|
| Status |
Public on Jun 26, 2023 |
| Title |
4aKO.4gHet.mTEClo.Thy#3 |
| Sample type |
SRA |
| |
|
| Source name |
Post-Aire mTEClo
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Thymus
strain: C57BL/6
genotype: Foxn1cre(+/-)Hnf4a(fl/fl)Hnf4g(+/-)
cell type: mTEClo
|
| Treatment protocol |
mTEC subsets were prepared by digesting thymi with collagenase and dispase, magnetically depleting CD45+ cells, staining with fluorescent antibodies and flow sorting subsets of interest into 5ul TCL buffer plus 1% 2-mercaptoethanol.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
1000 cells were cytofluorometrically sorted into 5ul TCL buffer (Qiagen) with 1% 2-mercaptoethanol (Sigma). Cells were double-sorted when cell numbers permitted. Total RNA was captured and purified on RNAClean XP beads (Beckman Coulter).
Total RNA was captured and purified on RNAClean XP beads (Beckman Coulter). Polyadenylated mRNA was then selected using an anchored oligo(dT) primer (5′–AAGCAGTGGTATCAACGCAGAGTACT30VN-3) and converted to cDNA via reverse transcription. First-strand cDNA was subjected to limited PCR amplification followed by Tn5 transposon-based fragmentation using the Nextera XT DNA Library Preparation Kit (Illumina). Samples were then PCR amplified for 18 cycles using barcoded primers such that each sample carried a specific combination of eight-base Illumina P5 and P7 barcodes and were pooled together prior to Smart sequencing. Smart-seq paired-end sequencing was performed on an Illumina NextSeq500 using 2 x 38bp reads with no further trimming.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Reads were mapped to the mouse reference genome (mm10) with STAR 2.7.3a
Non-uniquely mapped reads were discarded.
The uniquely mapped reads were assigned to genes using featureCounts with GENCODE annotation (vM25)
Assembly: mm10
Supplementary files format and content: raw read counts
|
| |
|
| Submission date |
Feb 20, 2023 |
| Last update date |
Jun 26, 2023 |
| Contact name |
CBDM Lab |
| E-mail(s) |
cbdm@hms.harvard.edu
|
| Phone |
617-432-7747
|
| Organization name |
Harvard Medical School
|
| Department |
Microbiology and Immunobiology
|
| Lab |
CBDM
|
| Street address |
77 Avenue Louis Pasteur
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02215 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE225659 |
Hnf4 controls gut and liver gene programs in the thymus [bulk_RNAseq] |
| GSE225661 |
Hnf4 controls gut and liver gene programs in the thymus |
|
| Relations |
| BioSample |
SAMN33386071 |
| SRA |
SRX19447673 |
