|
| Status |
Public on Apr 19, 2022 |
| Title |
LPI_smart_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Oocyte
|
| Organism |
Mus musculus |
| Characteristics |
genotype: WT
developmental stage: Late prometaphase I oocyte
molecule: polyA RNA
|
| Extracted molecule |
total RNA |
| Extraction protocol |
To obtain oocytes or preimplantation embryos, 8-weeks-old or 5-weeks-old C57BL/6 female mice were intraperitoneally injected with pregnant mare’s serum gonadotropin (PMSG; 5 IU) and human chorionic gonadotrophin (hCG; 5 IU). Preimplantation embryos were collected from 5-weeks-old C57BL/34 female mice mated with PWK/PhJ male mice.
The RNA-seq libraries were generated using the Smart-seq2 protocol as described previously
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 1500 |
| |
|
| Description |
LPI_smart_rep1_10bp_rpkm.bw
|
| Data processing |
Ribo-lite reads were trimmed with cutadapt v1.14 with parameters: cutadapt --trim-n -a GATCGGAAGAGCACACGTCTG -a AGAGCACACGTCTG <input.file> | cutadapt -u 3 -a A{100} --no-indels -e 0.16666666666666666 - | cutadapt -O 8 --match-read-wildcards -g GTTCAGAGTTCTACAGTCCGACGATCSSS -m 18 - -o <output.file> , and the trimmed reads were sequentially mapped to mouse/human rRNAs sequences (mm9/hg19) using Bowtie2 v2.2.2 with parameters --seedlen=23. Those aligned to rRNA were discarded, and the rest reads were mapped to transcriptome of mm9/hg19 using STAR v2.5.3a with parameters --outFilterMismatchNmax 2 --outFilterMultimapNmax 20 --outFilterMatchNmin 16 --alignEndsType EndToEnd. The gene expression level was then calculated by Cufflinks v2.2.1 based on the annotation of CDS region。
All mRNA-seq data were trimmed by Trim Galore v0.4.2 then mapped to transcriptome of mm9/hg19 by STAR v2.5.3a with parameters --outFilterMultimapNmax 20 --outSAMstrandField intronMotif. The gene expression level was calculated by Cufflinks v2.2.1.
After sequencing, CCS reads were extracted. The CCS reads were further split into different samples based on barcode and trimmed into clean reads. (The uploaded data are splitted and trimmed already). The clean reads were aligned to the mm9 genome using minimap. The poly(A) tail length of each transcript was calculated by the length of the clipped sequence. The poly(A) tail length of a gene was presented by the genomic mean of the poly(A) tail length of all the transcript as described44. For MII poly(A) tail length analysis, we merged WT and Btg4+/- data as MII control poly(A) tail length data to increase data depth after confirming their similarity.
Assembly: mm9
|
| |
|
| Submission date |
Apr 07, 2022 |
| Last update date |
Apr 19, 2022 |
| Contact name |
Zhuqing Xiong |
| E-mail(s) |
lexizqxiong@gmail.com
|
| Organization name |
School of Life Science, Tsinghua Univers
|
| Street address |
Haidian District
|
| City |
Beijing |
| State/province |
FOREIGN |
| ZIP/Postal code |
100084 |
| Country |
China |
| |
|
| Platform ID |
GPL18480 |
| Series (1) |
| GSE165782 |
Ultrasensitive Ribo-seq reveals translational landscapes during mammalian oocyte-to-embryo transition and pre-implantation development |
|
| Relations |
| BioSample |
SAMN27404770 |
| SRA |
SRX14778637 |
