 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 04, 2023 |
| Title |
Bdnf_4Cseq_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Cortical neurons (NPC, PMN, CN)
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
|
| Treatment protocol |
Cortical neurons were treated with 50mM KCl for 45 min before harvesting
|
| Growth protocol |
For neuronal progenitor cultures, cortices were dissected from E12.5 C57BL/6J mouse embryos in dissection buffer (2.5 mM Hepes pH 7.4, 30 mM glucose, 1 mM CaCl2, 1 mM MgSO4, 4 mM NaHCO3, 1X HBSS) supplemented with 1 U/ml Dispase I (Sigma) and 0.6 mg/ml DNase I (Sigma). Dissected cortices were digested in dissociation media (1 mM Hepes pH 7.4, 20mM glucose, 98 mM Na2SO4, 30 mM K2SO4, 5.8 mM MgCl2, 0.25 mM CaCl2, 0.001% Phenol red) supplemented with 20 U/ml of papain (Worthington) for 25 min at 37°C. After digestion, cortices were washed, dissociated and plated on Nunc dishes (Thermo Fisher Scientific) coated with 40 μg/ml poly-D-lysine (Sigma) and 2 μg/ml Laminin (BD Bioscience) in DMEM/F12 medium supplemented with 1X B27, 1X N2, 1 mM glutamine, 1 mM NaHCO3 and 10 ng/ml of bFGF (Thermo Fisher Scientific). Cells were plated more densely for NPC cultures harvested after 2 days in vitro (DIV) than for PMN cultures harvested at 7 DIV (90 mm dish for 4C-seq: NPC 2.5 x 10^6 cells, PMN 1 x 10^6 cells). For PMN cultures, after 2 DIV half of the medium was replaced with Neurobasal medium supplemented with 1X B27, 1 mM glutamine and 200 ng/ml NT3 (Alomone labs). After 5 DIV, half of the medium was replaced with Neurobasal medium supplemented with 1X B27, 1 mM glutamine, 200 ng/ml NT3 (Alomone labs) and 20 μM 5-Fluoro-2ʹ-deoxyuridine (FdU; Merck). Cells were maintained in 37°C, 5% CO2 incubators. For cortical neuron cultures, cortices were dissected from E15.5 C57BL/6J mouse embryos and dissociated as above. Neurons were cultured on Nunc dishes (Thermo Fisher Scientific) coated as above and plated in MEM supplemented with 10% fetal bovine serum, 5% horse serum, 1 mM glutamine and 1X penicillin-streptomycin. After 2-6 hours, culture medium was replaced with Neurobasal medium supplemented with 1X B27, 1 mM glutamine, 1X penicillin-streptomycin and 10 μM fluorodeoxyuridine (Merck). Cells were cultured at 37°C, 5% CO2 for 6 days, and one day before the experiment, 2/3 of the plating medium was replaced with medium lacking B27.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
4C-seq experiments were performed as described previously (Sofueva et al., 2013). To crosslink proteins with DNA, the medium was removed from neuronal cultures, and crosslinking buffer (0.1 M NaCl, 1 mM EDTA, 0.5 mM EGTA and 25 mM HEPES-KOH, pH 8.0) containing 1% formaldehyde was added for 10 min at room temperature. The cross-linking reaction was stopped by adding glycine to a final concentration of 125 mM. Cells were rinsed three times with ice-cold PBS containing protease inhibitor cocktail and 1 mM PMSF, collected by scraping and centrifuged at 3000 rpm at 4°C for 10 minutes. Cell pellets were lysed in 10 ml lysis buffer (10 mM Tris pH 8.0, 10 mM NaCl, 0.2% NP40 supplemented with protease inhibitor cocktail and 1 mM PMSF) on ice for 20 min. Nuclei were collected by centrifugation (1800 rpm, 5 min, 4oC), resuspended in 1.2X DpnII buffer and transferred to Protein LoBind tubes. SDS was added to 0.3% final concentration and nuclei were incubated 1h at 37oC in thermomixer shaking at 900 rpm (30s on, 30s off). Triton-20 was added to 2% final concentration and nuclei were incubated 1h 37oC in a thermomixer shaking at 900 rpm (30s on, 30s off). 