|
| Status |
Public on Nov 10, 2023 |
| Title |
U937 cells, MLL knockout, rep 1 |
| Sample type |
SRA |
| |
|
| Source name |
U-937
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: U-937
cell type: Monocytes
disease: Acute Myeloid Leukemia
genotype: MLL knockout
treatment: CRISPR sgRNA lentiviral transduction
|
| Treatment protocol |
Cells were transduced with CRISPR sgRNA lentivirus targeting MLL, CSNK2A1, SGF29 or non-targeting control. Puromycin (1ug/ul) was added 2 days after to select for transduced cells and removed from the culture upon selection completion.
Cells were harvested by centrifugation 7 days after puromycin removal and washed with 1X PBS and protease inhibitors.
|
| Growth protocol |
Cells were cultured in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum, 2mM Glutamine and 100 U/ml penicillin/streptomycin in a humidified atmosphere with 5% CO2 at 37C.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
RNA was extracted using the Rneasy Mini Kit (Qiagen) and 900ng of total RNA per sample were used for library preparation.
RNA library prep was performed with the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) follownig the manufacturer's instructions.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
MLL1
TPM_MLL-CK2-NTC.xlsx
|
| Data processing |
Raw reads were preprocessed by trimming Illumina Truseq adapters, polyA, and polyT sequences using cutadapt v2.3 with parameters “cutadapt -j 4 -m 20 --interleaved -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Fastq1 Fastq2 | cutadapt --interleaved -j 4 -m 20 -a "A{100}" -A "A{100}" - | cutadapt -j 4 -m 20 -a "T{100}" -A "T{100}" -”.
Trimmed reads were subsequently aligned to human genome version hg38 using STAR aligner v2.7.0d_0221 with parameters according to ENCODE long RNA-seq pipeline.
Gene expression levels were quantified using RSEM v1.3.1. Ensembl v84 gene annotations were used for the alignment and quantification steps. RNA-seq sequence, alignment, and quantification qualities were assessed using FastQC v0.11.5 and MultiQC v1.8. Lowly expressed genes were filtered out by retaining genes with estimated counts (from RSEM) ≥ number of samples times 5.
Assembly: hg38
Supplementary files format and content: tab-delimited text files include TPM values for each Sample.
|
| |
|
| Submission date |
Nov 10, 2022 |
| Last update date |
Nov 10, 2023 |
| Contact name |
Karina Ofelia Barbosa Guerra |
| E-mail(s) |
karinabarbosa4@gmail.com, adeshpande@sbpdiscovery.org
|
| Organization name |
Sanford Burnham Prebys Medical Discovery Institute
|
| Department |
Tumor Initiation & Maintenance Program
|
| Lab |
Deshpande
|
| Street address |
10901 North Torrey Pines Rd, Deshpande Lab RM6210B
|
| City |
La Jolla |
| State/province |
CA |
| ZIP/Postal code |
92037 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (2) |
| GSE217776 |
Effect of CRISPR knockout of MLL, CSNK2A1 and SGF29 on gene expression profiles in acute myeloid leukemia U937 cells [RNA-seq] |
| GSE217829 |
Epigenetic regulator landscape of HOX/MEIS expression in AML |
|
| Relations |
| BioSample |
SAMN31687129 |
| SRA |
SRX18235693 |
