GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Sample GSM670046 Query DataSets for GSM670046
Status Public on Mar 31, 2011
Title Bisulfite-Seq analysis of RRBS510 derived from human Fib 20 cells; RRBS510
Sample type SRA
Source name human primary fibroblasts; RRBS510
Organism Homo sapiens
Characteristics sample alias: hFib_20_p7
sample common name: Primary Fibroblast Cell Line
lineage: mesoderm
medium: 10% KOSR (Invitrogen)
molecule: genomic DNA
disease: none
passage: 7
line: Fib 20
differentiation_method: NA
batch: NA
biomaterial_type: Cell Line
differentiation_stage: undifferentiated
Sex: Male
biomaterial_provider: Harvard University
bisulfite_conversion_protocol: 2x5hrs Epitect Kit
dna_preparation_initial_dna_qnty: 20 ng
extraction_protocol_sonication_cycles: NA
dna_preparation_adaptor_ligation_protocol: T4 Ligase (2,000U/ul) 16C o/n
library_generation_pcr_r_primer_sequence: 5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
dna_preparation_post-ligation_fragment_size_selection: 130-250/180-350
bisulfite_conversion_percent: >99%
extraction_protocol: Standard Protocol (Smith et al., Methods 48, 226-232)
library_generation_pcr_primer_conc: 25uM
dna_preparation_fragment_size_range: 40-160/90-260
experiment_type: DNA Methylation
library_generation_pcr_thermocycling_program: Smith et al., Methods 48, 226-232
library_generation_pcr_product_isolation_protocol: Gel size selection
library_generation_pcr_template_conc: NA
library_generation_pcr_polymerase_type: Pfu Turbo Cx hot start
library_generation_pcr_number_cycles: 15
extraction_protocol_type_of_sonicator: NA
Extracted molecule genomic DNA
Extraction protocol Library construction protocol: Smith et al., Methods 48, 226-232
Library strategy Bisulfite-Seq
Library source genomic
Library selection Reduced Representation
Instrument model Illumina Genome Analyzer IIx
Description sample_term_id: CL_0000057
assay_term_id: OBI_0001862
nucleic_acid_term_id: SO_0000352
Design description: RRBS REMC Sequencing on Illumina
Library name: RRBS510
EDACC Genboree Experiment Page:
EDACC Genboree Sample Page:
For data usage terms and conditions, please refer to:
Data processing **********************************************************************

ANALYSIS FILE NAME: GSM670046_BI.Primary_Fibroblast.RRBS.RRBS510-511.wig
ANALYSIS ALIAS: RRBS510-RRBS511.hg19.level.2
ANALYSIS TITLE: Methylation Proportion Graphs of Primary Fibroblast Cell Line RRBS Data
ANALYSIS DESCRIPTION: Illumina RRBS read mappings from the Primary Fibroblast Cell Line, Libraries RRBS510-511 were processed into graphs of methylation proportions. Methylation proportions were calculated as (methylated calls / (methylated calls + unmethylated calls)) for all CpGs covered by at least 4 reads.
EDACC Genboree Analysis Page:
EXPERIMENT_TYPE: Reduced Representation Bisulfite-Seq
GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19 MspI restriction fragments 40-220bp
SOFTWARE: In house programs and scripts
GENOMIC_WINDOW: 2bp containing CpGs
RELEASE_NUMBER: Human Epigenome Atlas 3
BROWSER_TRACK_DESCRIPTION: BI Primary Fibroblast Cell Line RRBS Libraries RRBS510-511 EA Release 3


Submission date Feb 07, 2011
Last update date May 15, 2019
Organization name Broad Institute
Street address -
City Cambridge
State/province MA
ZIP/Postal code 02142
Country USA
Platform ID GPL10999
Series (1)
GSE25247 BI Human Reference Epigenome Mapping Project: Characterization of DNA methylation by RRBS in human subject
SRA SRX041092
BioSample SAMN00205691
Named Annotation GSM670046_BI.Primary_Fibroblast.RRBS.RRBS510-511.wig.gz

Supplementary file Size Download File type/resource
GSM670046_BI.Primary_Fibroblast.RRBS.RRBS510-511.wig.gz 12.8 Mb (ftp)(http) WIG
SRA Run SelectorHelp
Raw data not provided for this record
Processed data provided as supplementary file
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap