 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 10, 2024 |
| Title |
mouse_activating_sorted_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
mESC
|
| Organism |
Mus musculus |
| Characteristics |
cell line: mESC
genotype: wild-type cells with 7xTetO-pMYLPF-Puro-IRES-GFP reporter integrated into the expression-stable locus on Chr15, clonal cell line
treatment: sorted
|
| Treatment protocol |
The ORFtag viral constructs were derived from the ecotropic Retro-EGT construct8 that includes the sequence features necessary for the inverse-PCR protocol (see below). Furthermore, the construct contains constitutively active PGK promoter that drives the expression of a NeoR resistance gene separated from a tag by the IRES sequence. The tag contained either TetR with an N-terminally located nuclear localization signal (Activator and Repressor screens; Addgene, this study) or LambdaN domain (PTGR screen; Addgene, this study). Additionally, the tag contained 2x GGGS-linker followed by the BC2-tag and 3xFLAG-tag. Finally, the ORFtag construct contains a consensus splice donor motif followed by a part of the Hprt intron (chrX:53020400-53020556 +, mm10). In order to tag genes in all three possible coding frames, three constructs were used that contain either 0, 1 or 2 additional nucleotides upstream of the consensus splice motif. Retroviral constructs carrying ORFtag cassette were packed in PlatinumE cell lines (for the screens performed in mESCs) or PlatinumA cell lines (for the screen performed in HEK293 cells) using polyethylenimine (PEI) reagent as described previously8. Reporter cell lines (100-150 million cells) were transduced with packaged retrovirus in the presence of 6 µg/ml polybrene (Sigma) and at low transduction efficiency (< 20%) to ensure only one virus per cells. Cells were harvested 24 hours later and plated in medium containing 0.1 mg/ml G418 (Gibco) for selection of transduced cells. Selection was continued until all cells on the control plate died (4-5 days), after which 40 million cells were processed as non-selected background for mapping of genomic integrations (see below). The remaining cells were sorted for GFP-positive (mouse and human Activator screens) or GFP-negative (mouse and human Repressor screens) populations using BD FACSAria III or IIu cell sorters (BD Biosciences) and processed for mapping of genomic integrations (see below). For the PTGR screen a five-sort strategy was applied to enrich cells that show a tethering dependent repression of reporter gene expression. Cells with a GFP expression equal to the lowest 10 percent of GFP expression observed after selection were sorted using BD FACSAria III and expanded thereafter. Additionally, non-sorted cells were maintained for gating of the consecutive sorts. Two additional sorts for cells with GFP expression similar to the lowest 10% of GFP signal observed in the non-sorted cells were performed and again expanded in-between the sorts. A fourth sort was performed for cells with a GFP expression equal to the lowest 5% of GFP signal observed in the non-sorted cells. After expansion, the cells were treated with 500nM 4-Hydroxytamoxifen (Sigma) to induce Cre-mediated recombination and to flox the boxB sites of the reporter construct and hence to revert the tethering. Thereafter a final sort was performed to select a cell population with a GFP expression equal to the highest 70% of GFP expressing cells. Transduction efficiency was measured by plating 10,000 cells on a 15-cm dish and selecting with G418 (Gibco). A control plate with 1,000 cells was also plated without selection. After 10 days, colonies were counted and transduction efficiency was calculated as the number of colonies on the selected plate divided by the total number of cells plated (10 times the number of colonies on the control plate).
|
| Growth protocol |
All mouse experiments presented here were carried out in diploid mouse embryonic stem cells (mESCs) that were derived from originally haploid HMSc2 termed AN3-128. The mESCs were cultivated without feeders in high-glucose-DMEM (Sigma-Aldrich) supplemented with 13.5% fetal bovine serum (Sigma-Aldrich), 2 mM L-glutamine (Sigma-Aldrich), 1x Penicillin-Streptomycin (Sigma-Aldrich), 1x MEM non-essential amino acid solution (Gibco), 1mM sodium pyruvate (Sigma-Aldrich), 50 mM β-mercaptoethanol (Merck) and in-house produced recombinant LIF. Human ORFtag experiments were carried out in RKO (activator screen, ATCC, CRL-2577) or HEK293 (repressor screen, ATCC, CRL-1573) and the cells were cultivated in high-glucose-DMEM (Sigma-Aldrich) supplemented with 10% fetal bovine serum (Sigma-Aldrich), 2 mM L-glutamine (Sigma-Aldrich), 1x Penicillin-Streptomycin (Sigma-Aldrich). Virus packaging cell lines, Lenti-X 293T (Takara), PlatinumE (Cell Biolabs) and PlatinumA (Cell Biolabs), were grown according to the manufacturer’s instructions. All cell lines were cultured at 37°C and 5% CO2 and regularly tested for mycoplasma contamination.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Genomic locations of ORFtag integrations were mapped using modified inverse-PCR followed by next generation sequencing (iPCR-NGS) protocol8. Genomic DNA was prepared by lysing cell pellets in lysis buffer (10 mM Tris-HCl pH 8.0, 5 mM EDTA, 100 mM NaCl, 1% SDS, 0.5 mg/ml proteinase K) at 55°C overnight. Following a 2-hour RNase A treatment (Qiagen, 100 mg/ml, 1:1,000 dilution) at 37°C, two extractions using phenol:chloroform:isoamyl alcohol and one extraction using chloroform:isoamyl alcohol were carried out.
The samples then underwent two separate digestion reactions (with up to 4 µg of genomic DNA) using NlaIII and MseI enzymes (NEB) at 37°C overnight, followed by purification using a Monarch PCR&DNA Cleanup Kit (NEB). Ring-ligation was carried out using T4 DNA ligase (NEB) at 16 °C overnight, followed by heat-inactivation (65°C, 15 min) and linearization using SbfI-HF (NEB) at 37°C for 2 h. The digests were then purified using a Monarch PCR&DNA Cleanup Kit (NEB) and amplified using firstly a nested PCR reaction with KAPA HiFi HotStart ReadyMix (Roche), and a specific primer pair (TGCAGGACCGGACGTGACTGGAGTTC*A, TGCAGGACGATGAGCAGAGCCAGAACC*A) for 16 cycles. After cleanup with AMPure XP Reagent (Beckman Coulter, 1:1 ratio beads:PCR), iPCR amplification was carried out with KAPA HiFi HotStart ReadyMix (Roche), and a specific primer pair (AATGATACGGCGACCACCGAGATCTACACGAGCCAGAACCAGAAGGAACTTGA*C, CAAGCAGAAGACGGCATACGAGAT [custom-barcode] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) for 18 cycles. Afterwards, amplified libraries were size selected for a range of 400-800 bp using SPRIselect beads (Beckman Coulter). NGS was performed on an Illumina NextSeq550 or llumina HiSeq 2500 sequencer according to the manufacturers’ protocols with custom first-read primer (1:1 mix of GAGTGATTGACTACCCGTCAGCGGGGGTCTTTCA and TGAGTGATTGACTACCCACGACGGGGGTCTTTCA).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Description |
mouse_activating_sorted_rep1_counts_same_strand.txt
mouse_activating_sorted_rep1_counts_rev_strand.txt
mouse_activating_screen_sorted_vs_unsorted.txt
|
| Data processing |
First, iPCR reads from sorted and background (non-selected) samples were trimmed using Trim galore (v0.6.0) with default parameters to remove Illumina adapters. Then, trimmed reads were aligned to the mm10 version of the mouse genome (mouse assays) or to the hg38 version of the human genome (human assays) using bowtie216 with default parameters (for paired-end sequenced samples, only first mate reads were considered), before removal of duplicated and low mapping quality reads (mapq<=30) using samtools (v1.9)17. Mapped insertions were assigned to the closest downstream exon junction – with a maximum distance of 200kb – based on GENCODE annotations of the mouse genome (vM25, mouse assays) or of the human genome (v43, human assays). Finally, insertion counts were aggregated per gene. Of note, only exons from protein-coding transcripts were considered, except for the first exon of each transcript, which might not contain splicing acceptor sites. Consequently, intronless genes – for which none of the isoforms contain a spliced intron – were not considered.
For each species, background replicates showed reproducible gene counts and therefore were merged, and genes with at least one insertion were considered as putatively tagged. Finally, genes showing significantly more insertions in sorted samples compared to merged background samples were identified using one-tailed fisher's exact test (alternative= "greater") on merged biological replicates. Of note, only genes with at least 3 unique insertions in sorted samples were considered. Obtained p-values were corrected for multiple testing using the FDR method and genes showing an FDR<0.001 and a log2 Odd Ratio≥1 were classified as hits.
Assembly: mm10 (mouse) and hg38 (human)
Supplementary files format and content: counts_same_strand files contains the genomic coordinates of all the insertion that were found in the sample, and the id of the assigned gene. In addition, the distance between the insertion and the exon that was used for assignment, as well as its position (number) inside the gene, are reported.
Supplementary files format and content: counts_rev_strand is similar to the previous (counts_same_strand) file, but report the assignment of reversed insetions. Used to compute strand bias.
Supplementary files format and content: The sorted_vs_unsorted.txt files contain, for each gene, the unique insertions enrichment in sorted vs unsorted samples (log2OR) with the associated FDR (padj). In this study, all genes with a FDR<0.001 were considered as hits (see "hit" column).
Library strategy: ORFtag
|
| |
|
| Submission date |
Aug 07, 2023 |
| Last update date |
May 10, 2024 |
| Contact name |
Alexander Stark |
| E-mail(s) |
stark@starklab.org
|
| Organization name |
The Research Institute of Molecular Pathology (IMP)
|
| Lab |
Stark Lab
|
| Street address |
Campus-Vienna-Biocenter 1
|
| City |
Vienna |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL21626 |
| Series (2) |
| GSE225972 |
Proteome-scale tagging and functional screening in mammalian cells by ORFtag |
| GSE240282 |
Proteome-scale tagging and functional screening in mammalian cells by ORFtag [ORFtag] |
|
| Relations |
| BioSample |
SAMN36877143 |
| SRA |
SRX21285798 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
