NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM6127497 Query DataSets for GSM6127497
Status Public on Apr 26, 2023
Title Fhl1_R1
Sample type SRA
 
Source name bound fragments from in vitro library
Organism synthetic construct
Characteristics round: 1
protein: Fhl1
Extracted molecule genomic DNA
Extraction protocol The protein of interest was incubated with the randomized library and run on a non-denaturing polyacrylamide gel at 4 ⁰C. Bound fragments were excised and purified using phenol:chloroform:isoamyl extraction. An aliquot was then used for an additional round of selection and extraction. Illumina adapters and barcodes and were then added to the selected libraries usng 4 cycle PCR, and samples were sent for sequencing.
A hand-mixed library containing a 16 bp randomized region was ordered from IDT with standard desalting. The library was made double stranded using the Klenow reaction.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina HiSeq 2500
 
Data processing library strategy: SELEX-seq
Fixed adapters are trimmed using cutadapt v2.10, leaving only bases of the 16 bp variable region (Test Samples: cutadapt -g ^CGC -a CCTGGAATTCTCGGGTGCCAAGGAACTCCAG$ -O 10 -n 2 --discard-untrimmed --max-n 0 -m 16 -M 16; Production Samples: cutadapt -g ^CAG -a TCCGTATCGCTCCTCCAATG$ -O 10 -n 2 --discard-untrimmed --max-n 0 -m 16 -M 16)
Unexpected runs of cytidine were present in the Fhl1 samples, reads with runs of at least 7 cytidines were removed
The relative enrichment of various length k-mers are calculated using the same process as the SELEX package on bioconductor, the square root of the enrichment is provided for R2 samples
Supplementary files format and content:
tsv files that can be easily viewed in excel or a text editor of your choice
folders of tsv files are archived and compressed into tar.gz format
 
Submission date May 10, 2022
Last update date Apr 26, 2023
Contact name Remo Rohs
Organization name University of Southern California
Department Quantitative and Computational Biology
Lab Rohs Lab
Street address 1050 Childs Way
City Los Angeles
State/province CA
ZIP/Postal code 90089
Country USA
 
Platform ID GPL19604
Series (1)
GSE178811 DNA Binding Specificities of Fkh1, Fkh2, Hcm1, and Fhl1 Revealed by SELEX-seq
Relations
BioSample SAMN28175798
SRA SRX15222299

Supplementary file Size Download File type/resource
GSM6127497_Fhl1_R1_affinities.tsv.tar.gz 32.5 Mb (ftp)(http) TAR
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap