 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 11, 2023 |
| Title |
DSP-1012550009801-A-A11 |
| Sample type |
SRA |
| |
|
| Source name |
DRGs T8 to T12
|
| Organism |
Mus musculus |
| Characteristics |
genotype: Ptf1a-Cre; LSL-Kras+/G12D
tissue: DRGs T8 to T12
slide id: KC2
roi number: 10
segment type: Full ROI
area: 110242
nuclei_counts: 714
roi x coordinate: 19395
roi y coordinate: 67585
rawreads: 32998327
alignedreads: 31842066
deduplicatedreads: 2033344
trimmedreads: 32868131
stitchedreads: 32680056
sequencingsaturation: 93.6
|
| Treatment protocol |
no treatment
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Murine DRG T8 to T12 were extracted bilaterally from TPAC (Ela-TGFα; Ptf1a-Cre; Trp53fl/fl;RelAfl/fl , n=6, 47-54 weeks old), KPC (Ptf1a-Cre; LSL-Kras+/G12D; Trp53+/fl , n=3, 20-21 weeks old) and age-similar tumor-free control mice (Ela-TGFα; Trp53fl/fl;RelAfl/fl , n=3, 48-50 weeks old for TPAC and LSL-Kras+/G12D; Trp53+/fl , n=1, 20 weeks old; Trp53+/fl , n=1, 21 weeks old and LSL-Kras+/G12D; n=1, 22 weeks old for KPC). Following the extraction, DRGs were briefly washed in ice-cold, fresh PBS (D5262, Sigma-Aldrich) and fixated in freshly prepared 4% PFA (15710, Electron Microscopy Sciences; diluted with PBS) for 24 hours at room temperature. The samples were consecutively dehydrated, paraffine embedded and sectioned. For the human spatial transcriptome studies, two patient derived biopcies with pancreatic ductal adenocarcinoma analysed with HE staining for the neural invasion were fixed in freshly prepared 4% PFA (15710, Electron Microscopy Sciences; diluted with PBS) for 24 hours at room temperature. Three FFPE tissue sections of 5-μm from DRG biopsy tissue microarray (TMA) with VILI (n=6) and AIH (n=8) (TMA construction described below in the Immunoprofiling with CO-Detection by indEXing (CODEX)) were mounted on positively charged histology slides. Sections were incubated at 65 °C for 1 hour. Then, sections were deparaffinized in 3 xylol baths of 5 minutes and rehydrated in ethanol gradient from 100% EtOH 2 baths of 5 minutes, followed by 95% EtOH 5 minutes. Slides were then washed in 1X PBS. Antigen retrieval was carried out with Tris-EDTA pH 9.0 buffer at 100°C for 20 minutes at low pressure. Slides were first immersed into hot water for 10 seconds and then immersed into Tris-EDTA buffer. The cooker vent kept open during the procedure to ensure low pressure and it was allowed to reach 100°C. Slides were then washed with 1X PBS, and incubated in proteinase K containing PBS (1ug/ml) for 15 minutes at 37°C and washed again in 1X PBS. Tissue were post-fixed in 10% neutral-buffered formalin (NBF) for 5 minutes, washed two times 5 minutes in NBF stop buffer (0.1M Tris Base, 0.1M Glycine) and finally one time in 1X PBS. The mix of Whole Transcriptome Atlas probes (WTA, Nanostring) was dropped on each section and covered with HybriSlip Hybridization Covers. Slides were then incubated for hybridization overnight at 37°C in a Hyb EZ II hybridization oven (Advanced cell Diagnostics). The day after, HybriSlip covers were gently removed and 25 minutes stringent washes were performed twice in 50% formamide and 2X saline sodium citrate (SSC) at 37 °C. Tissues were washed for 5 min in 2× SSC, then blocked in Buffer W (Nanostring Technologies) for 30 min at room temperature in a humidity chamber. Next, 500 nM Syto83 and antibodies targeting NeuN (Channel-647, host-mouse, company -abCam, clone # EPR12763, dilution 1:100); GFAP (Channel-488, host-mouse, company -Novus, clone # GA-5, dilution 1:200); CD68 (Channel-594, host-mouse, company -Santa Cruz, clone # KP1, dilution 1:200) in Buffer W were applied to each section for 1 h at room temperature. Slides were washed twice in fresh 2× SSC then loaded on the GeoMx DSP. DSP Instrument (NanoString Technologies, Inc.), nCounter (NanoString Technologies, Inc.), Immunohistochemistry Pressure Cooker (BioSB), PCR instrument (Biorad) was used.
DNA oligonucleotide probes were designed to bind mRNA targets. From 5′ to 3′, each probe is comprised of a 35- to 50-nucleotide target complementary sequence, an ultraviolet (UV) photo cleavable linker and a 66-nucleotide indexing oligonucleotide sequence containing a unique molecular identifier (UMI), RNA ID sequence and primer binding sites. Oligomers from ROIs were disintegrated by UV irradiation, passed through capillaries, pooled into collection plates, and resealed with DAPI fluoromount G mounting medium.
Entire slides were imaged at ×20 magnification and morphologic markers were used to select Region Of Interest (ROI) either using circle or organic shapes. Automatic segmentation of ROI based on NeuN marker was used to defined Area of Illumination (AOIs). This allowed to separate Neurons (NeuN+) and cells around. A total of AOIs were exposed to 385 nm light (UV), releasing the indexing oligonucleotides which were collected with a microcapillary and deposited in a 96-well plate for subsequent processing. The indexing oligonucleotides were dried down overnight and resuspended in 10 μl of DEPC-treated water. Sequencing libraries were generated by PCR from the photo-released indexing oligos and AOI-specific Illumina adapter sequences, and unique i5 and i7 sample indices were added. Each PCR reaction used 4 μl of indexing oligonucleotides, 4 μl of indexing PCR primers, 2 μl of Nanostring 5X PCR Master Mix. Thermocycling conditions were 37 °C for 30 min, 50 °C for 10 min, 95 °C for 3 min; 18 cycles of 95 °C for 15 s, 65 °C for 1 min, 68 °C for 30 s; and 68 °C for 5 min. PCR reactions were pooled and purified twice using AMPure XP beads (Beckman Coulter, A63881), according to the manufacturer’s protocol. Pooled libraries were single-sequenced at 27 base pairs and with the single-index workflow on an Illumina NovaSeq S4 instrument. FastQ files were converted into DCC files according to manufacturer’s pipeline. Digital Count Conversion files were imported back into the GeoMx DSP instrument for QC and data analyses using GeoMx DSP analysis suite version 2.4.2.2 (Nanostring).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
Samples were pooled during library preparation and split across lanes. Individual FASTQ files were generated for each lane, forward & reverse primers. The Fastq files contain the same identifier as the sample name for aggregation.
|
| Data processing |
dcc-metadata = true
save-interim-files = false
quality-trim-score = 20
2color-trimming = True
adapter1 = AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
adapter2 = AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
adapter-trim-match-length = 10
adapter-trim-max-mismatch = 3
barcode-max-mismatch = 1
stitching-max-mismatch = 2
dedup-hd = 1
threads = 4
|
| |
|
| Submission date |
Oct 11, 2023 |
| Last update date |
Oct 12, 2023 |
| Contact name |
Rouzanna Istvánffy |
| E-mail(s) |
rouzanna.istvanffy@tum.de
|
| Organization name |
Klinikum rechts der Isar
|
| Department |
Department of Surgery
|
| Street address |
Ismaningerstr. 22
|
| City |
Munich |
| ZIP/Postal code |
81675 |
| Country |
Germany |
| |
|
| Platform ID |
GPL24247 |
| Series (1) |
| GSE245126 |
Phenotype screens of murine pancreatic cancer identify a Tgfa-Ccl2-paxillin axis driving human-like neural invasion |
|
| Relations |
| BioSample |
SAMN37778239 |
| SRA |
SRX22066698 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7837146_DSP-1012550009801-A-A11.dcc.gz |
69.1 Kb |
(ftp)(http) |
DCC |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
