GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Sample GSM5683194 Query DataSets for GSM5683194
Status Public on Mar 01, 2022
Title DSP-1010200000014-A12
Sample type SRA
Source name Human fresh frozen tonsil
Organism Homo sapiens
Characteristics slide_prep: FF
segment: CD3
roi: 11
slide: S1
molecule subtype: RNA ISH
Extracted molecule total RNA
Extraction protocol Samples were incubated with the mouse Whole Transcriptome Atlas RNA-ISH probes which were conjugated with a UV-photocleavable linker following standard ISH protocols, along with fluorescently labeled antibodies for visualization of morphological structures. Regions of interest within the tissue were illuminated with UV light and oligo barcodes were physically aspirated from the tissue and collected into microtiter plates by the GeoMx® Digital Spatial Profiler (DSP) platform. For more information about DSP protocols please see Merritt et al. Nature Biotech 2020 (doi: 10.1038/s41598-020-63539-x)
Each collection of oligo tags from one well (representing an AOI from the tissue section) was indexed with i7xi5 unique dual indexes using GeoMx SeqCode primers with 18 cycles of PCR.  After PCR, indexed AOIs were pooled and purified in two rounds of AMPure XP PCR purification using 1.2x bead:sample ratio.
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model NextSeq 2000
Data processing library strategy: GeoMx Seq
GeoMx NGS Pipeline v2.3.3.10 with the following parameters: quality-trim-score = 20, 2color-trimming = True, adapter1 = AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, adapter2 = AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT, adapter-trim-match-length = 10, adapter-trim-max-mismatch = 3, barcode-max-mismatch = 1, stitching-max-mismatch = 2
Genome_build: NA
Supplementary_files_format_and_content: Digital Count Conversion (DCC) files: format outputted from GeoMx NGS Pipeline, contains software versions, scan attributes, GeoMx NGS pipeline parameters and output metrics, Q30 scores, and list of deduplicated counts per RTS_ID (probe barcode)
Supplementary_files_format_and_content: tonsil_SampleAnnotations: txt file containing sample annotations
Supplementary_files_format_and_content: tonsil_RawCounts: txt file containing raw probe counts per sample
Supplementary_files_format_and_content: tonsil_CollapsedTargetCounts: txt file containing collapsed gene-level target counts per sample
Submission date Nov 08, 2021
Last update date Mar 02, 2022
Contact name Stephanie Zimmerman
Organization name NanoString Technologies
Street address 530 Fairview Ave N
City Seattle
State/province WA
ZIP/Postal code 98109
Country USA
Platform ID GPL30173
Series (2)
GSE188451 Spatially resolved whole transcriptome profiling in human and mouse tissue using Digital Spatial Profiling [human tonsil]
GSE190089 Spatially resolved whole transcriptome profiling in human and mouse tissue using Digital Spatial Profiling
BioSample SAMN22999057
SRA SRX13067127

Supplementary file Size Download File type/resource
GSM5683194_DSP-1010200000014-A12.dcc.gz 62.2 Kb (ftp)(http) DCC
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap