 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 18, 2024 |
| Title |
ATAC-seq on WT gastruloids at 96h replicate 2 |
| Sample type |
SRA |
| |
|
| Source name |
Gastruloids
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Gastruloids
Stage: 96h
genotype: WT
replicate: 2
background: 129/SVEV
|
| Extracted molecule |
other |
| Extraction protocol |
Assay for Transposase Accessible Chromatin was performed as described in Corces et al. 2017. Gastruloids were collected, pooled in a 1.7 ml Eppendorf tube and washed twice in 1 ml of PBS. They were then dissociated in 100 µl of Accutase (Stempro) for 5 min at 37°C. Full dissociation was completed by mechanical dissociation and verified to ensure proper dissociation. Dissociated cells were then washed in 500 µl of PBS (centrifugation 5 minutes at 4°C at 400g) and resuspended in 200 µl of resuspension buffer RSB (10 mM Tris-HCl pH7.4, 10 mM NaCl, 3 mM MgCl2). 50 000 cells were extracted, pelleted (centrifugation 5 minutes at 4°C at 400g) and incubated 3 minutes on ice in cold lysis buffer (RSB, 0.1% NP40, 0.1% Tween-20, 0.01% Digitonin). Nuclei were then washed in 1 ml of lysis washout buffer (RSB, 0.1% Tween-20) and pelleted at 500g for 10 minutes at 4°C. Pelleted nuclei were resuspended in 50ul of cold transposition buffer (25 ulTD Buffer, 2,5ul Tn5 (Illumina, 20034197), 20% PBS, 0.01% Digitonin, 0.1% Tween-20, 10% water) and incubated 30 minutes at 37°C. For the samples : 48h_WT_rep1, 48h_WT_rep2, 72h_WT_rep1, 72h_WT_rep2, 96h_WT_rep1, 96h_WT_rep2, 120h_WT_rep1, 120h_WT_rep2, after dissociation, the Buenrostro et al. 2013 version of the ATAC protocol was used. Briefly, following accutase dissociation, 50 000 cells were resuspended in ice cold Lysis buffer (10 mM Tris-Cl pH7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP40). Samples were then centrifuge at 4°C for 10 minutes, and supernatant was removed. Tagmentation was performed by resuspending the pellet in in 50 ul of tagmentation mix (25 ul TD buffer, 2,5 ul Tn5, 22.5 ul H2O), then all samples underwent the same procedure for library preparation, quality control and analysis
Each reaction was purified using the Qiagen MinElute PCR purification kit. The reaction was then amplified by PCR using the NEBNext Master Mix and Nextera primers.
|
| |
|
| Library strategy |
ATAC-seq |
| Library source |
other |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Raw ATAC-seq reads were trimmed to remove Nextera adapters or bad quality bases (Cutadapt v4.043 -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -A CTGTCTCTTATACACATCTGACGCTGCCGACGA -q 30 -m 15). Mapping was performed on filtered reads on the mouse genome mm10 with Bowtie2 version 2.5.044 (--very-sensitive 2). Resulting Bam files were sorted using samtools. Reads mapping to the mitochondrial chromosome or unconcordantly were discarded with bamFilter v2.5.248. Duplicates were removed with picard MarkDuplicates version 2.18.2. BAM was converted to BED with BEDTools version 2.30.0 in order to use both mates to call peaks. Peaks were called using macs2_callpeak v2.2.7.1. with the options (--gsize '1870000000' --call-summits --keep-dup 'all' --nomodel --extsize '200' --shift '-100' --bdg). Coverages were converted to bigwig and normalied to the number of million reads mapped less than 500bp from a peak summit. Normalised coverages from wild-type replicates 1 and 2 were averaged with bigwigAverage version 3.5.4 from deepTools as well as the coverages from the two KO clones at 72 and 96h. In order to build a comprehensive confident list of peaks from the wild-type time course, at each time point the following strategy was adopted. The BED with the largest number of reads was downsampled to match the number of reads of the other replicate. Peaks were called using a merged of equally sized BED. Only peaks whose summit was overlapping a peak in each of both replicates were kept. The four lists of confident peaks (one per time point) were concatenated and merged with BEDTools version 2.30.0. The number of reads falling into this comprehensive confident list were quantified with deeptools multiBamSummary version 3.5.150. DESeq2 was used to compare the wild-type duplicates of 72h with the wild-type duplicates of 96h to determine the loci with a significant change in accessibility (abs(log2FC) > 1 an adjusted p-value < 0.05). All the code required to reproduce the analysis is available here (https://github.com/MayranA/allScriptsFromMayranEtAl2023)
Assembly: mm10
Supplementary files format and content: .narrowPeak.gz: narrowPeak from MACS2
Supplementary files format and content: _repX.bw: coverage from MACS2 normalized to million reads in peaks
Supplementary files format and content: .bw: average of normalized coverage of the two first replicates
Supplementary files format and content: WT.narrowPeak.gz: consensus, confident peaks from two first replicates
|
| |
|
| Submission date |
Nov 11, 2023 |
| Last update date |
Jul 18, 2024 |
| Contact name |
ALEXANDRE MAYRAN |
| E-mail(s) |
alexandre.mayran@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
LAUSANNE |
| State/province |
Waadt |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE247507 |
Cadherins modulate the self-organizing potential of gastruloids (ATAC-seq) |
| GSE247511 |
Cadherins modulate the self-organizing potential of gastruloids |
|
| Relations |
| BioSample |
SAMN38206081 |
| SRA |
SRX22486716 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7890879_96h_WT_rep2.bw |
785.0 Mb |
(ftp)(http) |
BW |
| GSM7890879_96h_WT_rep2.narrowPeak.gz |
1.8 Mb |
(ftp)(http) |
NARROWPEAK |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
