|
| Status |
Public on Apr 11, 2023 |
| Title |
CD34+ HSPCs, day 4 under VPA treatment, mRNA-derived cDNA |
| Sample type |
SRA |
| |
|
| Source name |
Umbilical cord blood
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: Umbilical cord blood
cell type: CD34+ Hematopoietic Stem and Progenitor Cells (HSPCs)
library type: RNA
antibodies/tags: none
|
| Treatment protocol |
Following priming for 16 hours with cytokines, cells were exposed to 1mM VPA (Sigma-Aldrich).
|
| Growth protocol |
Highly purified (90%–98%) CD34+ cells were seeded at a density of 3.3×104 cells/mL in StemSpan SFEM II (StemCell Technologies) culture medium containing 1% penicillin-streptomycin (Life Technologies) supplemented with 150 ng/mL human stem cell factor (SCF), 100 ng/mL human fms-like tyrosine kinase receptor 3 (FLT3 ligand), 100 ng/mL human thrombopoietin (TPO), and 50 ng/mL human interleukin 3 (IL-3) (R&D Systems)
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Mononuclear cells were isolated by Ficoll-Hypaque (GE Healthcare) density centrifugation, and CD34+ cells were purified by immunomagnetic sorting using the CD34 Microbead kit (Miltenyi) and the AutoMACS Pro Separator (Miltenyi).
Library was prepared using Chromium Single Cell 3ʹ v2 protocol (10x Genomics). Cellular mRNA and antibody-derived oligos were reverse-transcribed and indexed with a shared cellular barcode. Indexed cDNAs were then pooled and amplified by PCR according to the Chromium Single Cell 3’ v2 protocol (10x Genomics) and with specific primers amplifying the antibody-derived tags. SPRI bead size selection was performed in order to separate both the mRNA-derived cDNA (>300bp) and the antibody-derived tagged cDNAs (180bp). For the mRNA derived cDNA library preparation, we further proceeded according to the manufacturer’s instructions for Single Cell 3’ v2 protocol (10x Genomics). For antibody-derived tagged library, we used the KAPA HiFI HotStart Library Amplification Kit (Roche) with the following primers and amplification program:
-CITE-seq library: amplification was performed at 95°C for 3’ followed by ten cycles at 95°C f¬¬or 20’’; 60°C for 30’’; 72°C for 20’’ and final elongation 72°C for 5’ with 5’-CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3’ Small RNA RPI1 primer as i7 primer (Illumina).
The following 5’- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3’ SI-PCR primer as i5 primer (Illumina) was used for both CITE-seq library amplification.
Following the final bead purification, all three libraries were pooled as 80% mRNA library and 20% ADT library before sequencing.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
3' mRNA library: read1 file contains cell barcode and UMI; read2 file contains transcript
poly A RNA
|
| Data processing |
Pre-processing of sequencing results to generate count matrices (gene expression and ADT barcode counts) was performed using the 10x genomics Cell Ranger pipeline where ADT were concatenated and treated as Custom library with default settings (v3.0.2) and aligning to the hg19 genome build and Ensembl 105 annotations.
Further processing was done with Seurat v4.1.1 (cell and gene filtering, hashtag identification, clustering, cell cycle analysis).
Assembly: hg19
Supplementary files format and content: 10x Genomics output files: barcodes.tsv.gz, features.tsv.gz, matrix.mtx.gz
Library strategy: CITE-seq (Cellular Indexing of Transcriptomes and Epitopes by sequencing)
|
| |
|
| Submission date |
Nov 18, 2022 |
| Last update date |
Apr 11, 2023 |
| Contact name |
Tiphaine Christiane Martin |
| E-mail(s) |
tiphaine.martin@mssm.edu
|
| Phone |
2128248403
|
| Organization name |
Icahn School of Medicine at Mount Sinai, Tisch Cancer Institute
|
| Department |
Oncological Sciences
|
| Lab |
Parsons
|
| Street address |
1470 Madison Ave
|
| City |
New York |
| State/province |
75459 |
| ZIP/Postal code |
10029 |
| Country |
USA |
| |
|
| Platform ID |
GPL20301 |
| Series (1) |
| GSE218359 |
CD34+ HSPC CITE-seq for day 0 and Day 1 and Day 4 under VPA |
|
| Relations |
| BioSample |
SAMN31792234 |
| SRA |
SRX18313016 |
