NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7989840 Query DataSets for GSM7989840
Status Public on Apr 15, 2024
Title Aortic CD45+ cells library1, HTO
Sample type SRA
 
Source name Aorta
Organism Mus musculus
Characteristics tissue: Aorta
cell line: not applicable
cell type: CD45+
genotype: Ldlr-/-
treatment: various
library type: HTO
Extracted molecule protein
Extraction protocol Ldlr-/- mice were fed a HFD according to the “Continuous” or “Alternate” diet protocols. C57bl6/J mice were used as healthy controls. Before sacrifice, mice received an i.v. injection of 2.5µg anti-CD45.2 APC (clone 104, Biolegend, cat. #109814) under isoflurane anesthesia to exclude contaminating blood leukocytes during FACS sorting. Mice were killed by cervical dislocation under isoflurane anesthesia, perfused via intracardiac injection of PBS, and the aorta excised and cleaned of perivascular adipose tissue. Aortas from 2 mice were pooled to generate each sample for single cell RNA-seq (scRNA-seq). The aortas were digested for 1 hour at 37°C under agitation in RPMI containing 450U/ml collagenase I (Sigma-Aldrich, #C0130), 125U/ml Collagenase XI (Sigma-Aldrich, C7657), 60U/ml Hyaluronidase (Sigma-Aldrich, H3506), 60U/ml DNAse (Roche #11284932001). After washing with PBS supplemented with 1% FCS, aortic cell preparations were incubated on ice in PBS+1%FCS supplemented with 1:50 FcBlock (BioLegend TruStain FcXTM) for 10 minutes, and further incubated for 25 minutes with a mix of fluorochrome coupled antibodies (anti-CD45.2-Alexa488 1:300, anti-Ter119-PE-Cy7 1:300), a viability dye (ThermoFisher Fixable Viability Dye e780), TotalSeq-A CITE-seq (all from BioLegend) and mouse TotalSeq-A Hashtag antibodies (1:200; BioLegend). Cell preparations were labeled using the following scheme: Hashtag 1 to 5: 5 pools of 2 aortas from Ldlr-/- mice fed the “Continuous” diet protocol; Hashtag 6 to 10: 5 pools of 2 aortas from Ldlr-/- mice fed the “Alternate” diet protocol; Hashtag 11 to 13: 3 pools of 2 aortas from healthy C57BL6/J mice. After two washes, all cell preparations were pooled for simultaneous sorting. We sorted viable Ter119negCD45.2(i.v.)negCD45.2-Alexapos in PBS supplemented with 0.2% ultrapure BSA (ThermoFisher) using a FACS Aria III with a 100µm nozzle. After sorting and washing, cells were resuspended in PBS supplemented with 0.2% ultrapure BSA at a concentration of 500 cells/µl and loaded into the 10x Genomics Chromium in duplicate lanes (Single Cell 3’ v3 reagents, 10x Genomics) and scRNA-seq, ADT and HTO libraries prepared and sequenced as described in PMID: 35950218.
Single cells were encapsulated into droplets with the Chromium™ Controller (10x Genomics). Transcripts captured in all cells encapsulated with a bead were uniquely barcoded using a combination of a 16 bp 10x Barcode and a 12 bp unique molecular identifier (UMI). cDNA libraries were generated using the Chromium™ Single Cell 3’ Library & Gel Bead Kit v3 (10x Genomics) following the detailed protocol provided by the manufacturer.
-CITE-seq library: amplification was performed at 95°C for 3’ followed by ten cycles at 95°C f¬¬or 20’’; 60°C for 30’’; 72°C for 20’’ and final elongation 72°C for 5’ with 5’-CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3’ Small RNA RPI1 primer as i7 primer (Illumina).
-HASH-seq library: amplification was performed at 95°C for 3’ followed by ten cycles 95°C for 20’’; 64°C for 30’’; 72°C for 20’’ and final elongation 72°C for 5’ with 5’-CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGC-3’ TruSeq D701_s primer as i7 primer (Illumina).
The following 5’- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3’ SI-PCR primer as i5 primer (Illumina) was used for both CITE- and HASH- seq library amplification.
Following the final bead purification, all three libraries were pooled as 80% mRNA library, 10% ADT library and 10% HTO library before sequencing.
 
Library strategy OTHER
Library source other
Library selection other
Instrument model Illumina NovaSeq 6000
 
Description HTO: read1 file contains cell barcode and UMI; read2 file contains Hastag Antibody derived tag reads
G3_2_filtered_feature_bc_matrix.tar.gz
G3_2_molecule_info.h5
Data processing Pre-processing of sequencing results to generate count matrices (gene expression, ADT and HTO barcode counts) was performed using the 10x genomics Cell Ranger pipeline where ADT and HTO sequences were concatenated and treated as Custom library with default settings (v3.0.2) and aligning to the mm10 genome build and Ensembl 93 annotations.
Further processing was done with Seurat v3.0.0 (cell and gene filtering, hashtag identification, clustering, differential gene expression analysis).
Assembly: mm10
Supplementary files format and content: 10x Genomics output files: barcodes.tsv.gz, features.tsv.gz, matrix.mtx.gz
Library strategy: CITE-seq (Cellular Indexing of Transcriptomes and Epitopes by sequencing)
 
Submission date Dec 22, 2023
Last update date Apr 15, 2024
Contact name Alexander M. Leipold
Organization name Helmholtz Institute for RNA-based Infection Research
Lab Saliba Lab
Street address Josef-Schneider-Str. 2
City Würzburg
ZIP/Postal code 97080
Country Germany
 
Platform ID GPL24247
Series (1)
GSE251907 scRNA-seq of mouse CD45+ aortic cells with CITE-seq and cell Hashing after continuous or alternate diet
Relations
BioSample SAMN39079009
SRA SRX23003177

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap