GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Sample GSM5621965 Query DataSets for GSM5621965
Status Public on Oct 15, 2021
Title PFA fixed kidney_organoid_1
Sample type SRA
Source name PFA fixed kidney organoid
Organism Homo sapiens
Characteristics tissue: kidney organoid
sample type: PFA fixed
Treatment protocol Tissues were sectioned and placed on a glass slide followed by HE staining
Extracted molecule polyA RNA
Extraction protocol Tissues were decrosslinked and enzymatically permeabilized
RNA libraries were prepared for sequencing following the 10x Genomics Visium protocol
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model NextSeq 2000
Description V19D02-085_B1_S5
Data processing library strategy: Spatial Transcriptomics (10x Visium)
bcl2fastq command line tool was used for base calling
Sequence reads were trimmed for adapter sequence (Template Switch Oligo) and polyA homopolymers using cutadapt (-g XAAGCAGTGGTATCAACGCAGAGTACATGGG;max_error_rate=0.1 -a AAAAAAAAAA ;max_error_rate=0--overlap 5 -n 2)
Reads were mapped, annotated and demultiplexed using the spaceranger v1.0.0 command line tool
Annotated reads were quantified and mapped to the Hematoxylin and Eosin image using the spaceranger v1.0.0 command line tool
Genome_build: mm10 for Mus musculus and GRCh38 for Homo sapiens
Supplementary_files_format_and_content: Matrix with raw counts for every gene and every spot, filtered to include spots under tissue
Supplementary_files_format_and_content: Hematoxylin and Eosin (HE) image in JPG format
Supplementary_files_format_and_content: Low resolution Hematoxylin and Eosin (HE) image in PNG format
Supplementary_files_format_and_content: Scalefactors in json format
Supplementary_files_format_and_content: Table with array and pixel coordinates
Submission date Oct 12, 2021
Last update date Oct 16, 2021
Contact name Ludvig Ale Larsson
Phone +46739911122
Organization name SciLifeLab
Department Gene Technology
Street address Tomtebodavägen 23A
City Solna
State/province Stockholm
ZIP/Postal code 17165
Country Sweden
Platform ID GPL30173
Series (1)
GSE185715 Genome-wide Spatial Expression Profiling in Formalin-fixed Tissues
BioSample SAMN22224928
SRA SRX12575976

Supplementary file Size Download File type/resource
GSM5621965_V19D02-085_B1.jpg.gz 87.1 Mb (ftp)(http) JPG
GSM5621965_V19D02-085_B1_filtered_feature_bc_matrix.h5 1.1 Mb (ftp)(http) H5
GSM5621965_V19D02-085_B1_scalefactors_json.json.gz 179 b (ftp)(http) JSON
GSM5621965_V19D02-085_B1_tissue_hires_image.png.gz 3.0 Mb (ftp)(http) PNG
GSM5621965_V19D02-085_B1_tissue_positions_list.csv.gz 70.9 Kb (ftp)(http) CSV
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap