 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 03, 2024 |
| Title |
U2OS cells, VEGFA site 2 replicate 2 |
| Sample type |
SRA |
| |
|
| Source name |
derived from sarcoma of the tibia
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: derived from sarcoma of the tibia
cell line: u2os
cell type: sarcoma of the tibia
genotype: WT
treatment: digested with VEGFA site 2 sgRNA
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
gDNA was extracted with DNeasy® Blood & Tissue kit
Library prep was performerd as described in the TTISS-seq manuscript: https://www.cell.com/molecular-cell/fulltext/S1097-2765(20)30143-X
TTISS-seq
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Instructions as in the TTISS-seq manuscript (https://www.cell.com/molecular-cell/fulltext/S1097-2765(20)30143-X)
- Open in a web browser the site http://BrowserGenome.org - Click the “Map deep sequencing data” tab
- Under point 2 click “Browse” to choose the human genome file “hg38.2bit” on your hard drive (download from http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.2bit) - Under point 3 click “Browse” to choose all un-compressed FASTQ files to be analyzed - Under point 4, enter the filter values 0 bp, TTATCCTCCTCGCCCTTGCTCACAAC - Under point 5 enter forward mapping start = 26 bp - Under point 6 enter forward mapping length = 25 bp - Under point 7 enter reverse mapping length = 15 bp - Under point 8 enter max forward/reverse span = 1000 bp
- Click “Start mapping,” which takes about one hour per ten million reads - When all data has been processed, click “Save all” on bottom right to save mapping data files - Click on the “Process” tab, then “Remove single read noise” and “Enforce antisense-overlap reads” for basic noise reduction and off-target site identification - Click “Export peak list” to save a list of detected cleavage sites, which can be opened in a text or spreadsheet editor for further analysis
Assembly: UCSC Human Genome version hg38 (timestamp 2014-01-15 21:14) downloaded from http://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz
Supplementary files format and content: tab separated file with genome position, local sequence, number of double-strand breaks
|
| |
|
| Submission date |
Nov 17, 2023 |
| Last update date |
Apr 03, 2024 |
| Contact name |
Sergi Sayols |
| Organization name |
Institute of Molecular Biology, Mainz
|
| Street address |
Ackermannweg 4
|
| City |
Mainz |
| ZIP/Postal code |
55128 |
| Country |
Germany |
| |
|
| Platform ID |
GPL18573 |
| Series (2) |
| GSE223772 |
Linking CRISPR/Cas9 double-strand break profiles to gene editing precision with BreakTag |
| GSE248141 |
Linking CRISPR/Cas9 double-strand break profiles to gene editing precision with BreakTag [ampliseq 3] |
|
| Relations |
| BioSample |
SAMN38301936 |
| SRA |
SRX22560411 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7906338_VEGFAsite2_2.txt.gz |
13.5 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
