 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 28, 2023 |
| Title |
CHi-C of wt stembryos at 120h |
| Sample type |
SRA |
| |
|
| Source name |
stembryo
|
| Organism |
Mus musculus |
| Characteristics |
tissue: stembryo
cell type: mES cells
genotype: wt
stage (in_hours_after_aggregation): 120
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Collected stembryos were pooled and fixed for 10 min in 1% formaldehyde at room temperature and stored at -80°C until further use.
Lysis was performed with TissueLyser II and metallic beads for 30 sec at 30 hertz before incubation at 4° for 30 min. The rest of the protocol for the capture Hi-C library generation is described in (Bolt et al., 2021). The costume SureSelectXT RNA probe used for DNA capture covers the region chr2:72240000-76840000 (mm9).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
All scripts are available on https://github.com/lldelisle/scriptsForRekaikEtAl2022
TruSeq adapters were removed with cutadapt (Martin et al 2011) version 1.16 (-a 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' -A 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT').
Trimmed reads were processed with HiCUP version 0.6.1 (doi: 10.12688/f1000research.7334.1) with default paramters on mm10 or on the corresponding mutant genome.
The output BAM was converted to Juicebox format thanks to a custom python script available in https://testtoolshed.g2.bx.psu.edu/repository/download?repository_id=be5040251cd4afb7&changeset_revision=44365a4feb3b&file_type=gz
Only pairs with both mates falling into the capture region (mm10:chr2:72402000-77000000) and with both mates with quality above 30 were kept.
Filtered pairs were loaded into 2kb and 5kb matrices with cooler version 0.7.4 (Abdennur, N., and Mirny, L. (2019), https://doi.org/10.1093/bioinformatics/btz540).
The matrices were balanced with cooler balance (--cis-only).
For the mutant Del(subTAD1), the balancing was done with the option --ignore-diags 5 instead of --ignore-diags 2 to discard the bias due to the presence of a BAC containing the region (mm10:chr2:74747769-74913171).
Assembly: mm10 for wt samples and Del(CBS*) samples and mutant genomes for Del(d1-d4) and Del(sub-TAD1)
Supplementary files format and content: *_validPairs_*.txt.gz: all valid pairs from HiCUP in juicebox format (<readname> <str1> <chr1> <pos1> <frag1> <str2> <chr2> <pos2> <frag2> <mapq1> <mapq2> str = strand (0 for forward, anything else for reverse) pos = middle of the fragment)
Supplementary files format and content: *_*kb_Balanced_*.cool: balanced matrix at 2 or 5kb-bins only in the captured region
Library strategy: Capture Hi-C
|
| |
|
| Submission date |
Jun 09, 2022 |
| Last update date |
Apr 28, 2023 |
| Contact name |
Lucille Lopez-Delisle |
| E-mail(s) |
lucille.delisle@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE205778 |
Sequential and directional insulation by conserved CTCF sites underlies the Hox timer in stembryos [cHi-C] |
| GSE205783 |
Sequential and directional insulation by conserved CTCF sites underlies the Hox timer in stembryos |
|
| Relations |
| BioSample |
SAMN28944786 |
| SRA |
SRX15652897 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6226227_wt_120h_CHiC_2kb_Balanced_mm10.cool.gz |
7.1 Mb |
(ftp)(http) |
COOL |
| GSM6226227_wt_120h_CHiC_5kb_Balanced_mm10.cool.gz |
3.9 Mb |
(ftp)(http) |
COOL |
| GSM6226227_wt_120h_CHiC_validPairs_mm10.txt.gz |
642.1 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
