 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 31, 2023 |
| Title |
ChIP T NotoPdiff |
| Sample type |
SRA |
| |
|
| Source name |
in vitro differentiated cell cultures
|
| Organism |
Mus musculus |
| Characteristics |
tissue: in vitro differentiated cell cultures
cell line: genetically modified F1G4 (C57BL/6N x SV129) mES cells
cell type: in vitro generated notochord progenitor-like cells
genotype: TRE::Foxa2-IRES-EGFP (Rosa26 locus); T::H2B-mCherry-T2A-irTA (BAC); Noto::H2B-mTurquoise (BAC)
treatment: Crosslinking was performed directly on differentiating cells in growth medium with the addition of 1/10th volume of crosslinking solution (11% formaldehyde, 100mM NaCl, 1mM EDTA pH8, 0.5mM EGTA pH8, 50mM Hepes pH7.8) for 10 minutes at room temperature, with the dishes placed on a shaker. The crosslinking reaction was quenched with the addition of 1/10th volume of 2.5M glycine and 5 minutes incubation. Dishes were placed on ice or in a 4°C cold room and washed twice with cold PBS. Cells were scraped and washed off using cold PBS, containing 0.05% Triton X-100 to break the surface tension. Cells were pooled in aliquots of ~30-50x10^6 in Eppendorf tubes, snap frozen and stored at -80°C until sonication.
|
| Growth protocol |
To initiate NotoP differentiation, ESCs were removed from feeders by dissociation using 0.05% trypsin and then plated onto tissue culture plates for four short successive periods (25’, 20’, 15’, 10’) to remove feeders. To induce differentiation, a protocol slightly modified from Gouti et al. was used. In short, cells were plated on CellBINDSurface dishes precoated with 0.1% gelatin at a density of 1 x 104 cells per cm2 in a medium consisting of ‘N2B27’ medium, supplemented with 10 ng/ml bFGF for 3 days (d1-d3). From d2-d4 µM CHIR99021 was added to the medium. For induction of Foxa2 expression, 1ng/ml doxycycline was applied from d2-d4.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
For sonication, complete protease inhibitors without EDTA (Roche) at 1x final concentration was added to all lysis buffers (LB) prior to use. Each pellet was resuspended in LB1 (50mM Hepes pH7.5, 140mM NaCl, 1mM EDTA pH8, 10% glycerol, 0.75% NP-40, 0.25% triton X-100) and rotated at 4°C for 20 minutes. The cell suspension was homogenized using a douncer with a tight pestle with 3x 15 strokes, with short resting times on ice in between. The chromatin was pelleted by centrifugation at 1400g and 4°C for 5 minutes and resuspended in 2.5ml LB2 (200mM NaCl, 1mM EDTA pH8, 0.5mM EGTA pH8, 10mM Tris pH 8) per cell pellet. After 10 minutes rotation at 4°C, the centrifugation step was repeated and each pellet was resuspended in 1.5ml LB3 (1mM EDTA pH8, 0.5mM EGTA, 10mM Tris pH8, 100mM NaCl, 0.1% Na-deoxycholate, 0.5% N-lauroylsarcosine), transferred to 15ml Falcon tubes and sonicated using a W-450D Digital Sonifier (Branson) sonicator for 14 cycles of 10s on/50s off in a 4°C coldroom with tubes chilled in ice water. After sonication, 150ul of triton X-100 was added per tube, transferred to two 1.5ml Eppendorf tubes and debris was pelleted by centrifugation at 20,000g and 4°C for 10 minutes. The solubilized chromatin was then pooled and mixed thoroughly. After taking 50ul as an input control, the chromatin was distributed into 1.5ml aliquots, snap frozen and stored at -80C until use. For ChIP, 25ul of protein-coated Dynal beads (Life Technologies) were washed 3x using 1ml of blocking solution (PBS containing 0.5% BSA), resuspended in 500ml of blocking solution together with approximately 2.5ug antibody and rotated overnight at 4C. The antibodies used were a goat polyclonal anti-T (R&D, AF2085) and a rabbit polyclonal anti-Foxa2 (Diagenode, 2683-6041). The next day, three further washes using 1ml blocking buffer were performed and the beads were resuspended in 100ml blocking buffer. Chromatin equivalent to approximately 2x10^6 cells was added and rotated overnight at 4C. The following day, washing steps (8 and 9 washes for Foxa2 and T respectively) were performed using 1ml RIPA buffer (50mM Hepes pH7.6, 500mM LiCl, 1mM EDTA pH8, 1% NP-40, 0.7% Na-Deoxycholate) containing 1x complete protease inhibitors without EDTA and finally once with 1ml of TEN (10mM Tris pH8, 1mM EDTA pH8, 50mM NaCl). The immunoprecipates were eluted in two subsequent steps using 100ml of 1x elution buffer (50mM Tris pH8, 10mM EDTA pH8, 1% SDS) and incubation at 65C while shaking for 10 minutes each. The eluates were combined and incubated overnight (13h-15h) at 65C under agitation. The next day, 200ml of TE were added to dilute the SDS of the elution and the ChIPs were purified with two subsequent phenol:chloroform:isoamylalcohol (25:24:1, pH8) isolations and a MinElute (Qiagen) purification.
ChIP-Seq sequencing libraries were generated using the TrueSeq ChIP-Seq kit (Ilumina) following the manufacturer’s instructions with minor modifications. After adapter ligation, 0.95x of AMPure XP beads (Beckman Coulter A63880) were used for a single purification and the DNA was eluted using 15 µl of resuspension buffer (RSB, Illumina). After the addition of 1 µl primer mix (25 mM each, Primer 1: 5’-AATGATACGGCGACCACCGA*G-3’; Primer2: 5’- CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C, 5 cycles of [15 seconds at 98°C, 30 s at 63°C and 30 s at 72°C] and a final 1 min incubation at 72°C. The PCR products were purified using 0.95x of beads and eluted using 21 µl of RSB. Libraries were directly amplified for additional 13 cycles and purified using AMPure XP beads. The libraries were quantified using the Qubit DNA HS assay and the library size was validated using DNA HS bioanalyzer chips (Agilent 5067-4626).
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Prior to mapping, the forward and reverse reads were trimmed to 50bp using fastx_trimmer (http://hannonlab.cshl.edu/fastx_toolkit/index.html). Reads were mapped to chromosomes 1-19, X, Y and M of the mouse mm10 genome using bowtie version 1.3.1, providing the options ‘ -y -m 1 -S -I 100 -X 500’. The mapping information of the paired-end reads was used to elongate each fragment to its original size using a custom pearl script, with the result stored as a BED file. Reads were then sorted and deduplicated such that only one fragment with the same starting and end position was retained. For visualization, wiggle files were generated with BEDTools version 2.23.0, converted to bigwig format and visualized in the Integrated Genome Browser. Peak detection was performed using MACS version 3.0.0b1 (https://github.com/macs3-project/MACS) using the elongated and deduplicated bed files as inputs and setting a q-value cutoff of 0.1.
Assembly: mm10
Supplementary files format and content: *.bw: tag denisty files of ChIP data in bigWig format
Supplementary files format and content: *.narrowPeak: peak files for ChIP-Seq tracks used in analysis obtained by MACS
Supplementary files format and content: RNA_FPKM.txt: normalized per gene abundance measurements (FPKM) for RNA-Seq samples obtained by Cuffdiff
|
| |
|
| Submission date |
Jun 15, 2023 |
| Last update date |
Oct 31, 2023 |
| Contact name |
Frederic Koch |
| Organization name |
Max Planck Institute for Molecular Genetics
|
| Department |
Developmental Genetics
|
| Street address |
Ihnestraße 63-73
|
| City |
Berlin |
| ZIP/Postal code |
14195 |
| Country |
Germany |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE235030 |
Genome-wide identification of notochord enhancers comprising the regulatory landscape of the Brachyury (T) locus in mouse |
|
| Relations |
| BioSample |
SAMN35750878 |
| SRA |
SRX20687505 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7493459_ChIP_T_NotoPdiff.bw |
82.4 Mb |
(ftp)(http) |
BW |
| GSM7493459_ChIP_T_NotoPdiff.narrowPeak.gz |
170.2 Kb |
(ftp)(http) |
NARROWPEAK |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
