NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM669901 Query DataSets for GSM669901
Status Public on Mar 31, 2011
Title Bisulfite-Seq analysis of RRBS747 derived from human H9 cells; RRBS747
Sample type SRA
 
Source name H9 (WA09) embryonic stem cells; NIH Approval # NIHhESC-10-0062; RRBS747
Organism Homo sapiens
Characteristics sample alias: hES_H9_p58
sample common name: H9 Cell Line
lineage: embrionic stem cell
medium: 10% KOSR (Invitrogen)
molecule: genomic DNA
disease: none
passage: 58
line: H9
differentiation_method: NA
batch: NA
biomaterial_type: Cell Line
differentiation_stage: undifferentiated
Sex: Female
biomaterial_provider: Harvard University
bisulfite_conversion_protocol: 2x5hrs Epitect Kit
dna_preparation_initial_dna_qnty: 20 ng
extraction_protocol_sonication_cycles: NA
dna_preparation_adaptor_ligation_protocol: T4 Ligase (2,000U/ul) 16C o/n
dna_preparation_adaptor_sequence: 5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG and 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_generation_pcr_r_primer_sequence: 5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
dna_preparation_post-ligation_fragment_size_selection: 160-250/190-400
bisulfite_conversion_percent: >99%
extraction_protocol: Standard Protocol (Smith et al., Methods 48, 226-232)
library_generation_pcr_primer_conc: 25uM
dna_preparation_fragment_size_range: 40-130/70-280
experiment_type: DNA Methylation
library_generation_pcr_thermocycling_program: Smith et al., Methods 48, 226-232
library_generation_pcr_product_isolation_protocol: Gel size selection
library_generation_pcr_f_primer_sequence: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_generation_pcr_template_conc: NA
library_generation_pcr_polymerase_type: Pfu Turbo Cx hot start
library_generation_pcr_number_cycles: 15
extraction_protocol_type_of_sonicator: NA
Extracted molecule genomic DNA
Extraction protocol Library construction protocol: Smith et al., Methods 48, 226-232
 
Library strategy Bisulfite-Seq
Library source genomic
Library selection Reduced Representation
Instrument model Illumina Genome Analyzer IIx
 
Description sample_term_id: NTR_0000838
assay_term_id: OBI_0001862
nucleic_acid_term_id: SO_0000352
Design description: RRBS REMC Sequencing on Illumina
Library name: RRBS747
EDACC Genboree Experiment Page:
http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FBroad%2FEXPERIMENT%2FEDACC.6032
EDACC Genboree Sample Page:
http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FBroad%2FSAMPLE%2FEDACC.6042
****************
For data usage terms and conditions, please refer to:
http://www.drugabuse.gov/funding/funding-opportunities/nih-common-fund/epigenomics-data-access-policies
****************
Data processing **********************************************************************

ANALYSIS FILE NAME: GSM669901_BI.H9.RRBS.RRBS747-748.wig
ANALYSIS CENTER: EDACC
ANALYSIS ALIAS: RRBS747-RRBS748.hg19.level.2
ANALYSIS TITLE: Methylation Proportion Graphs of H9 Cell Line RRBS Data
ANALYSIS DESCRIPTION: Illumina RRBS read mappings from the H9 Cell Line, Libraries RRBS747-748 were processed into graphs of methylation proportions. Methylation proportions were calculated as (methylated calls / (methylated calls + unmethylated calls)) for all CpGs covered by at least 4 reads.
ANALYSIS TYPE: ABUNDANCE_MEASUREMENT
EDACC Genboree Analysis Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FEDACC%2FANALYSIS%2FEDACC.6841
DATA_ANALYSIS_LEVEL: 2
EXPERIMENT_TYPE: Reduced Representation Bisulfite-Seq
GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19 MspI restriction fragments 40-220bp
SOFTWARE: In house programs and scripts
SOFTWARE_VERSION: NA
READ_EXTENSION: 0bp
TREATMENT_OF_IDENTICAL_ALIGNMENTS_OF_MULTIPLE_READS: None
GENOMIC_WINDOW: 2bp containing CpGs
TREATMENT_OF_REGIONS_PRONE_TO_MULTIPLE_ALIGNMENTS: None
RELEASE_NUMBER: Human Epigenome Atlas 3
BROWSER_TRACK_NAME: H9 RRBS 47
BROWSER_TRACK_DESCRIPTION: BI H9 Cell Line RRBS Libraries RRBS747-748 EA Release 3
BISULFITE_CONVERSION_PERCENTAGE_BASED_ON_MAPPINGS: 98.9

**********************************************************************

 
Submission date Feb 07, 2011
Last update date May 15, 2019
Contact name BROAD INSTITUTE
E-mail(s) rharris1@bcm.tmc.edu
Organization name Broad Institute
Street address -
City Cambridge
State/province MA
ZIP/Postal code 02142
Country USA
 
Platform ID GPL10999
Series (1)
GSE25246 BI Human Reference Epigenome Mapping Project: Characterization of DNA methylation by RRBS
Relations
SRA SRX040947
BioSample SAMN00205664
Named Annotation GSM669901_BI.H9.RRBS.RRBS747-748.wig.gz

Supplementary file Size Download File type/resource
GSM669901_BI.H9.RRBS.RRBS747-748.wig.gz 13.4 Mb (ftp)(http) WIG
SRA Run SelectorHelp
Raw data not provided for this record
Processed data provided as supplementary file
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap