 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 16, 2022 |
| Title |
Cx3cr1-in vitro-1-pDC-5TR |
| Sample type |
SRA |
| |
|
| Source name |
A_2737_pDC_5TR
|
| Organism |
Mus musculus |
| Characteristics |
genotype/variation: Cx3cr1CreER-YFPR26FlipJump
tissue: Spleen
cell type: pDC
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Bulk RNA-Seq: RNA from sorted cells was extracted using TRIzol Plus purification kit (ThermoFisher) and cDNA libraries were prepared with the Low input Clontech SMART-seq HT with Nxt HT. Flip-Jump-Seq (MiSeq): Genomic DNA was extracted by NucleoSpin Tissue XS (Takara) (< 15,000 cells) or QIAamp Mini kit (> 15,000 cells). Extracted DNA was further amplified with REPLI-g Mini Kit (Qiagen) for whole genome amplification (WGA).Three-arm LM-PCR-based method was optimized and adapted to clone FlipJump transposon integration sites from both 3TR and 5TR ends. Amplified DNA was quantified using Qubit 2.0 fluorometer (Thermo Fisher), and 1 ug was digested separately with MspI, HindIII or HaeIII for 5TR cloning, and MspI, DpnII or HaeIII for 3TR cloning. The digested DNA was purified using QIAquick PCR Purification Kit. To prepare the individual LM-PCR linker mix, the equal volume of 50 uM linker common (long strand)(5’ GACCCGGGAGATCTGAATTCAGTGGCACAGCAGTTAGGGGGCTGGTCG 3’) and 50 uM restriction enzyme (RE)-digested end-specific linker (Blunt end linker /5Phos/CGACCAGCCC/3AmMO/ for HaeIII or CG end linker /5Phos/CGCGACCAGCCC/3AmMO/ for MspI or GATC end linker/5Phos/GATCCGACCAGCCC/3AmMO/ for DpnII or AGCT end linker/5Phos/AGCTCGACCAGCCC/3AmMO/ for HindIII were mixed in a PCR tube. The linker mix was then denatured and annealed by heating it to 95° C for 5 mins and cooling slowly to room temperature. One third of purified digested DNA was ligated with the individual LM-PCR linker mix using PfuTurbo Hotstart DNA Polymerase (Agilent Technologies). The ligation reaction was then digested with EcoRV (internal RE site of PB at 5TR direction) or MluI (internal RE site of PB at 3TR direction) to remove any linker that has ligated onto the 5TR or 3TR end of DNA, respectively. The remaining DNA containing MspI, HindIII and HaeIII linkers were pooled for 5TR sampling and the remaining DNA containing MspI, DpnII and HaeIII were pooled for 3TR processing. The pooled DNA was set up for PCR amplification using linker primer 1 (5’ GACCCGGGAGATCTGAATTC3’) and TR-specific biotinylated primers (LM_5TR_inver_A2: /5Biosg/AGATAATCATGCGTCATTTTGACTCAC or LM_3TR_inverA: /5Biosg/TCGATATACAGACCGATAAAACACATG). Biotinylated PCR products were pulled down using Dynabeads kilobaseBINDER kit at room temperature for 4 hours. Further nested PCR amplification was conducted using a primer that was specific for 5TR (LM_5TR_inver_B2: AGCGGCGACTGAGATGTCC) or 3TR (LM_3TR_inverB: ATGCGTCAATTTTACGCATGATTATC), and a Miseq sequencing index primer (Supplementary Table 5) containing individual sample barcode. The PCR products were tagged with modified P5 and P7 primers for sequencing.
RNA and DNA libraries were prepared for sequencing using standard Illumina protocols
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
Base calling and demultiplexing was performed using Illumina bcl2fastq software.
RNA-Seq reads were mapped to mm10 using STAR guided by GTF and read counting performed using HT-seq to make count tables
BAM to bedgraph performed using bedtools bedgraph to bigwig performed using bedGraphToBigWig v4
FlipJump-seq reads were trimmed using cutadapt and mapped using bowtie2, all the BAM files were merged to find all the peaks on all files and count tables were made for each BAM files using BEDTools
For FlipJump: bowtie2 -x ${Ref_DIR} -1 ${R1} -2 ${R2} --end-to-end -D 10 -R 2 -N 0 -L 22 -i S,0,2.50 -X 1000 | samtools view -Sb - > BAMs/${File_Name}.bam
For FlipJump: bedtools coverage -counts -b BAMtoBED.bed -a Peaks.bed > CounTable.bed
Genome_build: mm10
Supplementary_files_format_and_content: BigWig (.bw), count tables (.txt)
|
| |
|
| Submission date |
Jan 14, 2022 |
| Last update date |
Feb 17, 2022 |
| Contact name |
Alireza Khodadadi-Jamayran |
| Organization name |
New York University, NYU Langone Medical Center
|
| Department |
Division of Advanced Research Technologies (DART)
|
| Lab |
Applied Bioinformatics Laboratories (ABL)
|
| Street address |
550 1st Ave, MSB 304
|
| City |
New York City |
| State/province |
NY |
| ZIP/Postal code |
10016 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (1) |
| GSE193733 |
Clonal lineage tracing reveals shared origin of conventional and plasmacytoid dendritic cells |
|
| Relations |
| BioSample |
SAMN25003464 |
| SRA |
SRX13790929 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5819525_A_2737_pDC_5TR_TTGATCC-counts.txt.gz |
90.7 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
