 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 23, 2023 |
| Title |
MD47_10xPerf_MILI IP |
| Sample type |
SRA |
| |
|
| Source name |
Testes
|
| Organism |
Mus musculus |
| Characteristics |
immunoprecipitation: MILI IP
genotype: 10xPerf
mouse: Mouse-15175
|
| Growth protocol |
The reporters were created by inserting one or ten complementary binding sites for piR-A in the 3ʹ UTR of the Ythdc2 gene (MGI: 2448561; NCBI Gene: 240255). Binding sites were perfectly complementary or contained two mismatches at the 10th and 11th position relative to the guide RNA. Mismatched sites are referred to bulges. The first line contains one perfect complementary binding site (1XPerf), the second line contains one bulge binding site (1xBulge), the third line contains ten perfect complementary binding sites (10xPerf) and the fourth line contains ten bulge binding sites (10xBulge). Ythdc2 locus of the B6D2F1/J hybrid line (also called B6D2; The Jackson Laboratory, stock no. 100006) was targeted using CRISPR/Cas9 system.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from adult testes using TRIzol™ Reagent (Thermo Scientific, Cat. No. 15596026). Immunoprecipitation was conducted with Mili (PMID: 19465913) or Miwi antibodies (PMID: 22121019) and Protein G Sepharose® 4 Fast Flow beads (GE Healthcare, No. 17-0618-01) and Mili and Miwi loaded piRNAs were extracted using phenol-chloroform.
piRNA sequencing libraries were prepared with NEBNext® Multiplex Small RNA Library Prep Set for Illumina® (New England Biolabs, Ref. E7300L) and sequenced by NextSeq 500 platform (Illumina) in GeneCore(Heidelberg). The Stranded Total RNA Ribo-Zero Plus kit from Illumina was used for the library preparation from total RNA with 500 ng of total RNA as input. Library molarity and quality were assessed with the Qubit and Tapestation (DNA High sensitivity chip). Libraries were sequenced on a NovaSeq 6000 Illumina sequencer for SR100 reads (iGE3 Genomics Platform, University of Geneva).
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Reads from small RNA libraries were sorted into individual libraries based on the barcodes and the 3′ adapter sequences were clipped from the reads using cutadapt (DOI:http://dx.doi.org/10.14806/ej.17.1.200) with only sequences of at least 15 nucleotides left for further analysis (cutadapt parameters: -a AGATCGGAAGAGCACACGTCT -m 15 -e 0.2 -O 4 -q 10 --match-read-wildcards). The reads were then mapped to the mouse genome (GRCm38: Ensembl release 95) using STAR(Dobin et al., 2013) (with parameters: --runThreadN 10 -outFilterType BySJout --limitOutSJcollapsed 50000000 --limitIObufferSize 1500000000) and length distributions of the reads were plotted. Read counts were normalized to library sizes. To see whether any piRNAs are produced from the reporters, the reads were mapped by bowtie(Langmead et al., 2009) (with parameters: -v 0 -a --best --strata) to the Ythdc2 transcript sequence containing individual reporters: 1xPerf,1xBulge,10xPerf,10xBulge.
Reads from long RNA-seq libraries were mapped to the mouse genome (GRCm39 - Ensembl release 104) using salmon(Patro et al., 2017) (salmon quant with options -l A –validateMappings–gcBias). Further analysis was performed using R(R Core Team, 2017) and Bioconductor(Huber et al., 2015). The DESeq2(Love et al., 2014) package was used to obtain normalized read counts for individual genes.
Assembly: GRCm38(small RNA libraries) and GRCm39 (total RNA libraries)
Supplementary files format and content: The bigwig files contain piRNA coverages along the genome. The csv file contains gene expression data.
|
| |
|
| Submission date |
Dec 01, 2022 |
| Last update date |
Oct 23, 2023 |
| Contact name |
Ramesh Pillai |
| E-mail(s) |
ramesh.pillai@unige.ch
|
| Organization name |
University of Geneva
|
| Department |
Department of Molecular Biology
|
| Street address |
30, Quai Ernest-Ansermet
|
| City |
Gneveva |
| ZIP/Postal code |
CH-1211 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE219200 |
In vivo PIWI slicing in mouse testes deviates from rules established in vitro |
|
| Relations |
| BioSample |
SAMN31977774 |
| SRA |
SRX18456148 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6777749_minus_MD47_Aligned.out.sort.bw.gz |
29.7 Mb |
(ftp)(http) |
BW |
| GSM6777749_plus_MD47_Aligned.out.sort.bw.gz |
29.4 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
