DNA complexes were washed twice with 1 ml of Low salt buffer (20 mM Tris-HCl pH 7.5, 0.1% SDS, 1% Triton X-100, 2 mM EDTA and 150 mM NaCl) and once with 1 ml of High salt buffer (20 mM Tris-HCl pH 7.5, 0.1% SDS, 1% Triton X-100, 2 mM EDTA and 500 mM NaCl). After washing, protein-DNA complexes were eluted in 30 μl of elution buffer (50 mM Tris-HCl pH 7.5, 10 mM EDTA, 1% SDS). One hundred ng of RNAse A was added to the eluate and the mixture incubated for 30 min at 37°C, followed by 90 min at 65°C. Lastly, the DNA was purified using the QIAquick PCR purification Kit (Qiagen).
CLASH : The RNA was incubated with 10 units of T4 PNK (NEB) in 3′ end RNA dephosphorylation buffer (50 mM imidazole-HCl pH 6.0, 10 mM MgCl2, 5 mM DTT, 40 units RNasin (Promega)) for 30 min at 37˚C. Following dephosphorylation, the RNA was purified using SPRI select beads according to the manufacturer’s instructions. Dephosphorylated RNAs were ligated at their 3′ ends to a pre-adenylated DNA adaptor (AppNNNNTGGAATTCTCGGGTGCCAAGGddC) with 200 units of T4 RNA ligase 2 truncated KQ (NEB) in 3′ adaptor ligation buffer (1 ×T4 RNA ligase buffer, 15% PEG8000, 40 units RNasin (Promega)) overnight at 16˚C. 3′-ligation products were purified using SPRI select beads according to the manufacturer’s instructions. The 5’ ends of the RNAs were ligated to a 5′ RNA adaptor (GUUCAGAGUUCUACAGUCCGACGAUCNNNN) with 10 units of T4 RNA ligase 1 (NEB) in 5′ adaptor ligation buffer (1 ×T4 RNA ligase buffer, 1 mM ATP, 15% PEG8000, 40 units RNasin (Promega)) overnight at 16˚C. The RNA was subsequently purified using SPRI select beads according to the manufacturer’s instructions. Isolated RNA was reverse-transcribed using Superscript III Reverse Transcriptase (invitrogen) and the RT primer (GCCTTGGCACCCGAGAATTCCA), according to the manufacturer’s instructions. The cDNA was amplified using Illumina PR1 and RPI primers (TruSeq Small RNA kit) and the Q5 High-Fidelity DNA Polymerase (NEB), according to the manufacturer’s instructions. PCR products were separated on a 6% polyacrylamide gel in 1 × TBE buffer and the gel stained with SYBR Gold Nucleic Acid Gel Stain (Life Technology). Gel slices containing amplified libraries (180 to 200 bp) were excised and homogenized in 0.4 M NaCl, followed by an incubation overnight at 4˚C on a rotor. PCR products were precipitated with ethanol and PelletPaint NF (Millipore). Lastly, the DNA pellets were washed with 70% ethanol and dissolved in Nuclease-Free Water. Libraries were sequenced on an Illumina HiSeq platform.
CAGE : The 5 µg total RNAs from each replicate sample were reverse transcribed to cDNAs with random primers, and the capped RNA-cDNA hybrids were trapped by streptavidin beads. After the cap-trap, the single strand (ss)cDNAs were released from the beads and ligated to the Illumina Index containing a barcode identifier for each sample.
Iso-seq : Total RNA was sequenced on a PacBio Sequel HiFi platform (Pacific Biosciences) by Macrogen Japan.
Pacbio-DNAseq : The DNA was sequenced on a PacBio Sequel II HiFi platform (Pacific Biosciences) by Macrogen Japan.
piRNA-seq : Library construction were performed using the NEXTflex small RNA-seq kit v3 (PerkinElmer) or following method. One μl of a 3’ pre-adenylated adapter (20 pmol/μl) (AppNNNNTGGAATTCTCGGGTGCCAAGGddC) was added to 10.2 μl of purified RNA and incubated at 70°C for 2 min, followed by cooling to 4°C. The RNAs were then ligated to the adaptor at their 3′ ends in 3’ ligation buffer (2 μl of 10 x T4 RNA ligase buffer (no ATP) (NEB), 4.8 μl of 50% PEG8000 (NEB), 1 μl of RNasin (Promega), 1 μl of T4 RNA ligase 2 truncated KQ (NEB)) at 16°C overnight (>16 h). The RNA was purified using SPRIselect beads (Beckman Coulter), eluted with 16 μl of Nuclease-Free Water, and the 3’ adaptors degraded using deadenylase (NEB) and RecJf (NEB). After SPRIselect purification and elution with 8.2 μl of Nuclease-Free Water, the 5’ adaptor ligation buffer (2 μl 10 x T4 RNA ligase Buffer (no ATP) (NEB), 2 μl of 10 mM ATP (NEB), 4.8 μl of 50% PEG8000 (NEB), 1 μl of 5’ adaptor (20 pmol/μl) (GUUCAGAGUUCUACAGUCCGACGAUCNNNN), 1 μl of RNasin (Promega, N2111), 1 μl of T4 RNA ligase 1 (NEB, M0202L)) was added to the 3’ ligated RNAs and incubated at 16°C overnight (>16 h). After SPRIselect purification and elution with 10.2 μl of Nuclease-Free Water, 2 μl of 10 μM RT primer (GCCTTGGCACCCGAGAATTCCA) was added and the RNA reverse-transcribed using SuperScript III (Invitrogen) according to the manufacturer’s instructions. The libraries were amplified for 10 cycles using the Q5 High-Fidelity DNA polymerase (NEB), size selected by polyacrylamide gel electrophoresis and sequenced on the Illumina Miseq platform to obtain 50-nt single-end reads.
ChIP-seq : Libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Sequel