750 Units of DpnII (NEB) was added and incubated overnight at 37oC in a thermomixer shaking at 900 rpm (30s on, 30s off). The next day, the DpnII buffer was replaced with fresh 1.2X DpnII buffer supplemented with 0.3% SDS and 2% Triton and another 750 Units of DpnII and incubated overnight at 37oC in thermomixer shaking at 900 rpm (30s on, 30s off). Samples of undigested and DpnII-digested DNA was reverse crosslinked and run on a gel to confirm that most DNA fragments were <3 kb after digestion.Nuclei were centrifuged (1800 rpm, 3 min) and washed twice with 1X T4 DNA ligase buffer before resuspending in 100 µl 1X T4 DNA ligase buffer with 1600 Units T4 DNA ligase (NEB). In nucleo ligation was carried out overnight at 16oC without shaking before confirming that high molecular weight products were obtained. Samples were then reverse crosslinked in the presence of proteinase K overnight at 65oC before phenol:chloroform extraction and ethanol precipitation. DNA was quantified using Qubit high sensitivity assays (Thermo Fisher Scientific)6-10 µg of DNA was digested with 120 Units Csp6I enzyme (Thermo Fisher Scientific) [3-5 Csp6I digests per sample] overnight at 37oC in thermomixer shaking at 900 rpm (30s on, 30s off). After confirmation that Csp6I-digested products are <3kb, Csp6I was heat inactivated at 65oC for 20 min before phenol:chloroform extraction and ethanol precipitation. DNA was resuspended in 6 ml total volume to allow proximity ligation by 1600 Units T4 DNA ligase overnight at 16oC. Samples were purified by phenol:chloroform extraction and ethanol precipitation, followed by PCR purification columns (Qiagen), before quantitation using with Qubit high sensitivity assays (Thermo Fisher Scientific).
4C-seq libraries were generated using Expand Long Template polymerase (Roche) and primers designed using the 4C-seq primer database (van de Werken et al., 2012). Forward primers were generated with the Illumina p1 sequence (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT), a two-nucleotide barcode to allow multiplexing of samples, and then the primer sequence. Reverse primers were generated with the Illumina p2 CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT). 6-10 PCRs were set up per sample to generate library diversity. PCRs were run using the following program: 3 min 94oC; then 29 cycles of 10s 94oC, 1 min 55oC, 3 min 68oC; then 10 min 68oC. PCR products were purified using the High Pure PCR product purification kit (Roche). Libraries were quantified with Qubit high sensitivity assays, assessed using the Agilent Tapestation, and run on an Illumina MiSeq (MiSeq Reagent Kit v3, 150-cycle).
4C-seq
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
trimming reads
4cseqpipe (perl, van de Werken, Nat Methods, 2012)
Genome_build: mm10
stat files (output of fastq2raw)
Supplementary_files_format_and_content: 4cseqpipe output
|
| |
|
| Submission date |
Dec 06, 2021 |
| Last update date |
Jan 04, 2023 |
| Contact name |
Emily Brookes |
| E-mail(s) |
e.brookes@ucl.ac.uk
|
| Organization name |
University College London
|
| Department |
MRC Laboratory for Molecular Cell Biology
|
| Street address |
Gower Street
|
| City |
London |
| State/province |
London |
| ZIP/Postal code |
WC1E 6BT |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL16417 |
| Series (1) |
| GSE190306 |
A novel intergenic enhancer that regulates Bdnf expression in developing cortical neurons |
|
| Relations |
| BioSample |
SAMN23707945 |
| SRA |
SRX13328812 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5719538_4C_SampleMultiplexComponents_rep1.xlsx |
12.8 Kb |
(ftp)(http) |
XLSX |
| GSM5719538_4Cseq1_2.nearcis.norm.txt.median.scales.txt.gz |
168.1 Kb |
(ftp)(http) |
TXT |
| GSM5719538_4Cseq1_3.nearcis.norm.txt.median.scales.txt.gz |
160.3 Kb |
(ftp)(http) |
TXT |
| GSM5719538_4Cseq1_4.nearcis.norm.txt.median.scales.txt.gz |
154.4 Kb |
(ftp)(http) |
TXT |
| GSM5719538_4Cseq1_5.nearcis.norm.txt.median.scales.txt.gz |
118.7 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
