 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 04, 2010 |
| Title |
Ath_col0_dsRNA_2Xribominus |
| Sample type |
SRA |
| |
|
| Source name |
unopened flower buds, wild-type, dsRNA
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
ecotype: Col-0
genotype: wild-type
tissue: unopened flower buds
target-molecules: double-stranded RNAs (dsRNAs)
rrna depletion: 2-round rRNA depletion (2X Ribominus)
rna-treatment: ssRNase (Rnase One)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA is subjected to one (1X Ribominus) or two (2X Ribominus) rounds of rRNA depletion as per manufacturer’s instructions (Ribominus, Invitrogen (Carlsbad, CA)). Next, these rRNA-depleted RNA samples are treated with a single-strand specific ribonuclease as per manufacturer’s instructions (RNase One, Promega (Madison, WI)). The RNA sample is then used as the substrate for sequencing library construction using the Small RNA Sample Prep v1.5 kit (Illumina, San Diego, CA) as per manufacturer’s instructions.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
col0_dsRNA_2Xribo
dsRNA
3' adaptor sequence: ATCTCGTATGCCGTCTTCTGCTTG
|
| Data processing |
Abundance info of NR-seq (*info.txt file): All reads are reduced to non-redundant (NR) sequences at first to minimize the computational requirement for subsequent analysis steps. Only NR-seq that can map to the Arabidopsis thaliana genome (TAIR9 assembly) are shown (either trimmed or untrimmed).
NR-seq after trimming of 3'-adapters (*seq.fasta file): In order to detect 3’-adapter sequences, all NR-sequences are aligned to the Illumina 3'-adapter version 1.5 sequence using the “cross-match” program. The alignment parameters for cross-match are carefully tuned to maintain all alignments with less than 6% mis-matches. The cross-match alignment results are parsed using in-house Perl scripts. All NR-sequences that align to ≥ 6 bp of the 3’-adapter sequence at their 3’ end are defined as short and are subsequently trimmed at the adapter-sequence boundary. The remaining NR-sequences (without detectable 3’-adapters) remain “untrimmed”. Only NR-seq that can map to the Arabidopsis thaliana genome (TAIR9 assembly) are shown.
Alignment (*loc.txt file): All trimmed and untrimmed NR-sequences are aligned to the Arabidopsis genome (TAIR9 assembly) using cross-match, with the program parameters set to guarantee all sequences that align with ≤ 6% mis-matches to the Arabidopsis genome. Alignment results for trimmed or untrimmed inputs are then parsed independently using in-house Perl scripts. More specifically, alignments for trimmed sequences are required to extend to the ends of the query sequences, whereas alignments for untrimmed sequences are only required to extend to the imaginary positions of undetectable 3’-adapters (< 6 bp from the 3’ end of the sequence). The true lengths of the untrimmed sequences are also determined in this step by the most-frequent aligned length of all possible alignments to the Arabidopsis genome. At last, trimmed and untrimmed NR-sequences, as well as their genome loci information, are combined to form the final dataset using in-house Perl scripts. The smRNA libraries are pre-processed by this balanced pipeline as well.
|
| |
|
| Submission date |
Aug 05, 2010 |
| Last update date |
May 15, 2019 |
| Contact name |
Qi Zheng |
| E-mail(s) |
qi.zheng@nemours.org
|
| Phone |
3026515778
|
| Organization name |
Nemours Children's Health
|
| Street address |
1701 Rockland Road
|
| City |
Wilmington |
| State/province |
DE |
| ZIP/Postal code |
19803 |
| Country |
USA |
| |
|
| Platform ID |
GPL9302 |
| Series (1) |
| GSE23439 |
Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
|
| Relations |
| SRA |
SRX026296 |
| BioSample |
SAMN00109967 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM575244_col0_dsRNA_2Xribo_NR_TAIR9_loc.txt.gz |
115.1 Mb |
(ftp)(http) |
TXT |
| GSM575244_col0_dsRNA_2Xribo_mapped_NR_info.txt.gz |
11.5 Mb |
(ftp)(http) |
TXT |
| GSM575244_col0_dsRNA_2Xribo_mapped_NR_seq.fasta.gz |
35.9 Mb |
(ftp)(http) |
FASTA |
SRA Run Selector |
| Processed data provided as supplementary file |
| Raw data are available in SRA |
|
|
|
|
 |
