NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM6539661 Query DataSets for GSM6539661
Status Public on Sep 27, 2022
Title G648_MNase_NP40_3m_(20220614_TB_Mv_G648_Mnase_3m)
Sample type SRA
 
Source name MNase-seq
Organism Marseillevirus marseillevirus
Characteristics strain: G648
source: DNA from MNase-digested chromatin
Extracted molecule genomic DNA
Extraction protocol MNase-extraction_TB2021.pdf
Library_Preparation_TB2021.pdf
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model NextSeq 2000
 
Description MNase-seq of G648 after 3 min in NP40
Data processing Genome_build: G648_genome.fasta
1. We used cutadapt 2.9 with parameters "--nextseq-trim 20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Z" to trim adapters off 50bp paired-end reads. 2. We used Bowtie2 2.4.2 with options "--very-sensitive-local --soft-clipped-unmapped-tlen --dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to map the trimmed reads to the reference sequence: Marseillevirus marseillevirus G648 (Genome_G648.fasta) or Widom 601 7-copy array with 12-bp linkers in pUC19 cleaved with BamHI and KpnI (pUC19-601x7_KpnI.fasta). 3. We extracted properly paired reads from the alignments with bedtools bamtobed to generate a bed file of aligned fragments (Supplementary file fragments.bed.gz). 4. We used bedtools genomecov to make a normalized count bigwig file. Normalized counts are the fraction of counts at each base pair scaled by the size of the reference sequence so that if the scaled counts were uniformly distributed there would be 1 at each position (Supplementary file normalized_counts.bigwig).
 
Submission date Sep 02, 2022
Last update date Sep 29, 2022
Contact name Jorja Henikoff
E-mail(s) jorja@fhcrc.org
Phone 206-667-4850
Organization name Fred Hutchinson Cancer Research Center
Department Basic Sciences
Lab Henikoff
Street address 1100 Fairview AV N, A1-162
City Seattle
State/province WA
ZIP/Postal code 98109-1024
Country USA
 
Platform ID GPL32629
Series (1)
GSE193224 A giant virus genome is densely packaged by stable nucleosomes
Relations
BioSample SAMN30648537
SRA SRX17408758

Supplementary file Size Download File type/resource
GSM6539661_G648_MNase_NP40_3m.fragments.bed.gz 90.3 Mb (ftp)(http) BED
GSM6539661_G648_MNase_NP40_3m.normalized_counts.bigwig 2.8 Mb (ftp)(http) BIGWIG
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap