NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5640770 Query DataSets for GSM5640770
Status Public on Jan 27, 2023
Title Lung_C_02
Sample type SRA
 
Source name Rapid biopsy post-morterm lung tissue Donor CUN6/C
Organism Homo sapiens
Characteristics molecule: Oligonucleotide
individual: donor CUN6/C
tissue: post-morterm lung
disease state: COVID-19
morphology: Geometric; Alveolar morphology
severity: Moderate_Mild
sample name: Cun6_2_002
sample name_2: DSP-1012340036901-E04
title_2: Cun6_2_ROI_002_well_E04
slide id: Cun6_2
roi number: 002
segment type: Segment1
area: 217428
nuclei_counts: 886
roi x coordinate: 27628
roi y coordinate: 20790
rawreads: 6767796
alignedreads: 6314303
deduplicatedreads: 1030595
trimmedreads: 6736747.0
stitchedreads: 6650275.0
sequencingsaturation: 84.8
severity binary: Mild
proximal sars-cov-2 nucleocapsid protein: No
Extracted molecule other
Extraction protocol Samples were incubated with DNA-oligo barcoded RNA-ISH probes which were conjugated with a UV-photocleavable linker following standard ISH protocols, along with fluorescently labeled antibodies for visualization of morphological structures. Regions of interest within the tissue were illuminated with UV light and oligo barcodes were physically aspirated from the tissue and collected into microtiter plates by the GeoMx® Digital Spatial Profiler (DSP) platform. For more information about DSP protocols please see Merritt et al. Nature Biotech 2020 (doi: 10.1038/s41598-020-63539-x)
Each collection of oligo tags from one well (representing an ROI from the tissue section) was indexed with i7xi5 unique dual indexes using GeoMx SeqCode primers with 18 cycles of PCR. After PCR, indexed AOIs were pooled and purified in two rounds of AMPure XP PCR purification using 1.2x bead:sample ratio.
Samples were pooled during library preparation and split across lanes. Individual FASTQ files were generated for each lane, forward & reverse primers. The Fastq files contain the same identifier as the sample name for aggregation.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model NextSeq 2000
 
Data processing Library strategy: GeoMx Seq
save-interim-files = false
quality-trim-score = 20
2color-trimming = True
adapter1 = AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
adapter2 = AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
adapter-trim-match-length = 10
adapter-trim-max-mismatch = 3
barcode-max-mismatch = 1
stitching-max-mismatch = 2
dedup-hd = 1
threads = 4
Quality control and initial data exploration was conducted using the GeoMx DSP Analysis Suite. Sequencing quality per AOI was examined and an under-sequenced area (B_04) with zero deduplicated reads was excluded. Expression of each transcript was measured by 5 or more probes; outlier probes (geomean probe in all AOI/geomean of all probes for a transcript = <0.1; or probe failure in the Grubbs outlier test in over 20% AOIs) were excluded and the remaining probes combined to generate a single (post “biological probe QC”) expression value per gene target per AOI.
Genome_build: N/A, sequencing of synthetic tags and alignment to whitelist of RTS_IDs (probe barcodes) found in the config.ini output from the GeoMx DSP platform, see attached PKC files (Alpha_CTA_v2.0.pkc, and GeoMx_COVID19_v1.0.pkc)
Supplementary_files_format_and_content: Digital Count Conversion (DCC) file format outputted from GeoMx NGS Pipeline, contains software versions, scan attributes, GeoMx NGS pipeline parameters and output metrics, Q30 scores, and list of deduplicated counts per RTS_ID (probe barcode). Png files show the immunofluorescent microscopy image corresponding to each sample, including a white line border around the acquired areas of interest (AOIs). The multichannel rendered images show DNA in blue, CD45 in red, PanCK in green and CD68 in yellow.
Supplementary_files_format_and_content: [value definition] Values represented in the 'TargetCountMatrix' sheet of the ‘Post Biological Probe QC.xlsx’ are the geometric mean of the probes for a given target--in the case that multiple probes were used-- and excludes any targets flagged as outliers. A single sample (Cun4_2_004) was removed for sequencing failure and the absence of detected RawReads and AlignedReads. Analyzed counts in 'qn.exprs.tsv' represent quantile normalized collapsed counts for each sample in the study. Analyzed counts in 'qn.exprs.corrected.tsv' represent quantile normalized collapsed counts for each sample in the study and corrected for batch effects using the Limma "removeBatchEffect" function.
 
Submission date Oct 20, 2021
Last update date Jan 29, 2023
Contact name Amy Rachael Cross
E-mail(s) amy.cross@nds.ox.ac.uk
Organization name University of Oxford
Department NDS
Lab TRIG
Street address John Radcliffe Hospital
City Oxford
ZIP/Postal code OX38DU
Country United Kingdom
 
Platform ID GPL30173
Series (1)
GSE186213 Spatial transcriptomic characterization of the lung parenchyma during COVID-19 pneumonitis
Relations
BioSample SAMN22425896
SRA SRX12700603

Supplementary file Size Download File type/resource
GSM5640770_CUN6_C_ROI_002_merge_Segment_1.png.gz 3.1 Mb (ftp)(http) PNG
GSM5640770_DSP-1012340036901-E04.dcc.gz 32.0 Kb (ftp)(http) DCC
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap