GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM7181257

Query DataSets for GSM7181257

Status

Public on Dec 29, 2023

Title

Lib144

Sample type

SRA

Source name

MCR-Lib

Organism

Mus musculus

Characteristics

cell line: MCR-Lib
cell type: Hybridoma
treatment: A2

Treatment protocol

MCR-Lib cells were co-cultured with a five-fold excess orphan TCR-expressing A2 cells in 96 well U-bottom plates at 1 x 105 total cells per well. After 12 hr, Ametrine-GFP+NFAT-Blue+ cells were sorted as described above and expanded. After six rounds of iterative co-culture and sorting, DNA was isolated from sorted reporter cells.

Extracted molecule

genomic DNA

Extraction protocol

DNA was isolated from MCR cells using the DNeasy Blood & Tissue Kit (Qiagen) with RNaseA (Qiagen) pre-treatment.
NGS libraries were prepared by a two-step PCR protocol. First, MCR peptide sequences were PCR amplified from 5 mg of genomic DNA using PCR1_MCR_F 5’- TCTTGTGGAAAGGACGAAACACCGGCTGCTGTGGTGGTGCTGATGG-3’ and PCR1_MCR_R 5’-TCTACTATTCTTTCCCCTGCACTGTCCGTTGGTGAAGTAGCACTC-3’ with NEBNext Ultra II Q5 Master Mix (NEB) in a 50 mL reaction for 15-35 cycles. Cycle counts necessary to reach but not exceed the linear range were determined by quantitative real time PCR (qRT-PCR) with SYBR Green Supermix (Bio-Rad). PCR products were pooled when multiple reactions were performed for the same sample, concentrated using DNA Clean & Concentrator (Zymo), and size selected by gel electrophoresis and extraction (Qiagen). Purified products were diluted and 1 ng of each sample was PCR amplified using unique barcoded sequencing adapters PCR2_Fx 5’- AATGATACGGCGACCACCGAGATCTACAC[barcode]ACACTCTTTCCCTACACGACGCTCTTCCGATCT[stagger]TCTTGTGGAAAGGACGAAACACCG-3’ and PCR_Rx 5’- CAAGCAGAAGACGGCATACGAGAT[barcode]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT[stagger]TCTACTATTCTTTCCCCTGCACTGT-3’ with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) for 16 cycles. Libraries were purified using AMPure XP Beads (Beckman Coulter), quantified by qRT-PCR using i5_F 5’- AATGATACGGCGACCACCGAGATCTACAC-3’ and i7_R 5’- CAAGCAGAAGACGGCATACGAGAT-3’, and pooled to equimolar ratios.

Library strategy

OTHER

Library source

genomic

Library selection

other

Instrument model

Illumina NextSeq 500

Data processing

Open reading frames (ORFs) were determined from raw FASTA files using orfipy (version 0.0.4)1 with a minimum length of 60 nt. MCR peptide sequences were extracted from ORFs as peptide sequences flanked by PRTE and SGGS amino acids using str_match from tidyverse (version 2.0.0).
Supplementary files format and content: comma seperated value file contains raw peptide counts for each Sample
Library strategy: amplicon seq

Submission date

Apr 17, 2023

Last update date

Dec 29, 2023

Contact name

Elliot Akama-Garren

Organization name

Harvard Medical School

Street address

200 Longwood Ave

City

Boston