 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 05, 2022 |
| Title |
Exp2 10x Genomics Gene Expression |
| Sample type |
SRA |
| |
|
| Source name |
Single-cell RNA-Seq of mouse pancreatic adenocarcinoma in pancreas and peritoneum
|
| Organism |
Mus musculus |
| Characteristics |
cancer type: Pancreatic adenocarcinoma
organ: Pancreas_Peritoneum
method: 10x Genomics Gene Expression
|
| Growth protocol |
For mouse pancreatic adenocarcinoma, Rag1-_- and WT C57BL_6 mice were obtained from Jackson Laboratories (Bar Harbor, ME). The KrasG12D;Tp53R172H;Pdx1Cre (KPC) derived cell line FC1242 was utilized for orthotopic injection of 100,000 cells into the tail of pancreata of 8-12 week old C57BL_6 or Rag mice. To model liver and peritoneal metastases, mice received FC1242 via splenic (1,000,000 cells) and intraperitoneal (100,000 cells) injection, respectively. Tumors were harvested 2-3 weeks after injection.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For inDrop single-cell RNA-Seq of patient tumor samples, cell suspension was generated from minced tumor tissue using human tumor dissociation kit (Miltenyi) prior to droplet encapsulation and individual barcoding of cells using the inDrop platform. Cell lysis was performed in droplets to release RNA, and reverse transcription and barcoding took place in droplets at 50C for 2h. For 10x Genomics spatial transcriptomics of patient tumor samples, 10 µm cryosections were mounted onto spatially barcoded arrays where reverse transcription of cellular transcripts took place in situ after tissue permeabilisation for 12 minutes. For 10x Genomics single-cell RNA-Seq of mouse tumors, cell suspension was generated from minced tumor tissue using the mouse tumor dissociation kit (Miltenyi) enzymes D and R prior to droplet encapsulation and individual barcoding of cells using the 10x Genomics platform.
For inDrop single-cell RNA-seq library construction, we followed the inDrop library construction protocol detailed by Klein et al, Cell 2015, with minor changes. Briefly, RNA was reverse transcribed (RT) with SuperScript III (Invitrogen) in droplets. Droplet emulsions were broken, and post-RT material underwent second strand syntehsis and in vitro transcription using the T7 High Yield Enzyme mix (New England BiolaBS). RNA was fragmented for 105 seconds with 1X fragmentation reagent (1CellBio) prior to RT with random hexamers, eliminating the need for an adaptor ligation step. Cycles required for final library amplification was assessed by quantitative PCR (qPCR) with KAPA HiFi Hot Start PCR Mix (KAPA Biosystems) and EvaGreen dye (Biotium). Final libraries were amplified with KAPA HiFi Hot Start PCR mix for 9 to 13 cycles. inDrop library size assessed on a DNA BioAnalyzer chip following the manufacturer's instructions (Agilent). For 10x Genomics spatial transcriptomic and single-cell RNA-Seq library construction, we followed the manufacturer's instructions.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Illumina RTA v2 software was used for basecalling and quality determination.
Raw sequencing data obtained from the inDrop scRNA-Seq method were processed using a custom-built pipeline, available online (https:__github.com_flo-compbio_singlecell). Briefly, the “W1” adapter sequence of the inDrop RT primer was located in the barcode read (the second read of each fragment), by comparing the 22-mer sequences starting at positions 9-12 of the read with the known W1 sequence (“GAGTGATTGCTTGTGACGCCTT”), allowing at most two mismatches. Reads for which the W1 sequence could not be located in this way were discarded. The start position of the W1 sequence was then used to infer the length of the first part of the inDrop cell barcode in each read, which can range from 8-11 bp, as well as the start position of the second part of the inDrop cell barcode, which always consists of 8 bp. Cell barcode sequences were mapped to the known list of 384 barcode sequences for each read, allowing at most one mismatch. The resulting barcode combination was used to identify the cell from which the fragment originated. Finally, the UMI sequence was extracted, and reads with low-confidence base calls for the six bases comprising the UMI sequence (minimum PHRED score less than 20) were discarded. The reads containing the mRNA sequence (the first read of each fragment) were mapped by STAR 2.5.1 with parameter “—outSAMmultNmax 1” and default settings otherwise36. Mapped reads were split according to their cell barcode and assigned to genes by testing for overlap with exons of protein-coding genes.
Raw sequencing data obtained from the 10x Genomics Visium method were processed using the SpaceRanger pipeline.
Raw sequencing data obtained from the 10x Gene Expression method were processed using the CellRanger pipeline.
Assembly: hg38, mm10
Supplementary files format and content: for inDrop single-cell RNA-Seq data: genes as rows and cells as columns. For 10x Genomics spatial transcriptomic data: output of SpaceRanger pipeline, including gene expression and spatial contents. For 10x Genomics single-cell RNA-Seq: output of CellRanger pipeline, including gene expression, features and barcodes.
|
| |
|
| Submission date |
May 23, 2022 |
| Last update date |
Aug 06, 2022 |
| Contact name |
Dalia Barkley |
| E-mail(s) |
dalia.barkley@nyulangone.org
|
| Organization name |
NYU Langone Health
|
| Department |
Institute for Computational Medicine
|
| Lab |
Yanai
|
| Street address |
435 E 30th st
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10016 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE203612 |
Cancer cell states recur across tumor types and form specific interactions with the tumor microenvironment |
|
| Relations |
| BioSample |
SAMN28600483 |
| SRA |
SRX15419214 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6177627_Exp2_PancreasPeritoneum_barcodes.tsv.gz |
49.6 Kb |
(ftp)(http) |
TSV |
| GSM6177627_Exp2_PancreasPeritoneum_features.tsv.gz |
272.9 Kb |
(ftp)(http) |
TSV |
| GSM6177627_Exp2_PancreasPeritoneum_matrix.mtx.gz |
115.4 Mb |
(ftp)(http) |
MTX |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
