NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM6539656 Query DataSets for GSM6539656
Status Public on Sep 27, 2022
Title 601_Xl4_MPE_(20220819_TB_601_Xl4_MPE_20220801)
Sample type SRA
 
Source name MPE-seq
Organism synthetic construct
Characteristics source: DNA from MPE-digested chromatin
Extracted molecule genomic DNA
Extraction protocol MPE-extraction_TB2021.pdf
Library_Preparation_TB2021.pdf
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model NextSeq 2000
 
Description MPE-seq of Xenopus on 601x7_12bp-linker_pUC19 3:2 histone:DNA ratio
Widom 601 7-copy array with 12-bp linkers in pUC19 cleaved with BamHI and KpnI
Data processing Genome_build: pUC19-601x7_KpnI.fasta
1. We used cutadapt 2.9 with parameters "--nextseq-trim 20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Z" to trim adapters off 50bp paired-end reads. 2. We used Bowtie2 2.4.2 with options "--very-sensitive-local --soft-clipped-unmapped-tlen --dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to map the trimmed reads to the reference sequence: Marseillevirus marseillevirus G648 (Genome_G648.fasta) or Widom 601 7-copy array with 12-bp linkers in pUC19 cleaved with BamHI and KpnI (pUC19-601x7_KpnI.fasta). 3. We extracted properly paired reads from the alignments with bedtools bamtobed to generate a bed file of aligned fragments (Supplementary file fragments.bed.gz). 4. We used bedtools genomecov to make a normalized count bigwig file. Normalized counts are the fraction of counts at each base pair scaled by the size of the reference sequence so that if the scaled counts were uniformly distributed there would be 1 at each position (Supplementary file normalized_counts.bigwig).
 
Submission date Sep 02, 2022
Last update date Sep 29, 2022
Contact name Jorja Henikoff
E-mail(s) jorja@fhcrc.org
Phone 206-667-4850
Organization name Fred Hutchinson Cancer Research Center
Department Basic Sciences
Lab Henikoff
Street address 1100 Fairview AV N, A1-162
City Seattle
State/province WA
ZIP/Postal code 98109-1024
Country USA
 
Platform ID GPL32628
Series (1)
GSE193224 A giant virus genome is densely packaged by stable nucleosomes
Relations
BioSample SAMN30648542
SRA SRX17408753

Supplementary file Size Download File type/resource
GSM6539656_601_Xl4_MPE.fragments.bed.gz 17.8 Mb (ftp)(http) BED
GSM6539656_601_Xl4_MPE.normalized_counts.bigwig 75.1 Kb (ftp)(http) BIGWIG
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap