 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 15, 2024 |
| Title |
RNAseq_4C_MC_Female_rep14 |
| Sample type |
SRA |
| |
|
| Source name |
Single preimplantation embryo
|
| Organisms |
Mus musculus; Mus musculus castaneus |
| Characteristics |
tissue: Single preimplantation embryo
cell type: N/A
genotype: wild type (MC)
Sex: Female
strain: C57BL/6J x CAST/EiJ
developmental stage: 4-cell
treatment: N/A
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Single embryo was flushed out from the mouse oviduct, and immediately lysed in 1ul lysis solution containing 1% NP-40 and 4U RNase inhibitor
A combination of 1ul of 5x 1st strand buffer and 0.1 ul of RNA spike-in or water was added into the single embryo lysis, followed by the incubation at 82C for 12 minutes. After quick chill on ice, the RNAs were next end repaired by adding 1ul PNK solution (70mM tris-HCl pH7.6, 10mM MgCl2, 15mM DTT, 4 units/ul RNase Inhibitor) containing 2 units of T4 PNK and by incubating at 37C for 10 minutes. The RNA samples were further incubated at 37C for 5 minutes after the addition of 0.5ul mix containing 1 unit of PolyA polymerase and 3 picomole ATP. Before reverse transcription, 1ul of pre-RT mix (5uM R-dT Primer (TTTCCCTACACGACGCTCTTCCGATCTNNNNNNTTTTTTTTTTTTTTTVVN), 6.25mM dNTPs, 15mM EDTA) was added to samples, followed by the heat up at 72C for 2 minutes. After RNA denaturation, samples were immediately chilled on ice, followed by the addition of 5.5ul freshly made RT mix containing 1X 1st strand Buffer, 10mM DTT, 2U/ul RNase inhibitor, 2M Betaine, 1uM GGrG oligo (iCiGiCGGAGTTCAGACGTGTGCTCTTCCGATCTrGrG+G) and 20U/ul Superscript II reverse transcriptase II. Samples were then incubated with the following temperature setting: 40C for 5 mins, 42C for 30 mins, Two cycles of 50C for 2 mins followed by 42C for 2mins, and 15 mins at 70C. First strand cDNA libraries were next amplified by 15 cycles of first round PCR (F: GTGACTGGAGTTCAGACGTGTGCTCTTC; R: ACACTCTTTCCCTACACGACGCTCTTC) in a total volume of 30ul PCR reactions and purified with Ampure XP beads at 1:1 ratio. Purified cDNAs from the PCR (13.5ul) were mixed with 130ng of RNA probes in total 30ul of hybridization buffer (10mM Tris-HCl, pH8.0, 0.5M NaCl, 5mM EDTA and 0.2% SDS), and incubated at the following temperatures: 94C for 2 mins, followed by ramp down to 50C with 1C down per 50 seconds, and finally at 50C for 5 mins. Meanwhile, 100ul of streptavidin C1 beads were washed, pre-blocked and warmed to 50C. To delete ribosomal cDNAs, samples and beads were mixed at 50 C and incubated for another 5 mins at 50 C, and immediately put on a magnetic rack. Supernatant was collected and purified with Ampure XP beads. The purified cDNAs were further amplified by 9 cycles of PCR with Multiplex oligos (NEB). The final PCR product was purified and subject to sequencing.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
protocols1
|
| Data processing |
On the HiSeq 2500, HiSeq 4000 and NovaSeq platform, intensity extraction from images, base calling and quality score assignment during the sequencing was performed by software RTA and RTA2, respectively.
Raw data was first examined using Trim Galore (The Babraham Bioinformatics Group) to remove adapters from reads using the following parameters: (--stringency 8 --phred33 -e 0.2 --paired --length 43 --r1 44 --r2 44), followed by the PCR duplication removal and subsequent base trimming from the 5’end of reads (22nt from read1 and 5nt from read2). Pre-processed reads were aligned to two parental mouse genomes separately using STAR (v2.7.10a) in the 2-pass mode, with the allowance of 1 mismatch in every 20 bases and a maximum of 6 mismatches per read pair. Non-canonical introns were not considered. Reads with overlapping mates were only considered with at least 5 nucleotide overlap. All discordant read pairs where two mates were aligned to different chromosomes were discarded. The coordinates of rRNA genes in mm10 mouse genome were downloaded from RepeatMasker track (v4.0.7) in UCSC genome browser and all the reads mapping to these regions were masked and ignored in the final output files (including bam, bed and bw files).
To quantify overall expression of each given gene, all unique aligned read pairs overlapping with gene exons were counted using featureCounts (v1.5.0-p1).
For allelic gene analysis, each unique aligned read that covered strain specific SNPs or indels was analyzed and the alignment quality between two alleles was compared to determine its allelic origin. Each experiment yielded three tracks: cas, mus, and composite (neutral, cas and mus combined). For better visualization of gene expression between alleles, read mapping coordinates in different parental genomes were also converted to matched coordinates in mm10 mouse genome. Similar to overall expression quantification, only the allelic read overlapping with gene exons were considered for allelic read counts of this gene. Allelic expression level of a given gene was thus calculated by splitting its overall expression in accordance with the allelic expression ratio, which was defined by the ratio of total allelic read count from one allele relative to that of the other allele.
assembly: mm10
processed data files format and content: alignment .bw files showing RNA coverage on + and - strand from M. castaneus (cas) reads, M. musculus (mus) reads and compsoite (comp) reads.
processed data files format and content: .txt files showing gene read counts from M. castaneus (cas) reads, M. musculus (mus) reads and compsoite (comp) reads.
|
| |
|
| Submission date |
Dec 18, 2023 |
| Last update date |
Aug 19, 2024 |
| Contact name |
Chunyao Wei |
| E-mail(s) |
weic@molbio.mgh.harvard.edu
|
| Organization name |
Massachusetts General Hospital
|
| Department |
Molecular Biology
|
| Street address |
185 Cambridge St.
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02114 |
| Country |
USA |
| |
|
| Platform ID |
GPL33196 |
| Series (1) |
| GSE168455 |
Parallel tracking dosage compensation in the early mouse embryo |
|
| Relations |
| BioSample |
SAMN38913128 |
| SRA |
SRX22954552 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7980626_4C_MC.rep14.bw.tar.gz |
75.4 Mb |
(ftp)(http) |
TAR |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