Data processing

CLASH : Adapter sequences were removed using Cutadapt v4.0, low-quality reads were removed, and duplicate reads collapsed using SeqKit v2.3.1. Four random nucleotides at both ends were removed from the obtained reads using Cutadapt v4.0, and reads between 23-30 nt were extracted and re-collapsed using the ‘make_comp_fasta.pl’ script from Hyb v0.0. To remove non-chimeric RNAs, reads were mapped to the gene reference using Hisat2 v2.2.1 with the parameters ‘--known-splicesite-infile known_splicing_sites.txt –rna-strandness F -k 2000’ and sense mapped reads were removed. Then, piRNAs were mapped to the chimeric reads using Bowtie v1.0.0 with the parameters ‘-a -v 0’, and only reads with full-length piRNAs at the 5' or 3' end and with the remaining read greater than 15 bp were selected. Selected reads were mapped to the gene reference using Bowtie2 v2.2.5 with the parameters ‘-a’ and sense mapping reads were extracted. To map spliced reads, unmapped reads were mapped to the gene reference using Hisat2 v2.2.1 with the parameters ‘--known-splicesite-infile known_splicing_sites.txt –rna-strandness F -k 2000’. To remove re-ligations of the same RNA, if the piRNA and the rest of the RNA mapped to the same gene, it was excluded from further analysis. Reads in which the piRNA or target sequence was dominated by more than 90% of a given base were also excluded. Gibbs free energy (ΔG) between the piRNA and target RNA was calculated using RNAplex from the ViennaRNA package v2.4.18 with the parameter ‘--temp=26’.
CAGE : Adapters, N-containing reads and reads shorter than 100 nt were removed using Cutadapt v4.0. The remaining reads were mapped to the dm6 genome using STAR v2.7.10b with the parameters ‘--outSAMattributes All --outSAMtype BAM SortedByCoordinate --readFilesCommand zcat --outSAMunmapped None --alignSplicedMateMapLmin 30 --alignMatesGapMax 200000 --outFilterMultimapNmax 20 --alignIntronMax 20000’, and bed files were generated using Samtools v1.651 and Bedtools v2.30.0 as follows: ‘samtools view -f 0x2 -bS -uq 20 | samtools sort -m 4G -n - | bedtools bamtobed -mate1 -bedpe -i stdin’. Input CAGE tag starting sites (CTSSs) were generated by R. CAGEr v2.4.0 was used to detect OSC TSSs. TSSs were clustered using ‘clusterCTSS(threshold = 0.1, thresholdIsTpm = TRUE, nrPassThreshold = 0.1, method = "distclu", maxDist = 20, removeSingletons = TRUE, keepSingletonsAbove = 5)’ from EGFP KD and Piwi KD samples. TE-mapped TSSs were removed, and annotations were obtained using Bedtools intersect v2.30.0. The coverage of each sample was calculated using Bedtools intersect v2.30.0. Only TSSs present in the 5’UTR and <100 bp upstream of the dm6 TSS were considered as a TSS for that gene.
Iso-seq : Nanostat v1.6.0 and Nanoplot v1.40.2 were used for quality control of the reads. The raw PacBio Iso-seq data was analyzed using the IsoSeq3 v3.8.1 pipeline (https://github.com/PacificBiosciences/IsoSeq). First, circular consensus sequences (CCS) were generated using CCS v6.4.0 (https://github.com/PacificBiosciences/ccs) with the parameter ‘-all’. Primers were removed using Lima v2.6.0 (https://github.com/PacificBiosciences/barcoding) with the parameters ‘--isoseq --dump-clips’ and poly-A containing reads were selected using ‘isoseq3 refine –require-polya’, to obtain full-length non-chimeric (FLNC) sequences. Then, ‘isoseq cluster –use-qvs’ was used to generate high quality isoforms with an accuracy of >99%. The generated isoforms were mapped to dm6 or TEs using Minimap2 v2.2256 with the parameters ‘-ax splice -uf --secondary=no -C5’, and collapsed using the ‘collapse_isoform_by_sam.py’ script with parameters ‘--dun-merge-5-shorter --gen_mol_count’ and the ‘get_abundance_post_collapse.py’ script from cDNA_Cupcake v29.0.0 (https://github.com/Magdoll/cDNA_Cupcake). 