|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Apr 28, 2023 |
Title |
CHi-C of wt stembryos at 48h, rep3 |
Sample type |
SRA |
|
|
Source name |
stembryo
|
Organism |
Mus musculus |
Characteristics |
tissue: stembryo cell line: mES cells genotype: wt stage (in_hours_after_aggregation): 48
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Collected stembryos were pooled and fixed for 10 min in 1% formaldehyde at room temperature and stored at -80°C until further use. Lysis was performed with TissueLyser II and metallic beads for 30 sec at 30 hertz before incubation at 4° for 30 min. The rest of the protocol for the capture Hi-C library generation is described in (Bolt et al., 2021). The costume SureSelectXT RNA probe used for DNA capture covers the region chr2:72240000-76840000 (mm9).
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
wt_48h_CHiC_rep3
|
Data processing |
library strategy: Capture Hi-C All scripts are available on https://github.com/lldelisle/scriptsForRekaikEtAl2022 TruSeq adapters were removed with cutadapt (Martin et al 2011) version 1.16 (-a 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' -A 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT'). Trimmed reads were processed with HiCUP version 0.6.1 (doi: 10.12688/f1000research.7334.1) with default paramters on mm10 or on the corresponding mutant genome. The output BAM was converted to Juicebox format thanks to a custom python script available in https://testtoolshed.g2.bx.psu.edu/repository/download?repository_id=be5040251cd4afb7&changeset_revision=44365a4feb3b&file_type=gz Only pairs with both mates falling into the capture region (mm10:chr2:72402000-77000000) and with both mates with quality above 30 were kept. Filtered pairs were loaded into 2kb and 5kb matrices with cooler version 0.7.4 (Abdennur, N., and Mirny, L. (2019), https://doi.org/10.1093/bioinformatics/btz540). The matrices were balanced with cooler balance (--cis-only). For the mutant Del(subTAD1), the balancing was done with the option --ignore-diags 5 instead of --ignore-diags 2 to discard the bias due to the presence of a BAC containing the region (mm10:chr2:74747769-74913171). Assembly: mm10 for wt samples and Del(CBS*) samples and mutant genomes for Del(d1-d4) and Del(sub-TAD1) Supplementary files format and content: *_validPairs_*.txt.gz: all valid pairs from HiCUP in juicebox format (<readname> <str1> <chr1> <pos1> <frag1> <str2> <chr2> <pos2> <frag2> <mapq1> <mapq2> str = strand (0 for forward, anything else for reverse) pos = middle of the fragment) Supplementary files format and content: *_*kb_Balanced_*.cool: balanced matrix at 2 or 5kb-bins only in the captured region
|
|
|
Submission date |
Feb 09, 2023 |
Last update date |
Apr 29, 2023 |
Contact name |
Lucille Lopez-Delisle |
E-mail(s) |
lucille.delisle@epfl.ch
|
Organization name |
EPFL
|
Street address |
Station 19
|
City |
Lausanne |
ZIP/Postal code |
1015 |
Country |
Switzerland |
|
|
Platform ID |
GPL19057 |
Series (2) |
GSE205778 |
Sequential and directional insulation by conserved CTCF sites underlies the Hox timer in stembryos [cHi-C] |
GSE205783 |
Sequential and directional insulation by conserved CTCF sites underlies the Hox timer in stembryos |
|
Relations |
BioSample |
SAMN33219850 |
SRA |
SRX19320122 |
Supplementary file |
Size |
Download |
File type/resource |
GSM7035373_wt_48h_CHiC_rep3_2kb_Balanced_mm10.cool.gz |
7.2 Mb |
(ftp)(http) |
COOL |
GSM7035373_wt_48h_CHiC_rep3_5kb_Balanced_mm10.cool.gz |
3.9 Mb |
(ftp)(http) |
COOL |
GSM7035373_wt_48h_CHiC_rep3_validPairs_mm10.txt.gz |
559.1 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
Processed data are available on Series record |
|
|
|
|
|