 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 01, 2024 |
| Title |
Ab_sample8 |
| Sample type |
SRA |
| |
|
| Source name |
Heart
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: Heart
cell type: Cardiac Cells
library type: ADT
antibodies/tags: TotalSeq A 277 panel (BioLegend) antibody cocktail + two custom oligo-tagged antibodies (anti-FAP and anti-LRRC15)
|
| Extracted molecule |
protein |
| Extraction protocol |
Fresh cardiac left ventricular tissue from ex-planted hearts at the time of transplantation, LVAD cores, or donors declared DCD were harvested and perfused. Tissues were minced and digested. After incubating with the TotalSeq A 277 panel (BioLegend) antibodies with custom oligo-labeled FAP and LRRC15 antibodies, single cells were isolated and counted before proceeding with the 10x protocol.
Collected cells were processed using the single Cell 3’ Kit v 3.1 (10x Genomics PN: 1000268). Single-cell libraries were prepared using the single Cell 3’ Kit v 3.1 following a modified 3’ v3.1 assay protocol (User Guide CG000206) to concurrently prepare gene expression and TotalSeq A antibody derived tag (ADT) libraries as recommended by BioLegend. 1 ul of 0.2uM ADT Additive Primer (CCTTGGCACCCGAGAATT*C*C) and 15 ul of cDNA Primers (PN: 2000089) were used to amplify cDNA. ADT libraries were amplified with a final concentration of 0.25 uM SI Primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC*T*C) and 0.25 uM TrueSeq Small RNA RPI primer (CAAGCAGAAGACGGCATACGAGAT[6nt index]GTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A) using 15 cycles. Gene expression libraries were indexed using Single Index Kit T Set A (PN: 2000240). Libraries were sequenced on a NovaSeq 6000 S4 flow cell (Illumina).
|
| |
|
| Library strategy |
OTHER |
| Library source |
other |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
Antibody-derived oligonucleotide library: read1 file contains cell barcode and UMI; read2 file contains Antibody Derived Tag reads
Antibody-derived oligonucleotide (ADT)
|
| Data processing |
Raw fastq files were aligned to the human GRCh38 reference genome (v) using CellRanger (10x Genomics, v6) with the antibody capture tag for the TotalSeqA 277 + two custom oligo-tagged antibodies.
Protein reads were normalized and de-noised using the dsb package in R v4. Subsequent quality control, normalization, dimensional reduction, and clustering was performed in Seurat v4.0. Clusters were annotated using canonical gene and protein markers.
Assembly: GRCh38
Supplementary files format and content: celll.metadata.csv contains meta information of all samples with cells in rows and labels in columns; 10x Genomics output files: barcodes.tsv.gz, features.tsv.gz, matrix.mtx.gz
Library strategy: CITE-seq (Cellular Indexing of Transcriptomes and Epitopes by sequencing)
|
| |
|
| Submission date |
Nov 07, 2022 |
| Last update date |
Jul 01, 2024 |
| Contact name |
Xin Luo |
| E-mail(s) |
xluo01@amgen.com
|
| Organization name |
Amgen Inc
|
| Department |
Research and Development
|
| Street address |
750 Gateway Blvd
|
| City |
South San Francisco |
| State/province |
CA |
| ZIP/Postal code |
94080 |
| Country |
USA |
| |
|
| Platform ID |
GPL24676 |
| Series (2) |
| GSE217494 |
Targeting Immune-Fibroblast Crosstalk in Myocardial Infarction and Cardiac Fibrosis I |
| GSE218392 |
Targeting Immune-Fibroblast Crosstalk in Myocardial Infarction and Cardiac Fibrosis |
|
| Relations |
| BioSample |
SAMN31648510 |
| SRA |
SRX18201506 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
