|
| Status |
Public on Aug 03, 2022 |
| Title |
AR3_mut_3 |
| Sample type |
SRA |
| |
|
| Source name |
TEC
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
tissue: TEC
age: 4.5w
genotype: Foxn1 del AR3 mut
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Thymi were removed and enzymatically dissociated with Liberase TH and DNase. HFC were trypsinized from shaved dorsal skin. HFC and TEC populations were sorted and RNA was extracted using Dynabeads. MARSseq protocol was used construction of sequencing libraries.
RNA libraries were prepared for sequencing using the MARSseq protocol (Jaitin et. Al. 2014)
Bulk Mars-Seq (3' end-RNA-seq)
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Data was processed using UTAP pipeline (Kohen et al., 2019). Bcl files were converted into fastq by bcl2fastq. Demultiplexing is done using the sample barcode found on R2, the UMI found on R2 is inserted in the read name (in R1 fastq). R1 Fastq data submitted.
Reads were trimmed using Cutadapt (parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a “A{10}” –times 2 -u 3 -u -3 -q 20 -m 25) and mapped to the Mus_musculus genome using STAR v2.4.2a (parameters: –alignEndsType EndToEnd, –outFilterMismatchNoverLmax 0.05, –twopassMode Basic, –alignSoftClipAtReferenceEnds No).
The pipeline quantifies the 3’ of Gencode annotated genes (The 3’ region contains 1,000 bases upstream of the 3’ end and 100 bases downstream). Counting proceeded over genes annotated in RefSeq release using htseq-count (union mode). Genes having minimum 5 UMI-corrected reads in at least one sample, were considered. Normalization of the counts and differential expression analysis was performed using DESeq2 package.
Differential expression analysis was performed using DESeq2 with the betaPrior set to False. Raw P values were adjusted for multiple testing using the procedure of Benjamini and Hochberg. Differentially expressed genes were defined as genes that had a significant adjusted p value of less than 0.05 and at least 2-fold change.
Genome_build: mm10
Supplementary_files_format_and_content: normalized abundance measurements and DESeq2 analysis
|
| |
|
| Submission date |
Jan 01, 2022 |
| Last update date |
Aug 03, 2022 |
| Contact name |
Jakub Abramson |
| E-mail(s) |
jakub.abramson@weizmann.ac.il
|
| Organization name |
Weizmann Institute of Science
|
| Department |
Department of Immunology
|
| Street address |
234 Herzl st.
|
| City |
Rehovot |
| ZIP/Postal code |
7610001 |
| Country |
Israel |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE192872 |
Transcriptional regulation of the thymus master regulator Foxn1 [RNAseq_AR3_vs_nude] |
| GSE192875 |
Transcriptional regulation of the thymus master regulator Foxn1 |
|
| Relations |
| BioSample |
SAMN24563429 |
| SRA |
SRX13571874 |
