|
| Status |
Public on May 29, 2012 |
| Title |
Introgression line IL8-1D |
| Sample type |
SRA |
| |
|
| Source name |
young seedlings aerial tissue
|
| Organism |
Solanum lycopersicum x Solanum pennellii |
| Characteristics |
cell line: Introgression line IL8-1D lycopersicum background, penellii introgression
tissue: young seedlings aerial tissue
3'adapter: TCGTATGCCGTCTTCTGCTTGT
|
| Treatment protocol |
Small RNAs were isolated from different lines of 2 week old Tomato seedlings.
|
| Growth protocol |
Tomato seedlings were grown in Conviron growth chambers at 23'C, 60% RH and 16/8 light cycle in high nutrient compost.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted using Trizol (Invitrogen) and small RNA fraction was separated by PAGE gel. Adapter sequences appropriate for Illumina sequencing were ligated.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Data processing |
Sequence reads were obtained using the Illumina Genome Analyzer Pipeline. The 3 prime adaptor sequence was removed from the small RNA reads and the reads were aligned to the Tomato genome version bacs v340. Only reads with 100% match to the genome were retained.
|
| |
|
| Submission date |
Aug 11, 2010 |
| Last update date |
May 15, 2019 |
| Contact name |
Krys Kelly |
| Organization name |
University of Cambridge
|
| Department |
Plant Sciences
|
| Lab |
Baulcombe Group
|
| Street address |
Downing Street
|
| City |
Cambridge |
| ZIP/Postal code |
CB2 3EA |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL10777 |
| Series (1) |
| GSE23562 |
Small RNA profiling Tomato, wild tomato relative and series of introgression lines |
|
| Relations |
| SRA |
SRX026461 |
| BioSample |
SAMN00110638 |
