|
Status |
Public on Oct 25, 2011 |
Title |
sequencing ricinus screen inversions |
Sample type |
SRA |
|
|
Source name |
haploid mouse ES cells
|
Organism |
Mus musculus |
Characteristics |
cell type: haploid mouse ES cells retrovirus used: reFlipROSAß-Geo(Cre) selection: ricinus communis transfection batch: FS6
|
Treatment protocol |
selection was performed with G418 or ricinus communis
|
Growth protocol |
ES cells were grown in standard ES cell medium
|
Extracted molecule |
genomic DNA |
Extraction protocol |
inverse PCR: In brief, genomic DNA preparations were digested using DpnII or MseI, purified using the QIAquick Gel Extraction Kit, and fragments ligated at a concentration of 3µg/ml over night. The ligase was then heat inactivated and rings were re-digested in ligase buffer using the enzymes NheI and PvuII. Linearized fragments were purified using the QIAquick Gel Extraction Kit and subjected to PCR using Accuprime Taq polymerase (Invitrogen), primers FS Solexa upstream and FS Solexa downstream, and a BioRad Thermal Cycler. The program of 95ºC for 30 sec, 60ºC for 30 sec, and 68ºC for 105 sec was repeated 36 times. Amplicons were loaded on agarose gels, eluted and subjected to deep sequencing using an Illumina Genome Analyzer and primer FS flowcell. The following iPCR primers were used: upstream primer AATGATACGGCGACCACCGAGATCGCCAGTCCTCCGATTGA downstream primer CAAGCAGAAGACGGCATACGAGTTCCTATTCCGAAGTTCCTATTCTCTA flowcell sequencing primer TGATTGACTACCCGTCAGCGGGGGTCTTTCA
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
PCR |
Instrument model |
Illumina Genome Analyzer IIx |
|
|
Description |
sequencing ricinus screen inversions
|
Data processing |
Illumina GA Pipeline RTA 1.8.7; reads were mapped to the mouse mm9 genome using bowtie 0.12.5
|
|
|
Submission date |
Oct 24, 2011 |
Last update date |
May 15, 2019 |
Contact name |
Ulrich Elling |
Organization name |
IMBA
|
Lab |
Penninger
|
Street address |
Dr. Bohr-Gasse 3
|
City |
Vienna |
ZIP/Postal code |
1030 |
Country |
Austria |
|
|
Platform ID |
GPL11002 |
Series (1) |
GSE33184 |
Retroviral mutagenesis in haploid ES cells |
|
Relations |
SRA |
SRX104122 |
BioSample |
SAMN00749869 |