5’ degraded isoforms were removed using the ‘filter_away_subset.py’ script and expression counts were obtained using the ‘demux_isoseq_with_genome.py’ script from cDNA_Cupcake v29.0.0. Finally, the isoforms were annotated using the ‘sqanti3_qc.py’ script from SQANTI3 v5.1.
PacBio-DNAseq : For haplotype-resolved assemblies, the reads were assembled using Hifiasm v0.17.3 in Hi-C integration mode with the parameters ‘-t 28 --primary -D 10’. Hi-C data (SRR12655953, SRR12655954) was extracted from the Gene Expression Omnibus (GEO) database (accession code GSE158082)53. Assembly completeness was calculated with BUSCO v3.2.1 using diptera_odb10, and further assessed by Quast v5.2.0 (reference: dm6 full genome) to check the quality of the assemblies.
piRNA-seq : Adapter sequences were removed using Cutadapt v4.0 and collapsed using SeqKit v2.3.1. Four random nucleotides at both ends were removed using Cutadapt and reads with sizes between 23-30 nt were extracted for downstream analysis. The CPM of each piRNA was calculated and piRNAs with fewer than 1 CPM or 3 counts were discarded. Poly-A repeat sequences were also removed.
ChIP-seq : Adapters were removed using Cutadapt v4.0, and reads shorter than 50 nt were discarded. The remaining ChIP-seq reads were mapped to the dm6 genome using Bowtie2 v2.2.5 with default parameters. Uniquely mapping reads were extracted and used for further analysis. ChIP/input bigWigs were generated using the bamCompare function from Deeptools with the parameters ‘--binsize=10 --minMappingQuality 15 --normaliseUsing CPM –operation log2’. For Luciferase plasmid mapping, Adapter-trimmed reads were mapped to the pMT promoter and FLuc or NLuc regions of the plasmid. Read coverage was calculated as (1000000 * count / total reads in adapter trimmed reads). The NLuc / FLuc value was calculated.
Assembly: dm6
Supplementary files format and content: CLASH : clash_raw.csv.gz contains piRNA and target pairing. This files contains all possible pairings. clash_collapse.csv.gz contains collapsed pairings.
Supplementary files format and content: CAGE : CAGE_bw.zip contains TSS region and intensity bigwig. CAGE_matrix.zip contains each TSS’s intensity.
Supplementary files format and content: Iso-seq : isoforms.zip contains SQANTI3 output files.
Supplementary files format and content: PacBio-DNAseq : assembled_genome.zip contains assembled haploid genome sequence. Flam.zip contains flam and 20A sequence.
Supplementary files format and content: piRNA-seq : piRNA_CPM_GEO.zip contains each piRNA’s expression levels.
Supplementary files format and content: ChIP-seq : The bigwig file is the result of mapping to the genome. The bedgraph file is the result of mapping to Luciferase plasmid.

Submission date

May 28, 2024

Last update date

Nov 04, 2024

Contact name

Masaru Ariura

E-mail(s)

ariura.masaru2@keio.jp

Organization name

Keio university

Street address

Shinanomachi, Shinjuku-ku