NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM6001435 Query DataSets for GSM6001435
Status Public on Sep 27, 2022
Title G648_NP40_MPE_PE50_(20220324_TB_Mv_G648_10uM_MPE_2SCU_20210831)
Sample type SRA
 
Source name MPE-seq of G648
Organism Marseillevirus marseillevirus
Characteristics strain: G648
description: DNA from MPE-digested chromatin
Extracted molecule genomic DNA
Extraction protocol MPE-extraction_TB2021.pdf
viral DNA
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina NextSeq 500
 
Data processing Library strategy: MPE-seq
Genome_build: G648_genome.fasta
1. We used cutadapt 2.9 with parameters "--nextseq-trim 20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Z" to trim adapters off 50bp paired-end reads. 2. We used Bowtie2 2.4.2 with options "--very-sensitive-local --soft-clipped-unmapped-tlen --dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to map the trimmed reads to the reference sequence (Marseillevirus marseillvirus strain T19 or Marseillevirus marseillvirus strain G648 or 3 copies of the artificial sequence Widom 601). 3. We extracted properly paired reads from the alignments with bedtools bamtobed to generate a bed file of aligned fragments (Supplementary file fragments.bed.gz). 4. We used bedtools genomecov to make a normalized count bigwig file. Normalized counts are the fraction of counts at each base pair scaled by the size of the reference sequence so that if the scaled counts were uniformly distributed there would be 1 at each position (Supplementary file normalized_counts.bigwig).
 
Submission date Apr 01, 2022
Last update date Sep 29, 2022
Contact name Jorja Henikoff
E-mail(s) jorja@fhcrc.org
Phone 206-667-4850
Organization name Fred Hutchinson Cancer Research Center
Department Basic Sciences
Lab Henikoff
Street address 1100 Fairview AV N, A1-162
City Seattle
State/province WA
ZIP/Postal code 98109-1024
Country USA
 
Platform ID GPL32108
Series (1)
GSE193224 A giant virus genome is densely packaged by stable nucleosomes
Relations
BioSample SAMN27183533
SRA SRX14697315

Supplementary file Size Download File type/resource
GSM6001435_G648_NP40_MPE_PE50.fragments.bed.gz 41.6 Mb (ftp)(http) BED
GSM6001435_G648_NP40_MPE_PE50.normalized_counts.bigwig 2.4 Mb (ftp)(http) BIGWIG
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap