 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 01, 2023 |
| Title |
HRDE-1, hrde-2 (adult) - input, replicate 1 |
| Sample type |
SRA |
| |
|
| Source name |
Whole worm
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
tissue: Whole worm
antibody: none
strain: USC1465 - hrde-1(tor125[GFP::3xFLAG::hrde-1]) III; hrde-2/enri-3(qe20) V
Stage: 1-day-old adult
temperature: 20°C
fraction: Input
|
| Growth protocol |
Sychronized animals were grown on enriched peptone plates seeded with OP50 E. coli at 20°C for 68 hours post-hatching (for 1-day-old adults ).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For immunoprecipitation, ~100,000 synchronized 1-day-old adult animals were collected in IP Buffer (50 mM Tris-Cl pH 7.4, 100 mM KCl, 2.5 mM MgCl2, 0.1% Igapal CA-630, 0.5 mM PMSF, cOmplete Protease Inhibitor Cocktail, and RNaseOUT Ribonuclease Inhibitor), frozen in liquid nitrogen, and homogenized using a mortar and pestle. After further dilution into IP buffer (1:10 packed worms:buffer), insoluble particulate was removed by centrifugation and a sample was taken as “input.” The remaining lysate was used for the immunoprecipitation. Immunoprecipitation was performed at 4°C for 1 hour, then washed at least 3 times in immunoprecipitation buffer. Trizol reagent was added to the remainder of each sample, followed by chloroform extraction, and isopropanol precipitation.
Small RNAs (18 to 30-nt) were size selected on denaturing 15% polyacrylamide gels from total RNA samples. Small RNAs were treated with 5’ RNA polyphosphatase and ligated to 3’ pre-adenylated adapter with Truncated T4 RNA ligase. Small RNAs were then hybridized to the TruSeq reverse transcription primer, ligated to the 5’ adapter with T4 RNA ligase), and reverse transcribed with Superscript III. Small RNA libraries were amplified using Q5 High-Fidelity DNA polymerase and size selected on a 10% polyacrylamide gel. Library concentration was determined using the Qubit 1X dsDNA HS Assay kit and quality was assessed using the Agilent BioAnalyzer.
small RNA-seq
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
size-selected small RNA
|
| Data processing |
Small RNA libraries were sequenced on the Illumina NextSeq500 (SE 75-bp reads) platform.
Sequences were parsed from adapters using FASTQ/A Clipper (options: -Q33 -l 17 -c -n -a TGGAATTCTCGGGTGCCAAGG) and quality filtered using the FASTQ Quality Filter (options: -Q33 -q 27 -p 65) from the FASTX-Toolkit
Contamination from reads mapping to 18-mer and 28-mer size standards were filtered out using Cutadapt (version 3.4)
Filtered reads were mapped to the C. elegans genome WS258 using Bowtie2 v. 2.5.0 (default parameters)
Reads were assigned to genomic features using featureCounts (options: -t exon -g gene_id -O --fraction –largestOverlap) which is part of the Subread v. 2.0.1 package.
Assembly: WS258
Supplementary files format and content: Processed data files are tab-delimited text files including total reads mapping to each gene generated by FeatureCounts.
|
| |
|
| Submission date |
Jul 26, 2023 |
| Last update date |
Aug 01, 2023 |
| Contact name |
Carolyn Marie Phillips |
| E-mail(s) |
cphil@usc.edu
|
| Organization name |
University of Southern California
|
| Department |
Biological Sciences
|
| Lab |
Phillips
|
| Street address |
1050 Childs Way, RRI 201
|
| City |
Los Angeles |
| State/province |
CA |
| ZIP/Postal code |
90089 |
| Country |
USA |
| |
|
| Platform ID |
GPL19757 |
| Series (2) |
| GSE239289 |
Germ granule association drives small RNA specificity for a nuclear Argonaute protein [sRNA-seq] |
| GSE239291 |
Germ granule association drives small RNA specificity for a nuclear Argonaute protein |
|
| Relations |
| BioSample |
SAMN36714618 |
| SRA |
SRX21162832 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7662711_7_HRDE1-hrde2-Input1_2-2.txt.gz |
1.4 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
