 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 18, 2024 |
| Title |
RNAseq of 48h WT gastruloids replicate3 |
| Sample type |
SRA |
| |
|
| Source name |
Gastruloids
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Gastruloids
genotype: WT
replicate: 3
Stage: 48h
background: 129/SVEV
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Gastruloids were collected and pooled in a 2-ml Eppendorf tube at the indicated timepoints. After medium removal, gastruloids were washed once with PBS, pelleted and stored at −80 °C until RNA extraction. RNeasy Mini kit (Qiagen) with on-column DNase digestion was used for RNA extraction following manufacturer’s instructions. RNA quality was assessed on a Tapestation TS4200, all RNA samples showed quality number (RIN) above 9.5.
RNA-seq library preparation with Poly-A selection was performed with 1000 ng (for time course analysis) or 500 ng (for mutant gastruloid analysis) of RNA using the Illumina stranded mRNA ligation and following the manufacturer’s protocol 1000000124518 v01. Library quality was assessed with a Libraries were quantified by qubit DNA HS and profile analysis was done on TapeStation TS4200. Libraries were sequenced on HiSeq 4000 Illumina, with paired end 75 bp reads.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
Raw RNA-seq reads generated in this study were trimmed to remove Nextera adapters or bad quality bases (Cutadapt v4.043 -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -A CTGTCTCTTATACACATCTGACGCTGCCGACGA -q 30 -m 15). Mapping and counting were performed on filtered reads on the mouse genome mm10 with STAR version 2.7.8a44 with a custom gtf based on Ensembl version 10245 and ENCODE parameters. FPKM values were obtained by Cufflinks version 2.2.146,47 with options --no-effective-length-correction -b 'mm10.fa' --multiread-correct --library-type fr-firststrand --mask-file 'chrM_mm10.gtf' --max-bundle-length 10000000 --max-bundle-frags 1000000 (where chrM_mm10.gtf contains a transcript on each strand of the whole chrM). Uniquely mapped reads were filtered with bamFilter48 version 2.5.1. Coverages were computed with BEDTools49 version 2.30.0 for each strand using the '-scale' parameter to normalize to million uniquely mapped reads. Average between duplicates was performed with bigwigAverage v3.5.4 from deepTools50. All samples were of good quality and none were excluded from the analysis. Genes were called differentially expressed when they had both abs(log2fc) > 1 and padj < 0.05
All the code required to reproduce the analysis is available here (https://github.com/MayranA/allScriptsFromMayranEtAl2023)
Assembly: mm10
Supplementary files format and content: repX_both_strands.bw: normalized coverage (to million of uniquely mapped reads) with both strands combined
Supplementary files format and content: repX_negative_strand.bw: normalized coverage (to million of uniquely mapped reads) with coverage on negative strand
Supplementary files format and content: repX_positive_strand.bw: normalized coverage (to million of uniquely mapped reads) with coverage on positive strand
Supplementary files format and content: .bw: average of normalized coverage of the two or three replicates (96h_WT is the average of rep1, rep2 and rep3 while 96h_Snai1WT is the average of 96h_WT_rep4 and rep5)
Supplementary files format and content: tablesX.tar.gz: archive with two tables: AllCufflinks_Simplified.txt.gz: single table with all FPKM values from cufflinks and AllHTSeqCounts.txt.gz: single table with all counts from STAR
Supplementary files format and content: DESeq2_summary.txt: tabular separated text file where each row is a gene and columns indicates log2FC, padj and weather it was significant in each of the analysis
Supplementary files format and content: DESeq2_summary_long.txt: tabular separated text file where each row is a gene in a DESeq2 comparison. This format is more compatible with ggplot2.
|
| |
|
| Submission date |
Nov 11, 2023 |
| Last update date |
Jul 18, 2024 |
| Contact name |
ALEXANDRE MAYRAN |
| E-mail(s) |
alexandre.mayran@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
LAUSANNE |
| State/province |
Waadt |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL24247 |
| Series (2) |
| GSE247508 |
Cadherins modulate the self-organizing potential of gastruloids (RNA-seq) |
| GSE247511 |
Cadherins modulate the self-organizing potential of gastruloids |
|
| Relations |
| BioSample |
SAMN38206136 |
| SRA |
SRX22486729 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7890892_48h_WT_rep3_both_strands.bw |
100.4 Mb |
(ftp)(http) |
BW |
| GSM7890892_48h_WT_rep3_negative_strand.bw |
50.3 Mb |
(ftp)(http) |
BW |
| GSM7890892_48h_WT_rep3_positive_strand.bw |
51.8 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
