 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 22, 2022 |
| Title |
WT_restingBcells_rep1 [miRNA-seq] |
| Sample type |
SRA |
| |
|
| Source name |
Spleen
|
| Organism |
Mus |
| Characteristics |
tissue: Spleen
cell type: B cell
genotype: Ago2+/+
molecule type: small RNA
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Resting primary B cells were isolated from mouse spleens by negative selection using Mouse CD43 (Untouched™ B Cells; Invitrogen). Cells were used immediately after isolation.
QIAseq miRNA Library kit (Qiagen)
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
NextSeq 2000 |
| |
|
| Data processing |
Raw reads were processed using cutadapt v4.0 (Martin, 2011) and umitools v1.1.2 (Smith et al., 2017). Briefly, Illumina Universal Adaptor sequences were removed from the 3’ end of the read with ‘cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -m 20 -q 10 -j 12 --discard-untrimmed -o sample_step1.fastq.gz --quiet sample.fastq.gz’. A unique molecular identifier (UMI) of 12 random base pairs was removed from the 3’ end of the read and added to the read header using ‘umi_tools extract --3prime --stdin= sample_step1.fastq.gz --bc-pattern=NNNNNNNNNNNN --stdout= sample_step2.fastq.gz ’. Adaptor sequences were removed from the 5’ end of reads using ‘cutadapt -g GTTCAGAGTTCTACAGTCCGACGATC -m 20 -j 12 -o sample_step3.fastq.gz --quiet sample_step2.fastq.gz’. The remainder 3’adaptor sequence was removed with ‘cutadapt -a AACTGTAGGCACCATCAAT -m 10 -q 10 -j 12 --discard-untrimmed -o Processed_sample.fastq.gz --quiet sample_step3.fastq.gz’. Processed reads were mapped to the mm10 genome with STAR v2.7.9a with the parameters ‘STAR --readFilesIn Processed_sample.fastq.gz --genomeDir mm10 --runThreadN 12 --genomeLoad LoadAndRemove --limitBAMsortRAM 20000000000 --readFilesCommand zcat --outSAMtype BAM SortedByCoordinate --outReadsUnmapped Fastx --outFilterMismatchNmax 1 --outFilterMismatchNoverLmax 1 --outFilterMismatchNoverReadLmax 1 --outFilterMatchNmin 16 --outFilterMatchNminOverLread 0 --outFilterScoreMinOverLread 0 --outFilterMultimapNmax 5000 --winAnchorMultimapNmax 5000 --seedSearchStartLmax 30 --alignTranscriptsPerReadNmax 30000 --alignWindowsPerReadNmax 30000 --alignTranscriptsPerWindowNmax 300 --seedPerReadNmax 3000 --seedPerWindowNmax 300 --seedNoneLociPerWindow 1000 --outFilterMultimapScoreRange 0 --alignIntronMax 1 --alignSJDBoverhangMin 999999999999’ as previously described for transposons (Teissandier et al., 2019). Duplicates of mapped reads were removed based on the UMI sequence using umitools, and fastq files generated from deduplicated mapped reads using samtools v1.15 (Danecek et al., 2021). Fastq files from deduplicated reads were re-mapped to the consensus sequence of mouse retrotransposon elements as above. These consensus sequences were downloaded from the SalmonTE github repository (https://github.com/hyunhwan-jeong/SalmonTE/blob/master/reference/mm/mm.fa) which is derived from RepBase v22.06.
Assembly: mm10
Supplementary files format and content: wig
|
| |
|
| Submission date |
Jul 19, 2022 |
| Last update date |
Jul 22, 2022 |
| Contact name |
Joana A Vidigal |
| E-mail(s) |
joana.vidigal@nih.gov
|
| Phone |
240-760-6691
|
| Organization name |
NIH/NCI
|
| Department |
LBMB
|
| Lab |
Vidigal
|
| Street address |
37 Convent Dr, Room 6056
|
| City |
Bethesda |
| State/province |
MD |
| ZIP/Postal code |
20892-0001 |
| Country |
USA |
| |
|
| Platform ID |
GPL32258 |
| Series (2) |
| GSE203049 |
AGO2 silences mobile transposons in the nucleus of quiescent cells |
| GSE208572 |
AGO2 silences mobile transposons in the nucleus of quiescent cells [miRNA-seq] |
|
| Relations |
| BioSample |
SAMN29831217 |
| SRA |
SRX16346544 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6351519_WT1_allSIZES_TE_consensus_Signal.UniqueMultiple.str1.out.wig.gz |
451.9 Kb |
(ftp)(http) |
WIG |
| GSM6351519_WT1_allSIZES_TE_consensus_Signal.UniqueMultiple.str2.out.wig.gz |
494.5 Kb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
