|
| Status |
Public on Sep 13, 2023 |
| Title |
CT_GC-BuOE_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Cortex
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
Sex: male
tissue: Cortex
treatment: ground control
treatment: BuOE
slide id: GC_TX_2
roi number: 004
segment type: Full
area: 208860
nuclei_counts: 544
roi x coordinate: 18883
roi y coordinate: 9714
rawreads: 13851216
alignedreads: 13357811
deduplicatedreads: 609605
trimmedreads: 13804018
stitchedreads: 13718750
sequencingsaturation: 95.4
|
| Treatment protocol |
Mice were launched at the Kennedy Space Center (KSC) and spent 35 days aboard the international space station (ISS). All mice were maintained at an ambient temperature of 26–28 °C with a 12-hour light/dark cycle during the flight. All mice were provided NASA Nutrient-upgraded Rodent Food Bar (NuRFB) and autoclaved deionized water ad libitum. MnTnBuOE-2-PyP5+ (BuOE) at 1 mg/kg (0.2 mL) was administrated subcutaneously 7 days prior to the flight launch and weekly aboard the ISS. All mice were subdivided into saline or BuOE treated groups. Upon return to the Earth, spaceflight mice were transported to the research laboratory at Roskamp Institute, Sarasota, Florida within 20 hours of splashdown. Mice were exsanguinated by closed-cardiac blood collection under deep Ketamine/Xylazine (150/45 mg/kg) anesthesia, followed by cervical dislocation as a secondary euthanasia method to ensure death. Ground control mice were maintained on Earth for 35 days in flight hardware cages under similar environmental conditions as the flight groups, including the same food, light/dark, temperature, treatment (SAL or BuOE), and euthanasia regimens. The protocol for GC mice commenced three days subsequent to the commencement of the protocol for spaceflight mice.
|
| Growth protocol |
Ten-week-old C57BL/6 male mice.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
After sacrifice, mouse brains were then removed and prepared as follows. The left hemibrains were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 24 hours and then rinsed and washed with PBS for immunohistochemistry (IHC) assays or spatial genomics profiling. The right brains were flash-frozen and stored at −80 °C for further analysis. The study was approved by the Institutional Animal Care and Use Committee (IACUC) of Loma Linda University (LLU), Roskamp Institute, and The National Aeronautics and Space Administration (NASA).
Each collection of oligo tags from one well (representing an ROI from the tissue section) was indexed with i7xi5 unique dual indexes using GeoMx SeqCode primers with 18 cycles of PCR. After PCR, indexed AOIs were pooled and purified in two rounds of AMPure XP PCR purification using 1.2x bead:sample ratio.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
DSP-1001460001002-B-B05
Samples were pooled during library preparation and split across lanes. Individual FASTQ files were generated for each lane, forward & reverse primers. The Fastq files contain the same identifier as the sample name for aggregation.
|
| Data processing |
dcc-metadata = true
save-interim-files = false
quality-trim-score = 20
2color-trimming = True
adapter1 = AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
adapter2 = AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
adapter-trim-match-length = 10
adapter-trim-max-mismatch = 3
barcode-max-mismatch = 1
stitching-max-mismatch = 2
dedup-hd = 1
threads = 4
Assembly: NA
Supplementary files format and content: Digital count conversion (DCC) files produced by Nanostring's GeoMx NGS pipeline
Supplementary files format and content: Files ending in "GeneExpression_Q3norm.txt" give Q3-normalized gene expression of the indicated brain region. TX=BuOE treatment; SAL=Saline treatment; FLT=spaceflight mice; GC=Grounded Control mice.
Supplementary files format and content: Files ending in "DEanalysis.txt" are thre results of the differential expression analysis output by the GeoMx DSP Control Center. GCvsFLT-SAL=GC-SAL vs. FLT-SAL; SALvsBuOE-FLT=FLT-BuOE vs. FLT-SAL; SALvsBuOE-GC=GC-BuOE vs. GS-SAL; BuOE=BuOE treatment; SAL=Saline treatment; FLT=spaceflight mice; GC=Grounded Control mice.
Library strategy: GeoMx-Seq
|
| |
|
| Submission date |
Jul 26, 2023 |
| Last update date |
Sep 13, 2023 |
| Contact name |
Isaac Jacob Kremsky |
| E-mail(s) |
ikremsky@llu.edu
|
| Phone |
4044368914
|
| Organization name |
Loma Linda University
|
| Department |
Basic Sciences
|
| Street address |
11175 Campus St., Chan Shun Pavilion, Room A1022
|
| City |
Loma Linda |
| State/province |
CA |
| ZIP/Postal code |
92350 |
| Country |
USA |
| |
|
| Platform ID |
GPL24247 |
| Series (1) |
| GSE239336 |
Spaceflight-induced gene expression profiles in the mouse brain are attenuated by treatment with the antioxidant BuOE |
|
| Relations |
| BioSample |
SAMN36716320 |
| SRA |
SRX21164695 |
