|
| Status |
Public on Sep 08, 2023 |
| Title |
H3K27ac_YAP1_11_(230410_SH_Mm_K27ac_Y11_0401) |
| Sample type |
SRA |
| |
|
| Source name |
FFPE-CUTAC
|
| Organism |
Mus musculus |
| Characteristics |
antibody: H3K27ac Abcam cat# ab4729
cell type: mouse brain tumor FFPE
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
FFPE_90deg.pdf
CUT&Tag uses tagmentation in which the barcoded adapters are integrated on both sides of the insert, so that the DNA that is released is already a barcoded library. PMID:31036827
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
Biological replicates and double (except pAG-Tn5), see FFPE_90deg.pdf
|
| Data processing |
Genome_build: mm10
1. We used cutadapt 2.9 with parameters "-j 8 --nextseq-trim 20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Z" to trim adapters from 50bp paired-end reads. 2. We used Bowtie2 2.4.4 with options "--very-sensitive-local --soft-clipped-unmapped-tlen --dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to map the paired-end 50bp reads to the repeat-masked mm10 Mus musculus reference sequence obtained from UCSC. 3. We used samtools 1.14 "view" to extract properly paired reads from the mm10 alignments. 4. We used bedtools 2.30.0 "genomecov" to make a normalized count mm10 track which is the fraction of counts at each base pair scaled by the size of the mm10 reference sequence (2725537669) so that if the counts were uniformly distributed across the reference sequence there would be one at each position (Supplementary file .mm10.bw)
|
| |
|
| Submission date |
Jun 26, 2023 |
| Last update date |
Sep 08, 2023 |
| Contact name |
Jorja Henikoff |
| E-mail(s) |
jorja@fhcrc.org
|
| Phone |
206-667-4850
|
| Organization name |
Fred Hutchinson Cancer Research Center
|
| Department |
Basic Sciences
|
| Lab |
Henikoff
|
| Street address |
1100 Fairview AV N, A1-162
|
| City |
Seattle |
| State/province |
WA |
| ZIP/Postal code |
98109-1024 |
| Country |
USA |
| |
|
| Platform ID |
GPL30172 |
| Series (1) |
| GSE235876 |
Epigenomic analysis of Formalin-Fixed Paraffin-Embedded samples by CUT&Tag |
|
| Relations |
| BioSample |
SAMN35993368 |
| SRA |
SRX20787234 |
